Design Results for LNPEP

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size100Maximal Amplicon Size125
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (827,21)GCCCTGCTCCTTCATCTTCAAAmplicon SizecDNA: 120 bpgenomic: 20,481
Reverse (946,23)AAACAAGGCTCTTTGGCTAAATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.357 kcal/mol
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGAT
TGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGTTT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)120294 - 413
Exon 2 To Exon 3 (Pair 2)
Forward (827,21)GCCCTGCTCCTTCATCTTCAAAmplicon SizecDNA: 118 bpgenomic: 20,479
Reverse (944,22)ACAAGGCTCTTTGGCTAAATCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.357 kcal/mol
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGAT
TGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)118294 - 411
Exon 2 To Exon 3 (Pair 3)
Forward (827,21)GCCCTGCTCCTTCATCTTCAAAmplicon SizecDNA: 122 bpgenomic: 20,483
Reverse (948,23)GTAAACAAGGCTCTTTGGCTAAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.357 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGAT
TGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGTTT
AC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)122294 - 415
Exon 2 To Exon 3 (Pair 4)
Forward (827,21)GCCCTGCTCCTTCATCTTCAAAmplicon SizecDNA: 126 bpgenomic: 20,487
Reverse (952,22)GGATGTAAACAAGGCTCTTTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.383 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGAT
TGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGTTT
ACATCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)126294 - 419
Exon 2 To Exon 3 (Pair 5)
Forward (820,19)GCTCCTGGCCCTGCTCCTTAmplicon SizecDNA: 125 bpgenomic: 20,486
Reverse (944,22)ACAAGGCTCTTTGGCTAAATCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.261 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops1.357 kcal/mol
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGCTCCTGGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGA
ATATGATTGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGC
CTTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)125287 - 411
Exon 2 To Exon 3 (Pair 6)
Forward (827,21)GCCCTGCTCCTTCATCTTCAAAmplicon SizecDNA: 125 bpgenomic: 20,486
Reverse (951,22)GATGTAAACAAGGCTCTTTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.383 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGAT
TGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGTTT
ACATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)125294 - 418
Exon 2 To Exon 3 (Pair 7)
Forward (826,20)GGCCCTGCTCCTTCATCTTCAmplicon SizecDNA: 123 bpgenomic: 20,484
Reverse (948,23)GTAAACAAGGCTCTTTGGCTAAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.682 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.357 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGA
TTGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGTT
TAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)123293 - 415
Exon 2 To Exon 3 (Pair 8)
Forward (824,20)CTGGCCCTGCTCCTTCATCTAmplicon SizecDNA: 126 bpgenomic: 20,487
Reverse (949,23)TGTAAACAAGGCTCTTTGGCTAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops1.357 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceCTGGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATAT
GATTGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTG
TTTACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)126291 - 416
Exon 2 To Exon 3 (Pair 9)
Forward (826,20)GGCCCTGCTCCTTCATCTTCAmplicon SizecDNA: 124 bpgenomic: 20,485
Reverse (949,23)TGTAAACAAGGCTCTTTGGCTAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.682 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.357 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGA
TTGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGTT
TACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)124293 - 416
Exon 2 To Exon 3 (Pair 10)
Forward (824,20)CTGGCCCTGCTCCTTCATCTAmplicon SizecDNA: 123 bpgenomic: 20,484
Reverse (946,23)AAACAAGGCTCTTTGGCTAAATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops1.357 kcal/mol
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceCTGGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATAT
GATTGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTG
TTT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)123291 - 413
Exon 2 To Exon 3 (Pair 11)
Forward (826,20)GGCCCTGCTCCTTCATCTTCAmplicon SizecDNA: 125 bpgenomic: 20,486
Reverse (950,23)ATGTAAACAAGGCTCTTTGGCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.682 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.357 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGA
TTGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGTT
TACAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)125293 - 417
Exon 2 To Exon 3 (Pair 12)
Forward (826,20)GGCCCTGCTCCTTCATCTTCAmplicon SizecDNA: 119 bpgenomic: 20,480
Reverse (944,22)ACAAGGCTCTTTGGCTAAATCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.682 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.357 kcal/mol
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGA
TTGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)119293 - 411
Exon 2 To Exon 3 (Pair 13)
Forward (824,20)CTGGCCCTGCTCCTTCATCTAmplicon SizecDNA: 121 bpgenomic: 20,482
Reverse (944,22)ACAAGGCTCTTTGGCTAAATCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops1.357 kcal/mol
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceCTGGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATAT
GATTGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTG
T
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)121291 - 411
Exon 2 To Exon 3 (Pair 14)
Forward (826,20)GGCCCTGCTCCTTCATCTTCAmplicon SizecDNA: 126 bpgenomic: 20,487
Reverse (951,22)GATGTAAACAAGGCTCTTTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.682 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.383 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGA
TTGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGTT
TACATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)126293 - 418
Exon 2 To Exon 3 (Pair 15)
Forward (827,21)GCCCTGCTCCTTCATCTTCAAAmplicon SizecDNA: 124 bpgenomic: 20,485
Reverse (950,23)ATGTAAACAAGGCTCTTTGGCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.357 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGAT
TGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGTTT
ACAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)124294 - 417
Exon 2 To Exon 3 (Pair 16)
Forward (826,20)GGCCCTGCTCCTTCATCTTCAmplicon SizecDNA: 121 bpgenomic: 20,482
Reverse (946,23)AAACAAGGCTCTTTGGCTAAATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.682 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.357 kcal/mol
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGA
TTGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGTT
T
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)121293 - 413
Exon 2 To Exon 3 (Pair 17)
Forward (827,21)GCCCTGCTCCTTCATCTTCAAAmplicon SizecDNA: 123 bpgenomic: 20,484
Reverse (949,23)TGTAAACAAGGCTCTTTGGCTAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.357 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATATGAT
TGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTGTTT
ACA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)123294 - 416
Exon 2 To Exon 3 (Pair 18)
Forward (824,20)CTGGCCCTGCTCCTTCATCTAmplicon SizecDNA: 125 bpgenomic: 20,486
Reverse (948,23)GTAAACAAGGCTCTTTGGCTAAANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-2.544 kcal/mol
Reverse Loops1.357 kcal/mol in 3' area
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.776 kcal/mol outside primersite
Amplicon SequenceCTGGCCCTGCTCCTTCATCTTCAAAGCTACCAAAGATCGGCTTCAGCTCCCCAGGAATAT
GATTGAAAACAGCATGTTTGAGGAAGAACCAGATGTGGTGGATTTAGCCAAAGAGCCTTG
TTTAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_175920 (LNPEP)125291 - 415
Exon 12 To Exon 13 (Pair 1)
Forward (2814,24)GTCACTGAAGGAAGAAATTATTCAAmplicon SizecDNA: 114 bpgenomic: 7,246
Reverse (2927,24)CATGTTTATATTCACTTTGACCCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.657 kcal/mol
Forward Dimers-0.892 kcal/mol
Reverse Loops1.651 kcal/mol
Reverse Dimers0.08 kcal/mol
Forward-Reverse Dimers-1.639 kcal/mol
Amplicon Folding0.657 kcal/mol inside primersite
Amplicon SequenceGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATTACTGGATAAGAAATCA
GGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAAGTGAATATAAACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1142489 - 2602
NM_175920 (LNPEP)1142281 - 2394
Exon 12 To Exon 13 (Pair 2)
Forward (2791,23)TGTGGCATATTCCACTATCCTATAmplicon SizecDNA: 113 bpgenomic: 7,245
Reverse (2903,23)CAGCACTTCTTCTGTAAGATTGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.263 kcal/mol
Forward Dimers-2.66 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.263 kcal/mol inside primersite
Amplicon SequenceTGTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGG
TATCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1132258 - 2370
NM_005575 (LNPEP)1132466 - 2578
Exon 12 To Exon 13 (Pair 3)
Forward (2798,23)TATTCCACTATCCTATGTCACTGAmplicon SizecDNA: 113 bpgenomic: 7,245
Reverse (2910,21)TGACCCACAGCACTTCTTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops1.196 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.176 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATT
ACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1132265 - 2377
NM_005575 (LNPEP)1132473 - 2585
Exon 12 To Exon 13 (Pair 4)
Forward (2814,24)GTCACTGAAGGAAGAAATTATTCAAmplicon SizecDNA: 113 bpgenomic: 7,245
Reverse (2926,24)ATGTTTATATTCACTTTGACCCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.657 kcal/mol
Forward Dimers-0.892 kcal/mol
Reverse Loops1.651 kcal/mol
Reverse Dimers0.08 kcal/mol
Forward-Reverse Dimers-1.639 kcal/mol
Amplicon Folding0.657 kcal/mol inside primersite
Amplicon SequenceGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATTACTGGATAAGAAATCA
GGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAAGTGAATATAAACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1132281 - 2393
NM_005575 (LNPEP)1132489 - 2601
Exon 12 To Exon 13 (Pair 5)
Forward (2814,24)GTCACTGAAGGAAGAAATTATTCAAmplicon SizecDNA: 115 bpgenomic: 7,247
Reverse (2928,24)TCATGTTTATATTCACTTTGACCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.657 kcal/mol
Forward Dimers-0.892 kcal/mol
Reverse Loops1.651 kcal/mol in 3' area
Reverse Dimers-0.252 kcal/mol
Forward-Reverse Dimers-1.639 kcal/mol
Amplicon Folding0.657 kcal/mol inside primersite
Amplicon SequenceGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATTACTGGATAAGAAATCA
GGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAAGTGAATATAAACATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1152489 - 2603
NM_175920 (LNPEP)1152281 - 2395
Exon 12 To Exon 13 (Pair 6)
Forward (2798,23)TATTCCACTATCCTATGTCACTGAmplicon SizecDNA: 115 bpgenomic: 7,247
Reverse (2912,22)TTTGACCCACAGCACTTCTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops1.196 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.176 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATT
ACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1152473 - 2587
NM_175920 (LNPEP)1152265 - 2379
Exon 12 To Exon 13 (Pair 7)
Forward (2793,23)TGGCATATTCCACTATCCTATGTAmplicon SizecDNA: 111 bpgenomic: 7,243
Reverse (2903,23)CAGCACTTCTTCTGTAAGATTGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.431 kcal/mol
Forward Dimers-0.793 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTA
TCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1112468 - 2578
NM_175920 (LNPEP)1112260 - 2370
Exon 12 To Exon 13 (Pair 8)
Forward (2798,23)TATTCCACTATCCTATGTCACTGAmplicon SizecDNA: 117 bpgenomic: 7,249
Reverse (2914,22)ACTTTGACCCACAGCACTTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops1.196 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.176 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATT
ACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1172473 - 2589
NM_175920 (LNPEP)1172265 - 2381
Exon 12 To Exon 13 (Pair 9)
Forward (2796,23)CATATTCCACTATCCTATGTCACAmplicon SizecDNA: 106 bpgenomic: 7,238
Reverse (2901,23)GCACTTCTTCTGTAAGATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol in 3' area
Forward Dimers-0.408 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCA
TTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1062263 - 2368
NM_005575 (LNPEP)1062471 - 2576
Exon 12 To Exon 13 (Pair 10)
Forward (2793,23)TGGCATATTCCACTATCCTATGTAmplicon SizecDNA: 122 bpgenomic: 7,254
Reverse (2914,22)ACTTTGACCCACAGCACTTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.431 kcal/mol
Forward Dimers-0.793 kcal/mol
Reverse Loops1.196 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTA
TCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAA
GT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1222260 - 2381
NM_005575 (LNPEP)1222468 - 2589
Exon 12 To Exon 13 (Pair 11)
Forward (2798,23)TATTCCACTATCCTATGTCACTGAmplicon SizecDNA: 106 bpgenomic: 7,238
Reverse (2903,23)CAGCACTTCTTCTGTAAGATTGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATT
ACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1062265 - 2370
NM_005575 (LNPEP)1062473 - 2578
Exon 12 To Exon 13 (Pair 12)
Forward (2808,23)TCCTATGTCACTGAAGGAAGAAAAmplicon SizecDNA: 108 bpgenomic: 7,240
Reverse (2915,21)CACTTTGACCCACAGCACTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.965 kcal/mol
Forward Dimers-1.752 kcal/mol
Reverse Loops1.852 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.657 kcal/mol inside primersite
Amplicon SequenceTCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATTACTGGATAAG
AAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1082275 - 2382
NM_005575 (LNPEP)1082483 - 2590
Exon 12 To Exon 13 (Pair 13)
Forward (2798,23)TATTCCACTATCCTATGTCACTGAmplicon SizecDNA: 108 bpgenomic: 7,240
Reverse (2905,23)CACAGCACTTCTTCTGTAAGATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops0.568 kcal/mol
Reverse Dimers-1.51 kcal/mol
Forward-Reverse Dimers-1.176 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATT
ACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1082265 - 2372
NM_005575 (LNPEP)1082473 - 2580
Exon 12 To Exon 13 (Pair 14)
Forward (2799,23)ATTCCACTATCCTATGTCACTGAAmplicon SizecDNA: 103 bpgenomic: 7,235
Reverse (2901,23)GCACTTCTTCTGTAAGATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATTA
CTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1032266 - 2368
NM_005575 (LNPEP)1032474 - 2576
Exon 12 To Exon 13 (Pair 15)
Forward (2796,23)CATATTCCACTATCCTATGTCACAmplicon SizecDNA: 108 bpgenomic: 7,240
Reverse (2903,23)CAGCACTTCTTCTGTAAGATTGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol in 3' area
Forward Dimers-0.408 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCA
TTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1082263 - 2370
NM_005575 (LNPEP)1082471 - 2578
Exon 12 To Exon 13 (Pair 16)
Forward (2800,23)TTCCACTATCCTATGTCACTGAAAmplicon SizecDNA: 102 bpgenomic: 7,234
Reverse (2901,23)GCACTTCTTCTGTAAGATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATTAC
TGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1022475 - 2576
NM_175920 (LNPEP)1022267 - 2368
Exon 12 To Exon 13 (Pair 17)
Forward (2793,23)TGGCATATTCCACTATCCTATGTAmplicon SizecDNA: 120 bpgenomic: 7,252
Reverse (2912,22)TTTGACCCACAGCACTTCTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.431 kcal/mol
Forward Dimers-0.793 kcal/mol
Reverse Loops1.196 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTA
TCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1202468 - 2587
NM_175920 (LNPEP)1202260 - 2379
Exon 12 To Exon 13 (Pair 18)
Forward (2791,23)TGTGGCATATTCCACTATCCTATAmplicon SizecDNA: 120 bpgenomic: 7,252
Reverse (2910,21)TGACCCACAGCACTTCTTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.263 kcal/mol
Forward Dimers-2.66 kcal/mol
Reverse Loops1.196 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.429 kcal/mol
Amplicon Folding0.263 kcal/mol inside primersite
Amplicon SequenceTGTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGG
TATCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1202258 - 2377
NM_005575 (LNPEP)1202466 - 2585
Exon 12 To Exon 13 (Pair 19)
Forward (2814,24)GTCACTGAAGGAAGAAATTATTCAAmplicon SizecDNA: 102 bpgenomic: 7,234
Reverse (2915,21)CACTTTGACCCACAGCACTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.657 kcal/mol
Forward Dimers-0.892 kcal/mol
Reverse Loops1.852 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.657 kcal/mol inside primersite
Amplicon SequenceGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATTACTGGATAAGAAATCA
GGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1022489 - 2590
NM_175920 (LNPEP)1022281 - 2382
Exon 12 To Exon 13 (Pair 20)
Forward (2793,23)TGGCATATTCCACTATCCTATGTAmplicon SizecDNA: 109 bpgenomic: 7,241
Reverse (2901,23)GCACTTCTTCTGTAAGATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.431 kcal/mol
Forward Dimers-0.793 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTA
TCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1092468 - 2576
NM_175920 (LNPEP)1092260 - 2368
Exon 12 To Exon 13 (Pair 21)
Forward (2798,23)TATTCCACTATCCTATGTCACTGAmplicon SizecDNA: 118 bpgenomic: 7,250
Reverse (2915,21)CACTTTGACCCACAGCACTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops1.852 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.176 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATT
ACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1182265 - 2382
NM_005575 (LNPEP)1182473 - 2590
Exon 12 To Exon 13 (Pair 22)
Forward (2795,23)GCATATTCCACTATCCTATGTCAAmplicon SizecDNA: 107 bpgenomic: 7,239
Reverse (2901,23)GCACTTCTTCTGTAAGATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol in 3' area
Forward Dimers-0.408 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATC
ATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1072262 - 2368
NM_005575 (LNPEP)1072470 - 2576
Exon 12 To Exon 13 (Pair 23)
Forward (2798,23)TATTCCACTATCCTATGTCACTGAmplicon SizecDNA: 104 bpgenomic: 7,236
Reverse (2901,23)GCACTTCTTCTGTAAGATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATT
ACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1042473 - 2576
NM_175920 (LNPEP)1042265 - 2368
Exon 12 To Exon 13 (Pair 24)
Forward (2795,23)GCATATTCCACTATCCTATGTCAAmplicon SizecDNA: 109 bpgenomic: 7,241
Reverse (2903,23)CAGCACTTCTTCTGTAAGATTGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.072 kcal/mol in 3' area
Forward Dimers-0.408 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATC
ATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1092262 - 2370
NM_005575 (LNPEP)1092470 - 2578
Exon 12 To Exon 13 (Pair 25)
Forward (2791,23)TGTGGCATATTCCACTATCCTATAmplicon SizecDNA: 125 bpgenomic: 7,257
Reverse (2915,21)CACTTTGACCCACAGCACTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.263 kcal/mol
Forward Dimers-2.66 kcal/mol
Reverse Loops1.852 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.429 kcal/mol
Amplicon Folding0.263 kcal/mol inside primersite
Amplicon SequenceTGTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGG
TATCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCA
AAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1252466 - 2590
NM_175920 (LNPEP)1252258 - 2382
Exon 12 To Exon 13 (Pair 26)
Forward (2793,23)TGGCATATTCCACTATCCTATGTAmplicon SizecDNA: 123 bpgenomic: 7,255
Reverse (2915,21)CACTTTGACCCACAGCACTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.431 kcal/mol
Forward Dimers-0.793 kcal/mol
Reverse Loops1.852 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTA
TCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAA
GTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1232468 - 2590
NM_175920 (LNPEP)1232260 - 2382
Exon 12 To Exon 13 (Pair 27)
Forward (2809,23)CCTATGTCACTGAAGGAAGAAATAmplicon SizecDNA: 107 bpgenomic: 7,239
Reverse (2915,21)CACTTTGACCCACAGCACTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-1.447 kcal/mol
Reverse Loops1.852 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.654 kcal/mol
Amplicon Folding0.657 kcal/mol inside primersite
Amplicon SequenceCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTATCATTACTGGATAAGA
AATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCAAAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1072484 - 2590
NM_175920 (LNPEP)1072276 - 2382
Exon 12 To Exon 13 (Pair 28)
Forward (2791,23)TGTGGCATATTCCACTATCCTATAmplicon SizecDNA: 124 bpgenomic: 7,256
Reverse (2914,22)ACTTTGACCCACAGCACTTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.263 kcal/mol
Forward Dimers-2.66 kcal/mol
Reverse Loops1.196 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.429 kcal/mol
Amplicon Folding0.263 kcal/mol inside primersite
Amplicon SequenceTGTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGG
TATCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCA
AAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1242258 - 2381
NM_005575 (LNPEP)1242466 - 2589
Exon 12 To Exon 13 (Pair 29)
Forward (2791,23)TGTGGCATATTCCACTATCCTATAmplicon SizecDNA: 111 bpgenomic: 7,243
Reverse (2901,23)GCACTTCTTCTGTAAGATTGATGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.263 kcal/mol
Forward Dimers-2.66 kcal/mol
Reverse Loops0.781 kcal/mol
Reverse Dimers-0.85 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding0.263 kcal/mol inside primersite
Amplicon SequenceTGTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGG
TATCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1112258 - 2368
NM_005575 (LNPEP)1112466 - 2576
Exon 12 To Exon 13 (Pair 30)
Forward (2793,23)TGGCATATTCCACTATCCTATGTAmplicon SizecDNA: 118 bpgenomic: 7,250
Reverse (2910,21)TGACCCACAGCACTTCTTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.431 kcal/mol
Forward Dimers-0.793 kcal/mol
Reverse Loops1.196 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding0.657 kcal/mol outside primersite
Amplicon SequenceTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGGTA
TCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1182468 - 2585
NM_175920 (LNPEP)1182260 - 2377
Exon 12 To Exon 13 (Pair 31)
Forward (2791,23)TGTGGCATATTCCACTATCCTATAmplicon SizecDNA: 122 bpgenomic: 7,254
Reverse (2912,22)TTTGACCCACAGCACTTCTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.263 kcal/mol
Forward Dimers-2.66 kcal/mol
Reverse Loops1.196 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.429 kcal/mol
Amplicon Folding0.263 kcal/mol inside primersite
Amplicon SequenceTGTGGCATATTCCACTATCCTATGTCACTGAAGGAAGAAATTATTCAAAATATCAATCGG
TATCATTACTGGATAAGAAATCAGGTGTCATCAATCTTACAGAAGAAGTGCTGTGGGTCA
AA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1222466 - 2587
NM_175920 (LNPEP)1222258 - 2379
Exon 14 To Exon 15 (Pair 1)
Forward (3148,23)TTCAGACAGACCTCATCTATAACAmplicon SizecDNA: 121 bpgenomic: 7,325
Reverse (3268,24)TCAGTCCAAGTTTGTTGTTGAATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceTTCAGACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAA
GACTGGTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1212615 - 2735
NM_005575 (LNPEP)1212823 - 2943
Exon 14 To Exon 15 (Pair 2)
Forward (3156,22)GACCTCATCTATAACCTCCTTGAmplicon SizecDNA: 118 bpgenomic: 7,322
Reverse (3273,22)CCTCATCAGTCCAAGTTTGTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.672 kcal/mol in 3' area
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.525 kcal/mol
Amplicon Folding0.662 kcal/mol inside primersite
Amplicon SequenceGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGGTG
ACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1182831 - 2948
NM_175920 (LNPEP)1182623 - 2740
Exon 14 To Exon 15 (Pair 3)
Forward (3153,22)ACAGACCTCATCTATAACCTCCAmplicon SizecDNA: 126 bpgenomic: 7,330
Reverse (3278,21)AGTGCCCTCATCAGTCCAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.929 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTG
GTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAG
GGCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1262828 - 2953
NM_175920 (LNPEP)1262620 - 2745
Exon 14 To Exon 15 (Pair 4)
Forward (3145,23)TGTTTCAGACAGACCTCATCTATAmplicon SizecDNA: 125 bpgenomic: 7,329
Reverse (3269,24)ATCAGTCCAAGTTTGTTGTTGAATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol in 3' area
Forward Dimers-0.501 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceTGTTTCAGACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCT
CAAGACTGGTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGA
CTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1252612 - 2736
NM_005575 (LNPEP)1252820 - 2944
Exon 14 To Exon 15 (Pair 5)
Forward (3154,22)CAGACCTCATCTATAACCTCCTAmplicon SizecDNA: 125 bpgenomic: 7,329
Reverse (3278,21)AGTGCCCTCATCAGTCCAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.929 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceCAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGG
TGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAGG
GCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1252621 - 2745
NM_005575 (LNPEP)1252829 - 2953
Exon 14 To Exon 15 (Pair 6)
Forward (3153,22)ACAGACCTCATCTATAACCTCCAmplicon SizecDNA: 120 bpgenomic: 7,324
Reverse (3272,23)CTCATCAGTCCAAGTTTGTTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol in 3' area
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.566 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTG
GTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1202828 - 2947
NM_175920 (LNPEP)1202620 - 2739
Exon 14 To Exon 15 (Pair 7)
Forward (3152,22)GACAGACCTCATCTATAACCTCAmplicon SizecDNA: 126 bpgenomic: 7,330
Reverse (3277,21)GTGCCCTCATCAGTCCAAGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops2.26 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceGACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACT
GGTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGA
GGGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1262827 - 2952
NM_175920 (LNPEP)1262619 - 2744
Exon 14 To Exon 15 (Pair 8)
Forward (3153,22)ACAGACCTCATCTATAACCTCCAmplicon SizecDNA: 121 bpgenomic: 7,325
Reverse (3273,22)CCTCATCAGTCCAAGTTTGTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.672 kcal/mol in 3' area
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTG
GTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1212620 - 2740
NM_005575 (LNPEP)1212828 - 2948
Exon 14 To Exon 15 (Pair 9)
Forward (3156,22)GACCTCATCTATAACCTCCTTGAmplicon SizecDNA: 113 bpgenomic: 7,317
Reverse (3268,24)TCAGTCCAAGTTTGTTGTTGAATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.525 kcal/mol
Amplicon Folding0.662 kcal/mol inside primersite
Amplicon SequenceGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGGTG
ACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1132831 - 2943
NM_175920 (LNPEP)1132623 - 2735
Exon 14 To Exon 15 (Pair 10)
Forward (3154,22)CAGACCTCATCTATAACCTCCTAmplicon SizecDNA: 117 bpgenomic: 7,321
Reverse (3270,23)CATCAGTCCAAGTTTGTTGTTGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol in 3' area
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.525 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceCAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGG
TGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1172621 - 2737
NM_005575 (LNPEP)1172829 - 2945
Exon 14 To Exon 15 (Pair 11)
Forward (3154,22)CAGACCTCATCTATAACCTCCTAmplicon SizecDNA: 120 bpgenomic: 7,324
Reverse (3273,22)CCTCATCAGTCCAAGTTTGTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.672 kcal/mol in 3' area
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceCAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGG
TGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1202621 - 2740
NM_005575 (LNPEP)1202829 - 2948
Exon 14 To Exon 15 (Pair 12)
Forward (3156,22)GACCTCATCTATAACCTCCTTGAmplicon SizecDNA: 117 bpgenomic: 7,321
Reverse (3272,23)CTCATCAGTCCAAGTTTGTTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.644 kcal/mol in 3' area
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.525 kcal/mol
Amplicon Folding0.662 kcal/mol inside primersite
Amplicon SequenceGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGGTG
ACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1172623 - 2739
NM_005575 (LNPEP)1172831 - 2947
Exon 14 To Exon 15 (Pair 13)
Forward (3154,22)CAGACCTCATCTATAACCTCCTAmplicon SizecDNA: 118 bpgenomic: 7,322
Reverse (3271,23)TCATCAGTCCAAGTTTGTTGTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol in 3' area
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.525 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceCAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGG
TGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1182829 - 2946
NM_175920 (LNPEP)1182621 - 2738
Exon 14 To Exon 15 (Pair 14)
Forward (3156,22)GACCTCATCTATAACCTCCTTGAmplicon SizecDNA: 122 bpgenomic: 7,326
Reverse (3277,21)GTGCCCTCATCAGTCCAAGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops2.26 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.461 kcal/mol
Amplicon Folding0.662 kcal/mol inside primersite
Amplicon SequenceGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGGTG
ACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAGGGC
AC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1222623 - 2744
NM_005575 (LNPEP)1222831 - 2952
Exon 14 To Exon 15 (Pair 15)
Forward (3152,22)GACAGACCTCATCTATAACCTCAmplicon SizecDNA: 118 bpgenomic: 7,322
Reverse (3269,24)ATCAGTCCAAGTTTGTTGTTGAATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceGACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACT
GGTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1182827 - 2944
NM_175920 (LNPEP)1182619 - 2736
Exon 14 To Exon 15 (Pair 16)
Forward (3156,22)GACCTCATCTATAACCTCCTTGAmplicon SizecDNA: 115 bpgenomic: 7,319
Reverse (3270,23)CATCAGTCCAAGTTTGTTGTTGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.644 kcal/mol in 3' area
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.525 kcal/mol
Amplicon Folding0.662 kcal/mol inside primersite
Amplicon SequenceGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGGTG
ACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1152623 - 2737
NM_005575 (LNPEP)1152831 - 2945
Exon 14 To Exon 15 (Pair 17)
Forward (3154,22)CAGACCTCATCTATAACCTCCTAmplicon SizecDNA: 119 bpgenomic: 7,323
Reverse (3272,23)CTCATCAGTCCAAGTTTGTTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol in 3' area
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.566 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceCAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGG
TGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1192829 - 2947
NM_175920 (LNPEP)1192621 - 2739
Exon 14 To Exon 15 (Pair 18)
Forward (3150,22)CAGACAGACCTCATCTATAACCAmplicon SizecDNA: 120 bpgenomic: 7,324
Reverse (3269,24)ATCAGTCCAAGTTTGTTGTTGAATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceCAGACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGA
CTGGTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1202617 - 2736
NM_005575 (LNPEP)1202825 - 2944
Exon 14 To Exon 15 (Pair 19)
Forward (3156,22)GACCTCATCTATAACCTCCTTGAmplicon SizecDNA: 116 bpgenomic: 7,320
Reverse (3271,23)TCATCAGTCCAAGTTTGTTGTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.644 kcal/mol in 3' area
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.525 kcal/mol
Amplicon Folding0.662 kcal/mol inside primersite
Amplicon SequenceGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGGTG
ACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1162623 - 2738
NM_005575 (LNPEP)1162831 - 2946
Exon 14 To Exon 15 (Pair 20)
Forward (3154,22)CAGACCTCATCTATAACCTCCTAmplicon SizecDNA: 115 bpgenomic: 7,319
Reverse (3268,24)TCAGTCCAAGTTTGTTGTTGAATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.525 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceCAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGG
TGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1152621 - 2735
NM_005575 (LNPEP)1152829 - 2943
Exon 14 To Exon 15 (Pair 21)
Forward (3145,23)TGTTTCAGACAGACCTCATCTATAmplicon SizecDNA: 124 bpgenomic: 7,328
Reverse (3268,24)TCAGTCCAAGTTTGTTGTTGAATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol in 3' area
Forward Dimers-0.501 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceTGTTTCAGACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCT
CAAGACTGGTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGA
CTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1242820 - 2943
NM_175920 (LNPEP)1242612 - 2735
Exon 14 To Exon 15 (Pair 22)
Forward (3148,23)TTCAGACAGACCTCATCTATAACAmplicon SizecDNA: 122 bpgenomic: 7,326
Reverse (3269,24)ATCAGTCCAAGTTTGTTGTTGAATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceTTCAGACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAA
GACTGGTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTG
AT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1222823 - 2944
NM_175920 (LNPEP)1222615 - 2736
Exon 14 To Exon 15 (Pair 23)
Forward (3153,22)ACAGACCTCATCTATAACCTCCAmplicon SizecDNA: 125 bpgenomic: 7,329
Reverse (3277,21)GTGCCCTCATCAGTCCAAGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops2.26 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTG
GTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAG
GGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1252620 - 2744
NM_005575 (LNPEP)1252828 - 2952
Exon 14 To Exon 15 (Pair 24)
Forward (3154,22)CAGACCTCATCTATAACCTCCTAmplicon SizecDNA: 124 bpgenomic: 7,328
Reverse (3277,21)GTGCCCTCATCAGTCCAAGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops2.26 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.777 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceCAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGG
TGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAGG
GCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1242829 - 2952
NM_175920 (LNPEP)1242621 - 2744
Exon 14 To Exon 15 (Pair 25)
Forward (3152,22)GACAGACCTCATCTATAACCTCAmplicon SizecDNA: 117 bpgenomic: 7,321
Reverse (3268,24)TCAGTCCAAGTTTGTTGTTGAATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceGACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACT
GGTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1172619 - 2735
NM_005575 (LNPEP)1172827 - 2943
Exon 14 To Exon 15 (Pair 26)
Forward (3154,22)CAGACCTCATCTATAACCTCCTAmplicon SizecDNA: 116 bpgenomic: 7,320
Reverse (3269,24)ATCAGTCCAAGTTTGTTGTTGAATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.525 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceCAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGG
TGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1162621 - 2736
NM_005575 (LNPEP)1162829 - 2944
Exon 14 To Exon 15 (Pair 27)
Forward (3156,22)GACCTCATCTATAACCTCCTTGAmplicon SizecDNA: 123 bpgenomic: 7,327
Reverse (3278,21)AGTGCCCTCATCAGTCCAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.929 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.461 kcal/mol
Amplicon Folding0.662 kcal/mol inside primersite
Amplicon SequenceGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGGTG
ACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGATGAGGGC
ACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1232623 - 2745
NM_005575 (LNPEP)1232831 - 2953
Exon 14 To Exon 15 (Pair 28)
Forward (3150,22)CAGACAGACCTCATCTATAACCAmplicon SizecDNA: 119 bpgenomic: 7,323
Reverse (3268,24)TCAGTCCAAGTTTGTTGTTGAATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.54 kcal/mol
Forward Dimers-0.41 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding0.54 kcal/mol inside primersite
Amplicon SequenceCAGACAGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGA
CTGGTGACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005575 (LNPEP)1192825 - 2943
NM_175920 (LNPEP)1192617 - 2735
Exon 14 To Exon 15 (Pair 29)
Forward (3156,22)GACCTCATCTATAACCTCCTTGAmplicon SizecDNA: 114 bpgenomic: 7,318
Reverse (3269,24)ATCAGTCCAAGTTTGTTGTTGAATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.883 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.644 kcal/mol
Reverse Dimers-0.22 kcal/mol
Forward-Reverse Dimers-0.525 kcal/mol
Amplicon Folding0.662 kcal/mol inside primersite
Amplicon SequenceGACCTCATCTATAACCTCCTTGAAAAACTGGGATACATGGATCTGGCCTCAAGACTGGTG
ACTAGGGTATTTAAATTACTTCAAAACCAAATTCAACAACAAACTTGGACTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_175920 (LNPEP)1142623 - 2736
NM_005575 (LNPEP)1142831 - 2944
 

See below for some more details.

Program Output:

Loading ...