Design Results for Lipg

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size200
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 6 (Pair 1)
Forward (1017,22)ACGATGTCTTGGGATCAATTGCAmplicon SizecDNA: 149 bpgenomic: 5,973
Reverse (1165,22)TTTGAAGCGATTGGAGTCAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.702 kcal/mol
Reverse Dimers-2.146 kcal/mol
Forward-Reverse Dimers-1.95 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceACGATGTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATG
AGCGAGCCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCT
TCCAGTGCACTGACTCCAATCGCTTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1491016 - 1164
Exon 5 To Exon 6 (Pair 2)
Forward (1023,23)TCTTGGGATCAATTGCATATGGAAmplicon SizecDNA: 168 bpgenomic: 5,992
Reverse (1190,20)TGCGGCAGCTCAGACAGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops1.006 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.322 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCGAG
CCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCAGT
GCACTGACTCCAATCGCTTCAAAAAGGGGATCTGTCTGAGCTGCCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1681022 - 1189
Exon 5 To Exon 6 (Pair 3)
Forward (1017,22)ACGATGTCTTGGGATCAATTGCAmplicon SizecDNA: 74 bpgenomic: 5,898
Reverse (1090,19)GTGGACGGCTCGCTCATGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.503 kcal/mol in 3' area
Reverse Dimers-1.36 kcal/mol
Forward-Reverse Dimers-1.469 kcal/mol
Amplicon Folding0.347 kcal/mol outside primersite
Amplicon SequenceACGATGTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATG
AGCGAGCCGTCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)741016 - 1089
Exon 5 To Exon 6 (Pair 4)
Forward (1017,22)ACGATGTCTTGGGATCAATTGCAmplicon SizecDNA: 192 bpgenomic: 6,016
Reverse (1208,22)TGCTATTACAACGGTTCTTGCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.291 kcal/mol
Reverse Dimers-1.754 kcal/mol
Forward-Reverse Dimers-1.677 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceACGATGTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATG
AGCGAGCCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCT
TCCAGTGCACTGACTCCAATCGCTTCAAAAAGGGGATCTGTCTGAGCTGCCGCAAGAACC
GTTGTAATAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1921016 - 1207
Exon 5 To Exon 6 (Pair 5)
Forward (1023,23)TCTTGGGATCAATTGCATATGGAAmplicon SizecDNA: 140 bpgenomic: 5,964
Reverse (1162,21)GAAGCGATTGGAGTCAGTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops0.702 kcal/mol
Reverse Dimers-2.146 kcal/mol
Forward-Reverse Dimers-2.126 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCGAG
CCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCAGT
GCACTGACTCCAATCGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1401022 - 1161
Exon 5 To Exon 6 (Pair 6)
Forward (1023,23)TCTTGGGATCAATTGCATATGGAAmplicon SizecDNA: 143 bpgenomic: 5,967
Reverse (1165,22)TTTGAAGCGATTGGAGTCAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops0.702 kcal/mol
Reverse Dimers-2.146 kcal/mol
Forward-Reverse Dimers-2.126 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCGAG
CCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCAGT
GCACTGACTCCAATCGCTTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1431022 - 1164
Exon 5 To Exon 6 (Pair 7)
Forward (1021,23)TGTCTTGGGATCAATTGCATATGAmplicon SizecDNA: 145 bpgenomic: 5,969
Reverse (1165,22)TTTGAAGCGATTGGAGTCAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops0.702 kcal/mol
Reverse Dimers-2.146 kcal/mol
Forward-Reverse Dimers-2.126 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTGTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCG
AGCCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCA
GTGCACTGACTCCAATCGCTTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1451020 - 1164
Exon 5 To Exon 6 (Pair 8)
Forward (1023,23)TCTTGGGATCAATTGCATATGGAAmplicon SizecDNA: 173 bpgenomic: 5,997
Reverse (1195,20)GTTCTTGCGGCAGCTCAGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops1.006 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.322 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCGAG
CCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCAGT
GCACTGACTCCAATCGCTTCAAAAAGGGGATCTGTCTGAGCTGCCGCAAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1731022 - 1194
Exon 5 To Exon 6 (Pair 9)
Forward (1021,23)TGTCTTGGGATCAATTGCATATGAmplicon SizecDNA: 143 bpgenomic: 5,967
Reverse (1163,21)TGAAGCGATTGGAGTCAGTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops0.702 kcal/mol
Reverse Dimers-2.146 kcal/mol
Forward-Reverse Dimers-2.126 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTGTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCG
AGCCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCA
GTGCACTGACTCCAATCGCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1431020 - 1162
Exon 5 To Exon 6 (Pair 10)
Forward (1023,23)TCTTGGGATCAATTGCATATGGAAmplicon SizecDNA: 186 bpgenomic: 6,010
Reverse (1208,22)TGCTATTACAACGGTTCTTGCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops1.291 kcal/mol
Reverse Dimers-1.754 kcal/mol
Forward-Reverse Dimers-1.333 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCGAG
CCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCAGT
GCACTGACTCCAATCGCTTCAAAAAGGGGATCTGTCTGAGCTGCCGCAAGAACCGTTGTA
ATAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1861022 - 1207
Exon 5 To Exon 6 (Pair 11)
Forward (1021,23)TGTCTTGGGATCAATTGCATATGAmplicon SizecDNA: 142 bpgenomic: 5,966
Reverse (1162,21)GAAGCGATTGGAGTCAGTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops0.702 kcal/mol
Reverse Dimers-2.146 kcal/mol
Forward-Reverse Dimers-2.126 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTGTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCG
AGCCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCA
GTGCACTGACTCCAATCGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1421020 - 1161
Exon 5 To Exon 6 (Pair 12)
Forward (1023,23)TCTTGGGATCAATTGCATATGGAAmplicon SizecDNA: 170 bpgenomic: 5,994
Reverse (1192,20)CTTGCGGCAGCTCAGACAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops1.006 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.322 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCGAG
CCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCAGT
GCACTGACTCCAATCGCTTCAAAAAGGGGATCTGTCTGAGCTGCCGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1701022 - 1191
Exon 5 To Exon 6 (Pair 13)
Forward (1023,23)TCTTGGGATCAATTGCATATGGAAmplicon SizecDNA: 171 bpgenomic: 5,995
Reverse (1193,20)TCTTGCGGCAGCTCAGACAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops1.006 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.322 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCGAG
CCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCAGT
GCACTGACTCCAATCGCTTCAAAAAGGGGATCTGTCTGAGCTGCCGCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1711022 - 1192
Exon 5 To Exon 6 (Pair 14)
Forward (1023,23)TCTTGGGATCAATTGCATATGGAAmplicon SizecDNA: 188 bpgenomic: 6,012
Reverse (1210,23)AATGCTATTACAACGGTTCTTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops1.291 kcal/mol
Reverse Dimers-1.754 kcal/mol
Forward-Reverse Dimers-2.684 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCGAG
CCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCAGT
GCACTGACTCCAATCGCTTCAAAAAGGGGATCTGTCTGAGCTGCCGCAAGAACCGTTGTA
ATAGCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1881022 - 1209
Exon 5 To Exon 6 (Pair 15)
Forward (1017,22)ACGATGTCTTGGGATCAATTGCAmplicon SizecDNA: 72 bpgenomic: 5,896
Reverse (1088,19)GGACGGCTCGCTCATGCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.351 kcal/mol in 3' area
Reverse Dimers-1.326 kcal/mol
Forward-Reverse Dimers-1.469 kcal/mol
Amplicon Folding0.347 kcal/mol outside primersite
Amplicon SequenceACGATGTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATG
AGCGAGCCGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)721016 - 1087
Exon 5 To Exon 6 (Pair 16)
Forward (1023,23)TCTTGGGATCAATTGCATATGGAAmplicon SizecDNA: 141 bpgenomic: 5,965
Reverse (1163,21)TGAAGCGATTGGAGTCAGTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol
Forward Dimers-1.508 kcal/mol
Reverse Loops0.702 kcal/mol
Reverse Dimers-2.146 kcal/mol
Forward-Reverse Dimers-2.126 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATGAGCGAG
CCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCTTCCAGT
GCACTGACTCCAATCGCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1411022 - 1162
Exon 5 To Exon 6 (Pair 17)
Forward (1017,22)ACGATGTCTTGGGATCAATTGCAmplicon SizecDNA: 194 bpgenomic: 6,018
Reverse (1210,23)AATGCTATTACAACGGTTCTTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.291 kcal/mol
Reverse Dimers-1.754 kcal/mol
Forward-Reverse Dimers-1.677 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceACGATGTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATG
AGCGAGCCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCT
TCCAGTGCACTGACTCCAATCGCTTCAAAAAGGGGATCTGTCTGAGCTGCCGCAAGAACC
GTTGTAATAGCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1941016 - 1209
Exon 5 To Exon 6 (Pair 18)
Forward (1017,22)ACGATGTCTTGGGATCAATTGCAmplicon SizecDNA: 147 bpgenomic: 5,971
Reverse (1163,21)TGAAGCGATTGGAGTCAGTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.702 kcal/mol
Reverse Dimers-2.146 kcal/mol
Forward-Reverse Dimers-1.95 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceACGATGTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATG
AGCGAGCCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCT
TCCAGTGCACTGACTCCAATCGCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1471016 - 1162
Exon 5 To Exon 6 (Pair 19)
Forward (1017,22)ACGATGTCTTGGGATCAATTGCAmplicon SizecDNA: 75 bpgenomic: 5,899
Reverse (1091,19)GGTGGACGGCTCGCTCATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.505 kcal/mol
Reverse Dimers-1.36 kcal/mol
Forward-Reverse Dimers-1.469 kcal/mol
Amplicon Folding0.347 kcal/mol outside primersite
Amplicon SequenceACGATGTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATG
AGCGAGCCGTCCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)751016 - 1090
Exon 5 To Exon 6 (Pair 20)
Forward (1017,22)ACGATGTCTTGGGATCAATTGCAmplicon SizecDNA: 146 bpgenomic: 5,970
Reverse (1162,21)GAAGCGATTGGAGTCAGTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.702 kcal/mol
Reverse Dimers-2.146 kcal/mol
Forward-Reverse Dimers-1.95 kcal/mol
Amplicon Folding-2.177 kcal/mol outside primersite
Amplicon SequenceACGATGTCTTGGGATCAATTGCATATGGAACAATCACAGAGGTGGTAAAATGTGAGCATG
AGCGAGCCGTCCACCTCTTTGTTGACTCTCTGGTGAATCAGGACAAGCCGAGTTTTGCCT
TCCAGTGCACTGACTCCAATCGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006033 (LIPG)1461016 - 1161
 

See below for some more details.

Program Output:

Loading ...