Design Results for KCNQ2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 7 To Exon 8 (Pair 1)
Forward (1147,21)CACAGGCAGAAGCACTTTGAGAmplicon SizecDNA: 86 bpgenomic: 4,807
Reverse (1232,21)GAGAGGTTGGTGGCGTAGAATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.544 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops2.154 kcal/mol
Reverse Dimers-0.243 kcal/mol
Forward-Reverse Dimers-1.194 kcal/mol
Amplicon Folding-2.286 kcal/mol outside primersite
Amplicon SequenceCACAGGCAGAAGCACTTTGAGAAGAGGCGGAACCCGGCAGCAGGCCTGATCCAGTCGGCC
TGGAGATTCTACGCCACCAACCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_172108 (KCNQ2)861147 - 1232
NM_004518 (KCNQ2)861147 - 1232
NM_172107 (KCNQ2)861147 - 1232
NM_172106 (KCNQ2)861147 - 1232
NM_172109 (KCNQ2)861147 - 1232
Exon 7 To Exon 8 (Pair 2)
Forward (1147,21)CACAGGCAGAAGCACTTTGAGAmplicon SizecDNA: 87 bpgenomic: 4,808
Reverse (1233,20)CGAGAGGTTGGTGGCGTAGANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.544 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops2.154 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-1.194 kcal/mol
Amplicon Folding-2.286 kcal/mol outside primersite
Amplicon SequenceCACAGGCAGAAGCACTTTGAGAAGAGGCGGAACCCGGCAGCAGGCCTGATCCAGTCGGCC
TGGAGATTCTACGCCACCAACCTCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004518 (KCNQ2)871147 - 1233
NM_172108 (KCNQ2)871147 - 1233
NM_172106 (KCNQ2)871147 - 1233
NM_172109 (KCNQ2)871147 - 1233
NM_172107 (KCNQ2)871147 - 1233
Exon 7 To Exon 8 (Pair 3)
Forward (1147,21)CACAGGCAGAAGCACTTTGAGAmplicon SizecDNA: 84 bpgenomic: 4,805
Reverse (1230,21)GAGGTTGGTGGCGTAGAATCTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.544 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops2.555 kcal/mol
Reverse Dimers-0.243 kcal/mol
Forward-Reverse Dimers-0.861 kcal/mol
Amplicon Folding-2.286 kcal/mol outside primersite
Amplicon SequenceCACAGGCAGAAGCACTTTGAGAAGAGGCGGAACCCGGCAGCAGGCCTGATCCAGTCGGCC
TGGAGATTCTACGCCACCAACCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_172109 (KCNQ2)841147 - 1230
NM_172106 (KCNQ2)841147 - 1230
NM_172107 (KCNQ2)841147 - 1230
NM_004518 (KCNQ2)841147 - 1230
NM_172108 (KCNQ2)841147 - 1230
 

See below for some more details.

Program Output:

Loading ...