Design Results for LRP4

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 29 To Exon 31 (Pair 52)
Forward (5789,21)GGTGGGAGTCTTGCATCAAACAmplicon SizecDNA: 217 bpgenomic: 4,049
Reverse (6005,20)CTCCTTGTTCCGGCCTGAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.857 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.664 kcal/mol in 3' area
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-1.235 kcal/mol
Amplicon Folding-1.878 kcal/mol outside primersite
Amplicon SequenceGGTGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGAT
CGAGAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCC
CTTTGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGACCAAGTCAAT
CCAGCGTGTTGACAAATACTCAGGCCGGAACAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 43)
Forward (5789,21)GGTGGGAGTCTTGCATCAAACAmplicon SizecDNA: 213 bpgenomic: 4,045
Reverse (6001,22)TTGTTCCGGCCTGAGTATTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.857 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-1.197 kcal/mol
Amplicon Folding-1.878 kcal/mol outside primersite
Amplicon SequenceGGTGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGAT
CGAGAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCC
CTTTGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGACCAAGTCAAT
CCAGCGTGTTGACAAATACTCAGGCCGGAACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 36)
Forward (5789,21)GGTGGGAGTCTTGCATCAAACAmplicon SizecDNA: 215 bpgenomic: 4,047
Reverse (6003,21)CCTTGTTCCGGCCTGAGTATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.857 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.474 kcal/mol in 3' area
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-1.197 kcal/mol
Amplicon Folding-1.878 kcal/mol outside primersite
Amplicon SequenceGGTGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGAT
CGAGAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCC
CTTTGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGACCAAGTCAAT
CCAGCGTGTTGACAAATACTCAGGCCGGAACAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 31)
Forward (5792,21)GGGAGTCTTGCATCAAACAGCAmplicon SizecDNA: 216 bpgenomic: 4,048
Reverse (6007,20)GTCTCCTTGTTCCGGCCTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.846 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.664 kcal/mol in 3' area
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-1.523 kcal/mol
Amplicon Folding-1.878 kcal/mol outside primersite
Amplicon SequenceGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGATCGA
GAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCCCTT
TGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGACCAAGTCAATCCA
GCGTGTTGACAAATACTCAGGCCGGAACAAGGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 20)
Forward (5789,21)GGTGGGAGTCTTGCATCAAACAmplicon SizecDNA: 208 bpgenomic: 4,040
Reverse (5996,21)CCGGCCTGAGTATTTGTCAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.857 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-2.164 kcal/mol
Forward-Reverse Dimers-0.893 kcal/mol
Amplicon Folding-1.878 kcal/mol outside primersite
Amplicon SequenceGGTGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGAT
CGAGAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCC
CTTTGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGACCAAGTCAAT
CCAGCGTGTTGACAAATACTCAGGCCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 15)
Forward (5792,21)GGGAGTCTTGCATCAAACAGCAmplicon SizecDNA: 215 bpgenomic: 4,047
Reverse (6006,20)TCTCCTTGTTCCGGCCTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.846 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.664 kcal/mol in 3' area
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-1.523 kcal/mol
Amplicon Folding-1.878 kcal/mol outside primersite
Amplicon SequenceGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGATCGA
GAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCCCTT
TGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGACCAAGTCAATCCA
GCGTGTTGACAAATACTCAGGCCGGAACAAGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 14)
Forward (5789,21)GGTGGGAGTCTTGCATCAAACAmplicon SizecDNA: 218 bpgenomic: 4,050
Reverse (6006,20)TCTCCTTGTTCCGGCCTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.857 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.664 kcal/mol in 3' area
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-1.54 kcal/mol
Amplicon Folding-1.878 kcal/mol outside primersite
Amplicon SequenceGGTGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGAT
CGAGAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCC
CTTTGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGACCAAGTCAAT
CCAGCGTGTTGACAAATACTCAGGCCGGAACAAGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 12)
Forward (5789,21)GGTGGGAGTCTTGCATCAAACAmplicon SizecDNA: 219 bpgenomic: 4,051
Reverse (6007,20)GTCTCCTTGTTCCGGCCTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.857 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.664 kcal/mol in 3' area
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-1.54 kcal/mol
Amplicon Folding-1.878 kcal/mol outside primersite
Amplicon SequenceGGTGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGAT
CGAGAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCC
CTTTGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGACCAAGTCAAT
CCAGCGTGTTGACAAATACTCAGGCCGGAACAAGGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 6)
Forward (5789,21)GGTGGGAGTCTTGCATCAAACAmplicon SizecDNA: 211 bpgenomic: 4,043
Reverse (5999,21)GTTCCGGCCTGAGTATTTGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.857 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-1.197 kcal/mol
Amplicon Folding-1.878 kcal/mol outside primersite
Amplicon SequenceGGTGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGAT
CGAGAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCC
CTTTGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGACCAAGTCAAT
CCAGCGTGTTGACAAATACTCAGGCCGGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 3)
Forward (5789,21)GGTGGGAGTCTTGCATCAAACAmplicon SizecDNA: 216 bpgenomic: 4,048
Reverse (6004,21)TCCTTGTTCCGGCCTGAGTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.857 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-1.197 kcal/mol
Amplicon Folding-1.878 kcal/mol outside primersite
Amplicon SequenceGGTGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGAT
CGAGAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCC
CTTTGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGACCAAGTCAAT
CCAGCGTGTTGACAAATACTCAGGCCGGAACAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 1)
Forward (5789,21)GGTGGGAGTCTTGCATCAAACAmplicon SizecDNA: 170 bpgenomic: 4,002
Reverse (5958,21)TCTGCCAGTCTGTCCAGTAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.857 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.748 kcal/mol in 3' area
Reverse Dimers-0.135 kcal/mol
Forward-Reverse Dimers-1.599 kcal/mol
Amplicon Folding-1.429 kcal/mol outside primersite
Amplicon SequenceGGTGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGAT
CGAGAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCC
CTTTGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 2)
Forward (5789,21)GGTGGGAGTCTTGCATCAAACAmplicon SizecDNA: 210 bpgenomic: 4,042
Reverse (5998,22)TTCCGGCCTGAGTATTTGTCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.857 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.474 kcal/mol
Reverse Dimers-2.664 kcal/mol
Forward-Reverse Dimers-1.197 kcal/mol
Amplicon Folding-1.878 kcal/mol outside primersite
Amplicon SequenceGGTGGGAGTCTTGCATCAAACAGCCTCGATCTACTGGGTGGATGCGCATCTGGACCGGAT
CGAGAGTGCTGACCTCAATGGGAAACTGCGGCAGGTCTTGGTCAGCCATGTGTCCCACCC
CTTTGCCCTCACACAGCAAGACAGGTGGATCTACTGGACAGACTGGCAGACCAAGTCAAT
CCAGCGTGTTGACAAATACTCAGGCCGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 33 To Exon 35 (Pair 6)
Forward (6211,21)GGGCTACTGGCATGAGTGAAAAmplicon SizecDNA: 255 bpgenomic: 3,630
Reverse (6465,22)TCAAAGCTGCAATCACCACCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops2.104 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.85 kcal/mol
Amplicon Folding-2.772 kcal/mol outside primersite
Amplicon SequenceGGGCTACTGGCATGAGTGAAAAGAGCCCAGTGCTACCCAACACACCACCTACCACCTTGT
ATTCTTCAACCACCCGGACCCGCACGTCTCTGGAGGAGGTGGAAGGAAGATGCTCTGAAA
GGGATGCCAGGCTGGGCCTCTGTGCACGTTCCAATGACGCTGTTCCTGCTGCTCCAGGGG
AAGGACTTCATATCAGCTACGCCATTGGTGGACTCCTCAGTATTCTGCTGATTTTGGTGG
TGATTGCAGCTTTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2555222 - 5476
Exon 33 To Exon 35 (Pair 5)
Forward (6211,21)GGGCTACTGGCATGAGTGAAAAmplicon SizecDNA: 232 bpgenomic: 3,607
Reverse (6442,22)ATCAGCAGAATACTGAGGAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.308 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-2.037 kcal/mol
Amplicon Folding-2.772 kcal/mol outside primersite
Amplicon SequenceGGGCTACTGGCATGAGTGAAAAGAGCCCAGTGCTACCCAACACACCACCTACCACCTTGT
ATTCTTCAACCACCCGGACCCGCACGTCTCTGGAGGAGGTGGAAGGAAGATGCTCTGAAA
GGGATGCCAGGCTGGGCCTCTGTGCACGTTCCAATGACGCTGTTCCTGCTGCTCCAGGGG
AAGGACTTCATATCAGCTACGCCATTGGTGGACTCCTCAGTATTCTGCTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2325222 - 5453
Exon 33 To Exon 35 (Pair 4)
Forward (6211,21)GGGCTACTGGCATGAGTGAAAAmplicon SizecDNA: 256 bpgenomic: 3,631
Reverse (6466,22)ATCAAAGCTGCAATCACCACCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops2.104 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.85 kcal/mol
Amplicon Folding-2.772 kcal/mol outside primersite
Amplicon SequenceGGGCTACTGGCATGAGTGAAAAGAGCCCAGTGCTACCCAACACACCACCTACCACCTTGT
ATTCTTCAACCACCCGGACCCGCACGTCTCTGGAGGAGGTGGAAGGAAGATGCTCTGAAA
GGGATGCCAGGCTGGGCCTCTGTGCACGTTCCAATGACGCTGTTCCTGCTGCTCCAGGGG
AAGGACTTCATATCAGCTACGCCATTGGTGGACTCCTCAGTATTCTGCTGATTTTGGTGG
TGATTGCAGCTTTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2565222 - 5477
Exon 33 To Exon 35 (Pair 3)
Forward (6211,21)GGGCTACTGGCATGAGTGAAAAmplicon SizecDNA: 259 bpgenomic: 3,634
Reverse (6469,22)AGCATCAAAGCTGCAATCACCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.534 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.85 kcal/mol
Amplicon Folding-2.772 kcal/mol outside primersite
Amplicon SequenceGGGCTACTGGCATGAGTGAAAAGAGCCCAGTGCTACCCAACACACCACCTACCACCTTGT
ATTCTTCAACCACCCGGACCCGCACGTCTCTGGAGGAGGTGGAAGGAAGATGCTCTGAAA
GGGATGCCAGGCTGGGCCTCTGTGCACGTTCCAATGACGCTGTTCCTGCTGCTCCAGGGG
AAGGACTTCATATCAGCTACGCCATTGGTGGACTCCTCAGTATTCTGCTGATTTTGGTGG
TGATTGCAGCTTTGATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2595222 - 5480
Exon 33 To Exon 35 (Pair 2)
Forward (6211,21)GGGCTACTGGCATGAGTGAAAAmplicon SizecDNA: 254 bpgenomic: 3,629
Reverse (6464,22)CAAAGCTGCAATCACCACCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops2.234 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.85 kcal/mol
Amplicon Folding-2.772 kcal/mol outside primersite
Amplicon SequenceGGGCTACTGGCATGAGTGAAAAGAGCCCAGTGCTACCCAACACACCACCTACCACCTTGT
ATTCTTCAACCACCCGGACCCGCACGTCTCTGGAGGAGGTGGAAGGAAGATGCTCTGAAA
GGGATGCCAGGCTGGGCCTCTGTGCACGTTCCAATGACGCTGTTCCTGCTGCTCCAGGGG
AAGGACTTCATATCAGCTACGCCATTGGTGGACTCCTCAGTATTCTGCTGATTTTGGTGG
TGATTGCAGCTTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2545222 - 5475
Exon 33 To Exon 35 (Pair 1)
Forward (6211,21)GGGCTACTGGCATGAGTGAAAAmplicon SizecDNA: 234 bpgenomic: 3,609
Reverse (6444,23)AAATCAGCAGAATACTGAGGAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.308 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-2.037 kcal/mol
Amplicon Folding-2.772 kcal/mol outside primersite
Amplicon SequenceGGGCTACTGGCATGAGTGAAAAGAGCCCAGTGCTACCCAACACACCACCTACCACCTTGT
ATTCTTCAACCACCCGGACCCGCACGTCTCTGGAGGAGGTGGAAGGAAGATGCTCTGAAA
GGGATGCCAGGCTGGGCCTCTGTGCACGTTCCAATGACGCTGTTCCTGCTGCTCCAGGGG
AAGGACTTCATATCAGCTACGCCATTGGTGGACTCCTCAGTATTCTGCTGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2345222 - 5455
Exon 33 To Exon 36 (Pair 1)
Forward (6211,21)GGGCTACTGGCATGAGTGAAAAmplicon SizecDNA: 299 bpgenomic: 5,374
Reverse (6509,22)CATTCCAGGATCAGTGAACTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.289 kcal/mol in 3' area
Reverse Dimers-1.372 kcal/mol
Forward-Reverse Dimers-2.341 kcal/mol
Amplicon Folding-2.954 kcal/mol outside primersite
Amplicon SequenceGGGCTACTGGCATGAGTGAAAAGAGCCCAGTGCTACCCAACACACCACCTACCACCTTGT
ATTCTTCAACCACCCGGACCCGCACGTCTCTGGAGGAGGTGGAAGGAAGATGCTCTGAAA
GGGATGCCAGGCTGGGCCTCTGTGCACGTTCCAATGACGCTGTTCCTGCTGCTCCAGGGG
AAGGACTTCATATCAGCTACGCCATTGGTGGACTCCTCAGTATTCTGCTGATTTTGGTGG
TGATTGCAGCTTTGATGCTGTACAGACACAAAAAATCCAAGTTCACTGATCCTGGAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2995222 - 5520
Exon 34 To Exon 37 (Pair 5)
Forward (6357,21)CGTTCCAATGACGCTGTTCCTAmplicon SizecDNA: 300 bpgenomic: 5,873
Reverse (6656,22)CTTGATCTTCTCCTTGGTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.241 kcal/mol
Forward Dimers-1.221 kcal/mol
Reverse Loops2.249 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.961 kcal/mol outside primersite
Amplicon SequenceCGTTCCAATGACGCTGTTCCTGCTGCTCCAGGGGAAGGACTTCATATCAGCTACGCCATT
GGTGGACTCCTCAGTATTCTGCTGATTTTGGTGGTGATTGCAGCTTTGATGCTGTACAGA
CACAAAAAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCC
TACCGAACATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAAC
CAGCTGTGCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)3005368 - 5667
Exon 34 To Exon 37 (Pair 4)
Forward (6356,21)ACGTTCCAATGACGCTGTTCCAmplicon SizecDNA: 301 bpgenomic: 5,874
Reverse (6656,22)CTTGATCTTCTCCTTGGTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.699 kcal/mol
Forward Dimers-1.942 kcal/mol
Reverse Loops2.249 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.961 kcal/mol outside primersite
Amplicon SequenceACGTTCCAATGACGCTGTTCCTGCTGCTCCAGGGGAAGGACTTCATATCAGCTACGCCAT
TGGTGGACTCCTCAGTATTCTGCTGATTTTGGTGGTGATTGCAGCTTTGATGCTGTACAG
ACACAAAAAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTC
CTACCGAACATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAA
CCAGCTGTGCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAA
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)3015367 - 5667
Exon 34 To Exon 37 (Pair 3)
Forward (6359,21)TTCCAATGACGCTGTTCCTGCAmplicon SizecDNA: 298 bpgenomic: 5,871
Reverse (6656,22)CTTGATCTTCTCCTTGGTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops2.249 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.961 kcal/mol outside primersite
Amplicon SequenceTTCCAATGACGCTGTTCCTGCTGCTCCAGGGGAAGGACTTCATATCAGCTACGCCATTGG
TGGACTCCTCAGTATTCTGCTGATTTTGGTGGTGATTGCAGCTTTGATGCTGTACAGACA
CAAAAAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTA
CCGAACATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCA
GCTGTGCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2985370 - 5667
Exon 34 To Exon 37 (Pair 2)
Forward (6358,21)GTTCCAATGACGCTGTTCCTGAmplicon SizecDNA: 299 bpgenomic: 5,872
Reverse (6656,22)CTTGATCTTCTCCTTGGTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops2.249 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.961 kcal/mol outside primersite
Amplicon SequenceGTTCCAATGACGCTGTTCCTGCTGCTCCAGGGGAAGGACTTCATATCAGCTACGCCATTG
GTGGACTCCTCAGTATTCTGCTGATTTTGGTGGTGATTGCAGCTTTGATGCTGTACAGAC
ACAAAAAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCT
ACCGAACATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACC
AGCTGTGCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2995369 - 5667
Exon 34 To Exon 37 (Pair 1)
Forward (6360,21)TCCAATGACGCTGTTCCTGCTAmplicon SizecDNA: 297 bpgenomic: 5,870
Reverse (6656,22)CTTGATCTTCTCCTTGGTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops2.249 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.961 kcal/mol outside primersite
Amplicon SequenceTCCAATGACGCTGTTCCTGCTGCTCCAGGGGAAGGACTTCATATCAGCTACGCCATTGGT
GGACTCCTCAGTATTCTGCTGATTTTGGTGGTGATTGCAGCTTTGATGCTGTACAGACAC
AAAAAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTAC
CGAACATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAG
CTGTGCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2975371 - 5667
Exon 35 To Exon 37 (Pair 4)
Forward (6421,22)GACTCCTCAGTATTCTGCTGATAmplicon SizecDNA: 298 bpgenomic: 5,288
Reverse (6718,21)AGTTGCTTGAGGTCATCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.159 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops0.997 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-0.961 kcal/mol outside primersite
Amplicon SequenceGACTCCTCAGTATTCTGCTGATTTTGGTGGTGATTGCAGCTTTGATGCTGTACAGACACA
AAAAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTACC
GAACATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGC
TGTGCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATCG
TAGAGGGAATCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGACCTCAAGCAACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2985432 - 5729
Exon 35 To Exon 37 (Pair 3)
Forward (6420,21)GGACTCCTCAGTATTCTGCTGAmplicon SizecDNA: 299 bpgenomic: 5,289
Reverse (6718,21)AGTTGCTTGAGGTCATCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.833 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops0.997 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-0.961 kcal/mol outside primersite
Amplicon SequenceGGACTCCTCAGTATTCTGCTGATTTTGGTGGTGATTGCAGCTTTGATGCTGTACAGACAC
AAAAAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTAC
CGAACATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAG
CTGTGCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATC
GTAGAGGGAATCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGACCTCAAGCAACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2995431 - 5729
Exon 35 To Exon 37 (Pair 2)
Forward (6420,21)GGACTCCTCAGTATTCTGCTGAmplicon SizecDNA: 298 bpgenomic: 5,288
Reverse (6717,21)GTTGCTTGAGGTCATCCCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.833 kcal/mol
Forward Dimers-1.291 kcal/mol
Reverse Loops0.997 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-0.961 kcal/mol outside primersite
Amplicon SequenceGGACTCCTCAGTATTCTGCTGATTTTGGTGGTGATTGCAGCTTTGATGCTGTACAGACAC
AAAAAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTAC
CGAACATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAG
CTGTGCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATC
GTAGAGGGAATCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGACCTCAAGCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2985431 - 5728
Exon 35 To Exon 37 (Pair 1)
Forward (6421,22)GACTCCTCAGTATTCTGCTGATAmplicon SizecDNA: 297 bpgenomic: 5,287
Reverse (6717,21)GTTGCTTGAGGTCATCCCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.159 kcal/mol in 3' area
Forward Dimers-1.291 kcal/mol
Reverse Loops0.997 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-0.961 kcal/mol outside primersite
Amplicon SequenceGACTCCTCAGTATTCTGCTGATTTTGGTGGTGATTGCAGCTTTGATGCTGTACAGACACA
AAAAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTACC
GAACATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGC
TGTGCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATCG
TAGAGGGAATCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGACCTCAAGCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2975432 - 5728
Exon 36 To Exon 37 (Pair 10)
Forward (6550,22)CACAGGAAGTGAAGATTGAAGCAmplicon SizecDNA: 157 bpgenomic: 3,447
Reverse (6706,21)TCATCCCACTCAGCATCATCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.102 kcal/mol
Forward Dimers-0.775 kcal/mol
Reverse Loops2.981 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.609 kcal/mol
Amplicon Folding-0.299 kcal/mol outside primersite
Amplicon SequenceCACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGCTGTGCTATA
AGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATCGTAGAGGGAA
TCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)1575561 - 5717
Exon 36 To Exon 37 (Pair 11)
Forward (6484,22)AATCCAAGTTCACTGATCCTGGAmplicon SizecDNA: 225 bpgenomic: 3,515
Reverse (6708,21)GGTCATCCCACTCAGCATCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.33 kcal/mol
Forward Dimers-1.22 kcal/mol
Reverse Loops1.324 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.791 kcal/mol
Amplicon Folding-0.779 kcal/mol outside primersite
Amplicon SequenceAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTACCGAA
CATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGCTGT
GCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATCGTAG
AGGGAATCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2255495 - 5719
Exon 36 To Exon 37 (Pair 9)
Forward (6550,22)CACAGGAAGTGAAGATTGAAGCAmplicon SizecDNA: 159 bpgenomic: 3,449
Reverse (6708,21)GGTCATCCCACTCAGCATCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.102 kcal/mol
Forward Dimers-0.775 kcal/mol
Reverse Loops1.324 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.609 kcal/mol
Amplicon Folding-0.299 kcal/mol outside primersite
Amplicon SequenceCACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGCTGTGCTATA
AGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATCGTAGAGGGAA
TCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)1595561 - 5719
Exon 36 To Exon 37 (Pair 8)
Forward (6484,22)AATCCAAGTTCACTGATCCTGGAmplicon SizecDNA: 223 bpgenomic: 3,513
Reverse (6706,21)TCATCCCACTCAGCATCATCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.33 kcal/mol
Forward Dimers-1.22 kcal/mol
Reverse Loops2.981 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.791 kcal/mol
Amplicon Folding-0.779 kcal/mol outside primersite
Amplicon SequenceAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTACCGAA
CATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGCTGT
GCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATCGTAG
AGGGAATCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2235495 - 5717
Exon 36 To Exon 37 (Pair 7)
Forward (6484,22)AATCCAAGTTCACTGATCCTGGAmplicon SizecDNA: 234 bpgenomic: 3,524
Reverse (6717,21)GTTGCTTGAGGTCATCCCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.33 kcal/mol
Forward Dimers-1.22 kcal/mol
Reverse Loops0.997 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.645 kcal/mol
Amplicon Folding-0.779 kcal/mol outside primersite
Amplicon SequenceAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTACCGAA
CATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGCTGT
GCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATCGTAG
AGGGAATCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGACCTCAAGCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2345495 - 5728
Exon 36 To Exon 37 (Pair 6)
Forward (6550,22)CACAGGAAGTGAAGATTGAAGCAmplicon SizecDNA: 137 bpgenomic: 3,427
Reverse (6686,20)CCCAGACAGGAGGCAGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.102 kcal/mol
Forward Dimers-0.775 kcal/mol
Reverse Loops0.316 kcal/mol
Reverse Dimers-0.561 kcal/mol
Forward-Reverse Dimers-1.02 kcal/mol
Amplicon Folding-0.299 kcal/mol outside primersite
Amplicon SequenceCACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGCTGTGCTATA
AGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATCGTAGAGGGAA
TCTGCCTCCTGTCTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)1375561 - 5697
Exon 36 To Exon 37 (Pair 4)
Forward (6484,22)AATCCAAGTTCACTGATCCTGGAmplicon SizecDNA: 173 bpgenomic: 3,463
Reverse (6656,22)CTTGATCTTCTCCTTGGTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.33 kcal/mol
Forward Dimers-1.22 kcal/mol
Reverse Loops2.249 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.904 kcal/mol
Amplicon Folding-0.779 kcal/mol outside primersite
Amplicon SequenceAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTACCGAA
CATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGCTGT
GCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)1735495 - 5667
Exon 36 To Exon 37 (Pair 5)
Forward (6550,22)CACAGGAAGTGAAGATTGAAGCAmplicon SizecDNA: 158 bpgenomic: 3,448
Reverse (6707,21)GTCATCCCACTCAGCATCATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.102 kcal/mol
Forward Dimers-0.775 kcal/mol
Reverse Loops2.981 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.609 kcal/mol
Amplicon Folding-0.299 kcal/mol outside primersite
Amplicon SequenceCACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGCTGTGCTATA
AGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATCGTAGAGGGAA
TCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)1585561 - 5718
Exon 36 To Exon 37 (Pair 3)
Forward (6550,22)CACAGGAAGTGAAGATTGAAGCAmplicon SizecDNA: 107 bpgenomic: 3,397
Reverse (6656,22)CTTGATCTTCTCCTTGGTGTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.102 kcal/mol
Forward Dimers-0.775 kcal/mol
Reverse Loops2.249 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-2.763 kcal/mol
Amplicon Folding-0.299 kcal/mol outside primersite
Amplicon SequenceCACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGCTGTGCTATA
AGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)1075561 - 5667
Exon 36 To Exon 37 (Pair 2)
Forward (6484,22)AATCCAAGTTCACTGATCCTGGAmplicon SizecDNA: 224 bpgenomic: 3,514
Reverse (6707,21)GTCATCCCACTCAGCATCATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.33 kcal/mol
Forward Dimers-1.22 kcal/mol
Reverse Loops2.981 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.791 kcal/mol
Amplicon Folding-0.779 kcal/mol outside primersite
Amplicon SequenceAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTACCGAA
CATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGCTGT
GCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATCGTAG
AGGGAATCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2245495 - 5718
Exon 36 To Exon 37 (Pair 1)
Forward (6484,22)AATCCAAGTTCACTGATCCTGGAmplicon SizecDNA: 235 bpgenomic: 3,525
Reverse (6718,21)AGTTGCTTGAGGTCATCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.33 kcal/mol
Forward Dimers-1.22 kcal/mol
Reverse Loops0.997 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.645 kcal/mol
Amplicon Folding-0.779 kcal/mol outside primersite
Amplicon SequenceAATCCAAGTTCACTGATCCTGGAATGGGGAACCTCACCTACAGCAACCCCTCCTACCGAA
CATCCACACAGGAAGTGAAGATTGAAGCAATCCCCAAACCAGCCATGTACAACCAGCTGT
GCTATAAGAAAGAGGGAGGGCCTGACCATAACTACACCAAGGAGAAGATCAAGATCGTAG
AGGGAATCTGCCTCCTGTCTGGGGATGATGCTGAGTGGGATGACCTCAAGCAACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002334 (LRP4)2355495 - 5729
 

See below for some more details.

Program Output:

Loading ...