Design Results for KCNQ3

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 4 (Pair 1)
Forward (623,24)ATCTTGTTCTTGCATTCATTACCTAmplicon SizecDNA: 182 bpgenomic: 262,924
Reverse (804,22)AAGCAAACTCGGCTCCAAAGATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.189 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.326 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-1.802 kcal/mol
Amplicon Folding0.042 kcal/mol outside primersite
Amplicon SequenceATCTTGTTCTTGCATTCATTACCTTATGAAGCCTGCAGAACACGCCACGATGTTCCTGAT
TGTCCTGGGGTGCTTGATTCTGGCTGTCCTGACCACATTCAAGGAGTATGAGACTGTCTC
GGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTGC
TT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)18212 - 193
Exon 2 To Exon 4 (Pair 2)
Forward (623,24)ATCTTGTTCTTGCATTCATTACCTAmplicon SizecDNA: 218 bpgenomic: 262,960
Reverse (840,21)TGTATCGGCAGCAACATCCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.189 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.965 kcal/mol
Reverse Dimers-1.012 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding-0.448 kcal/mol outside primersite
Amplicon SequenceATCTTGTTCTTGCATTCATTACCTTATGAAGCCTGCAGAACACGCCACGATGTTCCTGAT
TGTCCTGGGGTGCTTGATTCTGGCTGTCCTGACCACATTCAAGGAGTATGAGACTGTCTC
GGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTGC
TTTGAGGATCTGGGCTGCTGGATGTTGCTGCCGATACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)21812 - 229
Exon 2 To Exon 4 (Pair 3)
Forward (622,24)AATCTTGTTCTTGCATTCATTACCAmplicon SizecDNA: 186 bpgenomic: 262,928
Reverse (807,22)TCAAAGCAAACTCGGCTCCAAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.112 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.326 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-1.802 kcal/mol
Amplicon Folding0.042 kcal/mol outside primersite
Amplicon SequenceAATCTTGTTCTTGCATTCATTACCTTATGAAGCCTGCAGAACACGCCACGATGTTCCTGA
TTGTCCTGGGGTGCTTGATTCTGGCTGTCCTGACCACATTCAAGGAGTATGAGACTGTCT
CGGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTG
CTTTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)18611 - 196
Exon 2 To Exon 4 (Pair 4)
Forward (623,24)ATCTTGTTCTTGCATTCATTACCTAmplicon SizecDNA: 183 bpgenomic: 262,925
Reverse (805,22)AAAGCAAACTCGGCTCCAAAGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.189 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.326 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-1.802 kcal/mol
Amplicon Folding0.042 kcal/mol outside primersite
Amplicon SequenceATCTTGTTCTTGCATTCATTACCTTATGAAGCCTGCAGAACACGCCACGATGTTCCTGAT
TGTCCTGGGGTGCTTGATTCTGGCTGTCCTGACCACATTCAAGGAGTATGAGACTGTCTC
GGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTGC
TTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)18312 - 194
Exon 2 To Exon 4 (Pair 5)
Forward (622,24)AATCTTGTTCTTGCATTCATTACCAmplicon SizecDNA: 184 bpgenomic: 262,926
Reverse (805,22)AAAGCAAACTCGGCTCCAAAGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.112 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.326 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-1.802 kcal/mol
Amplicon Folding0.042 kcal/mol outside primersite
Amplicon SequenceAATCTTGTTCTTGCATTCATTACCTTATGAAGCCTGCAGAACACGCCACGATGTTCCTGA
TTGTCCTGGGGTGCTTGATTCTGGCTGTCCTGACCACATTCAAGGAGTATGAGACTGTCT
CGGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTG
CTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)18411 - 194
Exon 2 To Exon 5 (Pair 1)
Forward (623,24)ATCTTGTTCTTGCATTCATTACCTAmplicon SizecDNA: 294 bpgenomic: 266,947
Reverse (916,22)ACAGAGGCAATCAGCACAAAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.189 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.329 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.917 kcal/mol
Amplicon Folding-1.506 kcal/mol outside primersite
Amplicon SequenceATCTTGTTCTTGCATTCATTACCTTATGAAGCCTGCAGAACACGCCACGATGTTCCTGAT
TGTCCTGGGGTGCTTGATTCTGGCTGTCCTGACCACATTCAAGGAGTATGAGACTGTCTC
GGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTGC
TTTGAGGATCTGGGCTGCTGGATGTTGCTGCCGATACAAAGGCTGGCGGGGCCGACTGAA
GTTTGCCAGGAAGCCCCTGTGCATGTTGGACATCTTTGTGCTGATTGCCTCTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)29412 - 305
Exon 2 To Exon 5 (Pair 2)
Forward (622,24)AATCTTGTTCTTGCATTCATTACCAmplicon SizecDNA: 295 bpgenomic: 266,948
Reverse (916,22)ACAGAGGCAATCAGCACAAAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.112 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.329 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.917 kcal/mol
Amplicon Folding-1.506 kcal/mol outside primersite
Amplicon SequenceAATCTTGTTCTTGCATTCATTACCTTATGAAGCCTGCAGAACACGCCACGATGTTCCTGA
TTGTCCTGGGGTGCTTGATTCTGGCTGTCCTGACCACATTCAAGGAGTATGAGACTGTCT
CGGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTG
CTTTGAGGATCTGGGCTGCTGGATGTTGCTGCCGATACAAAGGCTGGCGGGGCCGACTGA
AGTTTGCCAGGAAGCCCCTGTGCATGTTGGACATCTTTGTGCTGATTGCCTCTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)29511 - 305
Exon 2 To Exon 4 (Pair 6)
Forward (622,24)AATCTTGTTCTTGCATTCATTACCAmplicon SizecDNA: 219 bpgenomic: 262,961
Reverse (840,21)TGTATCGGCAGCAACATCCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.112 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.965 kcal/mol
Reverse Dimers-1.012 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding-0.448 kcal/mol outside primersite
Amplicon SequenceAATCTTGTTCTTGCATTCATTACCTTATGAAGCCTGCAGAACACGCCACGATGTTCCTGA
TTGTCCTGGGGTGCTTGATTCTGGCTGTCCTGACCACATTCAAGGAGTATGAGACTGTCT
CGGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTG
CTTTGAGGATCTGGGCTGCTGGATGTTGCTGCCGATACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)21911 - 229
Exon 2 To Exon 4 (Pair 7)
Forward (623,24)ATCTTGTTCTTGCATTCATTACCTAmplicon SizecDNA: 220 bpgenomic: 262,962
Reverse (842,22)TTTGTATCGGCAGCAACATCCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.189 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.894 kcal/mol
Reverse Dimers-1.012 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding-0.448 kcal/mol outside primersite
Amplicon SequenceATCTTGTTCTTGCATTCATTACCTTATGAAGCCTGCAGAACACGCCACGATGTTCCTGAT
TGTCCTGGGGTGCTTGATTCTGGCTGTCCTGACCACATTCAAGGAGTATGAGACTGTCTC
GGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTGC
TTTGAGGATCTGGGCTGCTGGATGTTGCTGCCGATACAAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)22012 - 231
Exon 2 To Exon 4 (Pair 8)
Forward (622,24)AATCTTGTTCTTGCATTCATTACCAmplicon SizecDNA: 221 bpgenomic: 262,963
Reverse (842,22)TTTGTATCGGCAGCAACATCCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.112 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.894 kcal/mol
Reverse Dimers-1.012 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding-0.448 kcal/mol outside primersite
Amplicon SequenceAATCTTGTTCTTGCATTCATTACCTTATGAAGCCTGCAGAACACGCCACGATGTTCCTGA
TTGTCCTGGGGTGCTTGATTCTGGCTGTCCTGACCACATTCAAGGAGTATGAGACTGTCT
CGGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTG
CTTTGAGGATCTGGGCTGCTGGATGTTGCTGCCGATACAAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)22111 - 231
Exon 2 To Exon 4 (Pair 9)
Forward (623,24)ATCTTGTTCTTGCATTCATTACCTAmplicon SizecDNA: 185 bpgenomic: 262,927
Reverse (807,22)TCAAAGCAAACTCGGCTCCAAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.189 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops0.326 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-1.802 kcal/mol
Amplicon Folding0.042 kcal/mol outside primersite
Amplicon SequenceATCTTGTTCTTGCATTCATTACCTTATGAAGCCTGCAGAACACGCCACGATGTTCCTGAT
TGTCCTGGGGTGCTTGATTCTGGCTGTCCTGACCACATTCAAGGAGTATGAGACTGTCTC
GGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTGC
TTTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)18512 - 196
Exon 3 To Exon 5 (Pair 1)
Forward (743,21)GGGAGACTGGCTTCTGTTACTAmplicon SizecDNA: 194 bpgenomic: 5,828
Reverse (936,20)TTCCCACAGCAACCACTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops1.088 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.127 kcal/mol
Amplicon Folding-1.506 kcal/mol outside primersite
Amplicon SequenceGGGAGACTGGCTTCTGTTACTGGAGACATTTGCTATTTTCATCTTTGGAGCCGAGTTTGC
TTTGAGGATCTGGGCTGCTGGATGTTGCTGCCGATACAAAGGCTGGCGGGGCCGACTGAA
GTTTGCCAGGAAGCCCCTGTGCATGTTGGACATCTTTGTGCTGATTGCCTCTGTGCCAGT
GGTTGCTGTGGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004519 (KCNQ3)194681 - 874
NM_001204824 (KCNQ3)194132 - 325
Exon 4 To Exon 5 (Pair 1)
Forward (820,21)CTGGATGTTGCTGCCGATACAAmplicon SizecDNA: 97 bpgenomic: 4,008
Reverse (916,22)ACAGAGGCAATCAGCACAAAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.148 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.329 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.789 kcal/mol
Amplicon Folding-1.058 kcal/mol outside primersite
Amplicon SequenceCTGGATGTTGCTGCCGATACAAAGGCTGGCGGGGCCGACTGAAGTTTGCCAGGAAGCCCC
TGTGCATGTTGGACATCTTTGTGCTGATTGCCTCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)97209 - 305
NM_004519 (KCNQ3)97758 - 854
Exon 4 To Exon 5 (Pair 2)
Forward (821,22)TGGATGTTGCTGCCGATACAAAAmplicon SizecDNA: 96 bpgenomic: 4,007
Reverse (916,22)ACAGAGGCAATCAGCACAAAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.222 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.329 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.789 kcal/mol
Amplicon Folding-1.058 kcal/mol outside primersite
Amplicon SequenceTGGATGTTGCTGCCGATACAAAGGCTGGCGGGGCCGACTGAAGTTTGCCAGGAAGCCCCT
GTGCATGTTGGACATCTTTGTGCTGATTGCCTCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204824 (KCNQ3)96210 - 305
NM_004519 (KCNQ3)96759 - 854
 

See below for some more details.

Program Output:

Loading ...