Design Results for KCNC1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (589,20)GCTCTTCGAGGACCCGTACTAmplicon SizecDNA: 92 bpgenomic: 35,184
Reverse (680,20)GGCAGAAGGTGGTGATGGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.626 kcal/mol
Forward Dimers-1.398 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.645 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTT
CTTCATCCTGGTCTCCATCACCACCTTCTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004977 (KCNC3)921129 - 1220
NM_004976 (KCNC1)92589 - 680
NM_001112741 (KCNC1)92589 - 680
Exon 1 To Exon 2 (Pair 2)
Forward (587,19)GCGCTCTTCGAGGACCCGTAmplicon SizecDNA: 73 bpgenomic: 35,165
Reverse (659,21)CCAGGATGAAGAAGAGGGAAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.351 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-0.616 kcal/mol
Forward-Reverse Dimers-2.324 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceGCGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTC
TTCTTCATCCTGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001112741 (KCNC1)73587 - 659
NM_004977 (KCNC3)711127 - 1197
NM_004976 (KCNC1)73587 - 659
Exon 1 To Exon 2 (Pair 3)
Forward (590,20)CTCTTCGAGGACCCGTACTCAmplicon SizecDNA: 81 bpgenomic: 35,173
Reverse (670,21)GGTGATGGAGACCAGGATGAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol in 3' area
Forward Dimers-1.398 kcal/mol
Reverse Loops0.745 kcal/mol in 3' area
Reverse Dimers-1.702 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTTC
TTCATCCTGGTCTCCATCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001112741 (KCNC1)81590 - 670
NM_004976 (KCNC1)81590 - 670
Exon 1 To Exon 2 (Pair 4)
Forward (589,20)GCTCTTCGAGGACCCGTACTAmplicon SizecDNA: 83 bpgenomic: 35,175
Reverse (671,21)TGGTGATGGAGACCAGGATGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.626 kcal/mol
Forward Dimers-1.398 kcal/mol
Reverse Loops0.745 kcal/mol in 3' area
Reverse Dimers-1.733 kcal/mol
Forward-Reverse Dimers-1.588 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTT
CTTCATCCTGGTCTCCATCACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004976 (KCNC1)83589 - 671
NM_001112741 (KCNC1)83589 - 671
Exon 1 To Exon 2 (Pair 5)
Forward (590,20)CTCTTCGAGGACCCGTACTCAmplicon SizecDNA: 93 bpgenomic: 35,185
Reverse (682,20)CAGGCAGAAGGTGGTGATGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol in 3' area
Forward Dimers-1.398 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.645 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTTC
TTCATCCTGGTCTCCATCACCACCTTCTGCCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004976 (KCNC1)93590 - 682
NM_004977 (KCNC3)931130 - 1222
NM_001112741 (KCNC1)93590 - 682
Exon 1 To Exon 2 (Pair 6)
Forward (590,20)CTCTTCGAGGACCCGTACTCAmplicon SizecDNA: 94 bpgenomic: 35,186
Reverse (683,20)CCAGGCAGAAGGTGGTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol in 3' area
Forward Dimers-1.398 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.645 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTTC
TTCATCCTGGTCTCCATCACCACCTTCTGCCTGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001112741 (KCNC1)94590 - 683
NM_004977 (KCNC3)941130 - 1223
NM_004976 (KCNC1)94590 - 683
Exon 1 To Exon 2 (Pair 7)
Forward (590,20)CTCTTCGAGGACCCGTACTCAmplicon SizecDNA: 91 bpgenomic: 35,183
Reverse (680,20)GGCAGAAGGTGGTGATGGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol in 3' area
Forward Dimers-1.398 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.645 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTTC
TTCATCCTGGTCTCCATCACCACCTTCTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004976 (KCNC1)91590 - 680
NM_004977 (KCNC3)911130 - 1220
NM_001112741 (KCNC1)91590 - 680
Exon 1 To Exon 2 (Pair 8)
Forward (589,20)GCTCTTCGAGGACCCGTACTAmplicon SizecDNA: 82 bpgenomic: 35,174
Reverse (670,21)GGTGATGGAGACCAGGATGAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.626 kcal/mol
Forward Dimers-1.398 kcal/mol
Reverse Loops0.745 kcal/mol in 3' area
Reverse Dimers-1.702 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTT
CTTCATCCTGGTCTCCATCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001112741 (KCNC1)82589 - 670
NM_004976 (KCNC1)82589 - 670
Exon 1 To Exon 2 (Pair 9)
Forward (590,20)CTCTTCGAGGACCCGTACTCAmplicon SizecDNA: 96 bpgenomic: 35,188
Reverse (685,20)CTCCAGGCAGAAGGTGGTGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol in 3' area
Forward Dimers-1.398 kcal/mol
Reverse Loops1.729 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.645 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTTC
TTCATCCTGGTCTCCATCACCACCTTCTGCCTGGAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004977 (KCNC3)951130 - 1224
NM_001112741 (KCNC1)96590 - 685
NM_004976 (KCNC1)96590 - 685
Exon 1 To Exon 2 (Pair 10)
Forward (587,19)GCGCTCTTCGAGGACCCGTAmplicon SizecDNA: 72 bpgenomic: 35,164
Reverse (658,21)CAGGATGAAGAAGAGGGAAGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.351 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops0.956 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-2.324 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceGCGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTC
TTCTTCATCCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001112741 (KCNC1)72587 - 658
NM_004977 (KCNC3)711127 - 1197
NM_004976 (KCNC1)72587 - 658
Exon 1 To Exon 2 (Pair 11)
Forward (589,20)GCTCTTCGAGGACCCGTACTAmplicon SizecDNA: 94 bpgenomic: 35,186
Reverse (682,20)CAGGCAGAAGGTGGTGATGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.626 kcal/mol
Forward Dimers-1.398 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.645 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTT
CTTCATCCTGGTCTCCATCACCACCTTCTGCCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004976 (KCNC1)94589 - 682
NM_001112741 (KCNC1)94589 - 682
NM_004977 (KCNC3)941129 - 1222
Exon 1 To Exon 2 (Pair 12)
Forward (587,19)GCGCTCTTCGAGGACCCGTAmplicon SizecDNA: 84 bpgenomic: 35,176
Reverse (670,21)GGTGATGGAGACCAGGATGAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.351 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops0.745 kcal/mol in 3' area
Reverse Dimers-1.702 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceGCGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTC
TTCTTCATCCTGGTCTCCATCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001112741 (KCNC1)84587 - 670
NM_004976 (KCNC1)84587 - 670
Exon 1 To Exon 2 (Pair 13)
Forward (590,20)CTCTTCGAGGACCCGTACTCAmplicon SizecDNA: 82 bpgenomic: 35,174
Reverse (671,21)TGGTGATGGAGACCAGGATGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol in 3' area
Forward Dimers-1.398 kcal/mol
Reverse Loops0.745 kcal/mol in 3' area
Reverse Dimers-1.733 kcal/mol
Forward-Reverse Dimers-1.588 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTTC
TTCATCCTGGTCTCCATCACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004976 (KCNC1)82590 - 671
NM_001112741 (KCNC1)82590 - 671
Exon 1 To Exon 2 (Pair 14)
Forward (589,20)GCTCTTCGAGGACCCGTACTAmplicon SizecDNA: 97 bpgenomic: 35,189
Reverse (685,20)CTCCAGGCAGAAGGTGGTGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.626 kcal/mol
Forward Dimers-1.398 kcal/mol
Reverse Loops1.729 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.645 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTT
CTTCATCCTGGTCTCCATCACCACCTTCTGCCTGGAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004976 (KCNC1)97589 - 685
NM_004977 (KCNC3)961129 - 1224
NM_001112741 (KCNC1)97589 - 685
Exon 1 To Exon 2 (Pair 15)
Forward (589,20)GCTCTTCGAGGACCCGTACTAmplicon SizecDNA: 95 bpgenomic: 35,187
Reverse (683,20)CCAGGCAGAAGGTGGTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.626 kcal/mol
Forward Dimers-1.398 kcal/mol
Reverse Loops1.757 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.645 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTT
CTTCATCCTGGTCTCCATCACCACCTTCTGCCTGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004977 (KCNC3)951129 - 1223
NM_001112741 (KCNC1)95589 - 683
NM_004976 (KCNC1)95589 - 683
Exon 1 To Exon 2 (Pair 16)
Forward (587,19)GCGCTCTTCGAGGACCCGTAmplicon SizecDNA: 83 bpgenomic: 35,175
Reverse (669,21)GTGATGGAGACCAGGATGAAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.351 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops0.745 kcal/mol in 3' area
Reverse Dimers-1.702 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceGCGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTC
TTCTTCATCCTGGTCTCCATCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001112741 (KCNC1)83587 - 669
NM_004976 (KCNC1)83587 - 669
Exon 1 To Exon 2 (Pair 17)
Forward (589,20)GCTCTTCGAGGACCCGTACTAmplicon SizecDNA: 81 bpgenomic: 35,173
Reverse (669,21)GTGATGGAGACCAGGATGAAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.626 kcal/mol
Forward Dimers-1.398 kcal/mol
Reverse Loops0.745 kcal/mol in 3' area
Reverse Dimers-1.702 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceGCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTT
CTTCATCCTGGTCTCCATCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004976 (KCNC1)81589 - 669
NM_001112741 (KCNC1)81589 - 669
Exon 1 To Exon 2 (Pair 18)
Forward (590,20)CTCTTCGAGGACCCGTACTCAmplicon SizecDNA: 80 bpgenomic: 35,172
Reverse (669,21)GTGATGGAGACCAGGATGAAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.906 kcal/mol in 3' area
Forward Dimers-1.398 kcal/mol
Reverse Loops0.745 kcal/mol in 3' area
Reverse Dimers-1.702 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceCTCTTCGAGGACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTTC
TTCATCCTGGTCTCCATCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004976 (KCNC1)80590 - 669
NM_001112741 (KCNC1)80590 - 669
 

See below for some more details.

Program Output:

Loading ...