Design Results for MCOLN2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size90Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 6 (Pair 1)
Forward (839,23)CATTACAAGAAAGGGACCATGTTAmplicon SizecDNA: 141 bpgenomic: 4,041
Reverse (979,23)CAGTCTGAAGAATGATGAGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol in 3' area
Forward Dimers-0.857 kcal/mol
Reverse Loops0.718 kcal/mol in 3' area
Reverse Dimers-1.337 kcal/mol
Forward-Reverse Dimers-1.531 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTT
GAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAG
AACTCATCATTCTTCAGACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)141740 - 880
Exon 5 To Exon 6 (Pair 2)
Forward (849,23)AAGGGACCATGTTTCCTTCTAATAmplicon SizecDNA: 133 bpgenomic: 4,033
Reverse (981,23)TCCAGTCTGAAGAATGATGAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.785 kcal/mol
Forward Dimers-2.528 kcal/mol
Reverse Loops0.834 kcal/mol
Reverse Dimers-1.548 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGCTCGATT
GTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACTCATCAT
TCTTCAGACTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)133750 - 882
Exon 5 To Exon 6 (Pair 3)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 107 bpgenomic: 4,007
Reverse (935,22)AGAGGTCCTGAAGGTCTAATTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.458 kcal/mol
Reverse Dimers-2.404 kcal/mol
Forward-Reverse Dimers-1.154 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)107730 - 836
Exon 5 To Exon 6 (Pair 4)
Forward (832,23)TAAGCAGCATTACAAGAAAGGGAAmplicon SizecDNA: 141 bpgenomic: 4,041
Reverse (972,23)AAGAATGATGAGTTCTTCCAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.261 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.213 kcal/mol
Reverse Dimers-0.658 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAA
CGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGA
CTGGAAGAACTCATCATTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)141733 - 873
Exon 5 To Exon 6 (Pair 5)
Forward (839,23)CATTACAAGAAAGGGACCATGTTAmplicon SizecDNA: 145 bpgenomic: 4,045
Reverse (983,23)ATTCCAGTCTGAAGAATGATGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol in 3' area
Forward Dimers-0.857 kcal/mol
Reverse Loops0.834 kcal/mol
Reverse Dimers-1.548 kcal/mol
Forward-Reverse Dimers-1.531 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTT
GAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAG
AACTCATCATTCTTCAGACTGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)145740 - 884
Exon 5 To Exon 6 (Pair 6)
Forward (841,23)TTACAAGAAAGGGACCATGTTTCAmplicon SizecDNA: 132 bpgenomic: 4,032
Reverse (972,23)AAGAATGATGAGTTCTTCCAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol in 3' area
Forward Dimers-0.857 kcal/mol
Reverse Loops0.213 kcal/mol
Reverse Dimers-0.658 kcal/mol
Forward-Reverse Dimers-1.569 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGA
GCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAA
CTCATCATTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)132742 - 873
Exon 5 To Exon 6 (Pair 7)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 109 bpgenomic: 4,009
Reverse (937,21)GGAGAGGTCCTGAAGGTCTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.191 kcal/mol
Reverse Dimers-2.404 kcal/mol
Forward-Reverse Dimers-1.154 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)109730 - 838
Exon 5 To Exon 6 (Pair 8)
Forward (851,22)GGGACCATGTTTCCTTCTAATGAmplicon SizecDNA: 122 bpgenomic: 4,022
Reverse (972,23)AAGAATGATGAGTTCTTCCAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-0.857 kcal/mol
Reverse Loops0.213 kcal/mol
Reverse Dimers-0.658 kcal/mol
Forward-Reverse Dimers-1.252 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGCTCGATTGT
GTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACTCATCATTC
TT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)122752 - 873
Exon 5 To Exon 6 (Pair 9)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 106 bpgenomic: 4,006
Reverse (934,22)GAGGTCCTGAAGGTCTAATTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.458 kcal/mol
Reverse Dimers-2.404 kcal/mol
Forward-Reverse Dimers-1.154 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)106730 - 835
Exon 5 To Exon 6 (Pair 10)
Forward (849,23)AAGGGACCATGTTTCCTTCTAATAmplicon SizecDNA: 135 bpgenomic: 4,035
Reverse (983,23)ATTCCAGTCTGAAGAATGATGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.785 kcal/mol
Forward Dimers-2.528 kcal/mol
Reverse Loops0.834 kcal/mol
Reverse Dimers-1.548 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGCTCGATT
GTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACTCATCAT
TCTTCAGACTGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)135750 - 884
Exon 5 To Exon 6 (Pair 11)
Forward (843,22)ACAAGAAAGGGACCATGTTTCCAmplicon SizecDNA: 130 bpgenomic: 4,030
Reverse (972,23)AAGAATGATGAGTTCTTCCAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol in 3' area
Forward Dimers-0.857 kcal/mol
Reverse Loops0.213 kcal/mol
Reverse Dimers-0.658 kcal/mol
Forward-Reverse Dimers-1.569 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGC
TCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACT
CATCATTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)130744 - 873
Exon 5 To Exon 6 (Pair 12)
Forward (849,23)AAGGGACCATGTTTCCTTCTAATAmplicon SizecDNA: 131 bpgenomic: 4,031
Reverse (979,23)CAGTCTGAAGAATGATGAGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.785 kcal/mol
Forward Dimers-2.528 kcal/mol
Reverse Loops0.718 kcal/mol in 3' area
Reverse Dimers-1.337 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGCTCGATT
GTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACTCATCAT
TCTTCAGACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)131750 - 880
Exon 5 To Exon 6 (Pair 13)
Forward (830,23)TGTAAGCAGCATTACAAGAAAGGAmplicon SizecDNA: 112 bpgenomic: 4,012
Reverse (941,21)TCTTGGAGAGGTCCTGAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.418 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.92 kcal/mol
Reverse Dimers-2.404 kcal/mol
Forward-Reverse Dimers-1.812 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGAC
AACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)112731 - 842
Exon 5 To Exon 6 (Pair 14)
Forward (851,22)GGGACCATGTTTCCTTCTAATGAmplicon SizecDNA: 131 bpgenomic: 4,031
Reverse (981,23)TCCAGTCTGAAGAATGATGAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-0.857 kcal/mol
Reverse Loops0.834 kcal/mol
Reverse Dimers-1.548 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGCTCGATTGT
GTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACTCATCATTC
TTCAGACTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)131752 - 882
Exon 5 To Exon 6 (Pair 15)
Forward (832,23)TAAGCAGCATTACAAGAAAGGGAAmplicon SizecDNA: 138 bpgenomic: 4,038
Reverse (969,22)AATGATGAGTTCTTCCAGTCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.261 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops2.042 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-2.468 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAA
CGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGA
CTGGAAGAACTCATCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)138733 - 870
Exon 5 To Exon 6 (Pair 16)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 111 bpgenomic: 4,011
Reverse (939,21)TTGGAGAGGTCCTGAAGGTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.92 kcal/mol
Reverse Dimers-2.404 kcal/mol
Forward-Reverse Dimers-1.154 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)111730 - 840
Exon 5 To Exon 6 (Pair 17)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 108 bpgenomic: 4,008
Reverse (936,22)GAGAGGTCCTGAAGGTCTAATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.267 kcal/mol
Reverse Dimers-2.404 kcal/mol
Forward-Reverse Dimers-1.154 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)108730 - 837
Exon 5 To Exon 6 (Pair 18)
Forward (834,22)AGCAGCATTACAAGAAAGGGACAmplicon SizecDNA: 146 bpgenomic: 4,046
Reverse (979,23)CAGTCTGAAGAATGATGAGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.261 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.718 kcal/mol in 3' area
Reverse Dimers-1.337 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACG
ACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACT
GGAAGAACTCATCATTCTTCAGACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)146735 - 880
Exon 5 To Exon 6 (Pair 19)
Forward (779,21)GGGACCCTTGGTTATGGAGAAAmplicon SizecDNA: 151 bpgenomic: 4,051
Reverse (929,23)CCTGAAGGTCTAATTGAACACAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.362 kcal/mol
Forward Dimers-2.238 kcal/mol
Reverse Loops1.763 kcal/mol
Reverse Dimers-0.619 kcal/mol
Forward-Reverse Dimers-1.78 kcal/mol
Amplicon Folding-1.309 kcal/mol outside primersite
Amplicon SequenceGGGACCCTTGGTTATGGAGAAAATGAAGACAATAGAATTGGCTTAAAAGTCTGTAAGCAG
CATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTT
GAGCTCGATTGTGTTCAATTAGACCTTCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)151680 - 830
Exon 5 To Exon 6 (Pair 20)
Forward (849,23)AAGGGACCATGTTTCCTTCTAATAmplicon SizecDNA: 124 bpgenomic: 4,024
Reverse (972,23)AAGAATGATGAGTTCTTCCAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.785 kcal/mol
Forward Dimers-2.528 kcal/mol
Reverse Loops0.213 kcal/mol
Reverse Dimers-0.658 kcal/mol
Forward-Reverse Dimers-1.252 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGCTCGATT
GTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACTCATCAT
TCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)124750 - 873
Exon 5 To Exon 6 (Pair 21)
Forward (839,23)CATTACAAGAAAGGGACCATGTTAmplicon SizecDNA: 144 bpgenomic: 4,044
Reverse (982,23)TTCCAGTCTGAAGAATGATGAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol in 3' area
Forward Dimers-0.857 kcal/mol
Reverse Loops0.834 kcal/mol
Reverse Dimers-1.548 kcal/mol
Forward-Reverse Dimers-1.531 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTT
GAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAG
AACTCATCATTCTTCAGACTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)144740 - 883
Exon 5 To Exon 6 (Pair 22)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 102 bpgenomic: 4,002
Reverse (930,23)TCCTGAAGGTCTAATTGAACACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.458 kcal/mol
Reverse Dimers-0.924 kcal/mol
Forward-Reverse Dimers-1.154 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)102730 - 831
Exon 5 To Exon 6 (Pair 23)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 151 bpgenomic: 4,051
Reverse (979,23)CAGTCTGAAGAATGATGAGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.718 kcal/mol in 3' area
Reverse Dimers-1.337 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCC
GGACTGGAAGAACTCATCATTCTTCAGACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)151730 - 880
Exon 5 To Exon 6 (Pair 24)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 141 bpgenomic: 4,041
Reverse (969,22)AATGATGAGTTCTTCCAGTCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops2.042 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-2.468 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCC
GGACTGGAAGAACTCATCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)141730 - 870
Exon 5 To Exon 6 (Pair 25)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 144 bpgenomic: 4,044
Reverse (972,23)AAGAATGATGAGTTCTTCCAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.213 kcal/mol
Reverse Dimers-0.658 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCC
GGACTGGAAGAACTCATCATTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)144730 - 873
Exon 5 To Exon 6 (Pair 26)
Forward (839,23)CATTACAAGAAAGGGACCATGTTAmplicon SizecDNA: 143 bpgenomic: 4,043
Reverse (981,23)TCCAGTCTGAAGAATGATGAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol in 3' area
Forward Dimers-0.857 kcal/mol
Reverse Loops0.834 kcal/mol
Reverse Dimers-1.548 kcal/mol
Forward-Reverse Dimers-1.531 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTT
GAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAG
AACTCATCATTCTTCAGACTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)143740 - 882
Exon 5 To Exon 6 (Pair 27)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 101 bpgenomic: 4,001
Reverse (929,23)CCTGAAGGTCTAATTGAACACAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.763 kcal/mol
Reverse Dimers-0.619 kcal/mol
Forward-Reverse Dimers-1.154 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)101730 - 830
Exon 5 To Exon 6 (Pair 28)
Forward (849,23)AAGGGACCATGTTTCCTTCTAATAmplicon SizecDNA: 134 bpgenomic: 4,034
Reverse (982,23)TTCCAGTCTGAAGAATGATGAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.785 kcal/mol
Forward Dimers-2.528 kcal/mol
Reverse Loops0.834 kcal/mol
Reverse Dimers-1.548 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGCTCGATT
GTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACTCATCAT
TCTTCAGACTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)134750 - 883
Exon 5 To Exon 6 (Pair 29)
Forward (832,23)TAAGCAGCATTACAAGAAAGGGAAmplicon SizecDNA: 111 bpgenomic: 4,011
Reverse (942,21)TTCTTGGAGAGGTCCTGAAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.261 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.92 kcal/mol
Reverse Dimers-2.404 kcal/mol
Forward-Reverse Dimers-2.065 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAA
CGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)111733 - 843
Exon 5 To Exon 6 (Pair 30)
Forward (839,23)CATTACAAGAAAGGGACCATGTTAmplicon SizecDNA: 134 bpgenomic: 4,034
Reverse (972,23)AAGAATGATGAGTTCTTCCAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol in 3' area
Forward Dimers-0.857 kcal/mol
Reverse Loops0.213 kcal/mol
Reverse Dimers-0.658 kcal/mol
Forward-Reverse Dimers-1.569 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTT
GAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAG
AACTCATCATTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)134740 - 873
Exon 5 To Exon 6 (Pair 31)
Forward (830,23)TGTAAGCAGCATTACAAGAAAGGAmplicon SizecDNA: 150 bpgenomic: 4,050
Reverse (979,23)CAGTCTGAAGAATGATGAGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.418 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.718 kcal/mol in 3' area
Reverse Dimers-1.337 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGAC
AACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCG
GACTGGAAGAACTCATCATTCTTCAGACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)150731 - 880
Exon 5 To Exon 6 (Pair 32)
Forward (843,22)ACAAGAAAGGGACCATGTTTCCAmplicon SizecDNA: 137 bpgenomic: 4,037
Reverse (979,23)CAGTCTGAAGAATGATGAGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol in 3' area
Forward Dimers-0.857 kcal/mol
Reverse Loops0.718 kcal/mol in 3' area
Reverse Dimers-1.337 kcal/mol
Forward-Reverse Dimers-1.252 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGC
TCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACT
CATCATTCTTCAGACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)137744 - 880
Exon 5 To Exon 6 (Pair 33)
Forward (851,22)GGGACCATGTTTCCTTCTAATGAmplicon SizecDNA: 132 bpgenomic: 4,032
Reverse (982,23)TTCCAGTCTGAAGAATGATGAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-0.857 kcal/mol
Reverse Loops0.834 kcal/mol
Reverse Dimers-1.548 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGCTCGATTGT
GTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACTCATCATTC
TTCAGACTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)132752 - 883
Exon 5 To Exon 6 (Pair 34)
Forward (832,23)TAAGCAGCATTACAAGAAAGGGAAmplicon SizecDNA: 148 bpgenomic: 4,048
Reverse (979,23)CAGTCTGAAGAATGATGAGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.261 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.718 kcal/mol in 3' area
Reverse Dimers-1.337 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAA
CGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGA
CTGGAAGAACTCATCATTCTTCAGACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)148733 - 880
Exon 5 To Exon 6 (Pair 35)
Forward (830,23)TGTAAGCAGCATTACAAGAAAGGAmplicon SizecDNA: 140 bpgenomic: 4,040
Reverse (969,22)AATGATGAGTTCTTCCAGTCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.418 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops2.042 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-2.468 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGAC
AACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCG
GACTGGAAGAACTCATCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)140731 - 870
Exon 5 To Exon 6 (Pair 36)
Forward (839,23)CATTACAAGAAAGGGACCATGTTAmplicon SizecDNA: 92 bpgenomic: 3,992
Reverse (930,23)TCCTGAAGGTCTAATTGAACACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol in 3' area
Forward Dimers-0.857 kcal/mol
Reverse Loops1.458 kcal/mol
Reverse Dimers-0.924 kcal/mol
Forward-Reverse Dimers-2.083 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTT
GAGCTCGATTGTGTTCAATTAGACCTTCAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)92740 - 831
Exon 5 To Exon 6 (Pair 37)
Forward (841,23)TTACAAGAAAGGGACCATGTTTCAmplicon SizecDNA: 139 bpgenomic: 4,039
Reverse (979,23)CAGTCTGAAGAATGATGAGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol in 3' area
Forward Dimers-0.857 kcal/mol
Reverse Loops0.718 kcal/mol in 3' area
Reverse Dimers-1.337 kcal/mol
Forward-Reverse Dimers-1.252 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGA
GCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAA
CTCATCATTCTTCAGACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)139742 - 880
Exon 5 To Exon 6 (Pair 38)
Forward (851,22)GGGACCATGTTTCCTTCTAATGAmplicon SizecDNA: 129 bpgenomic: 4,029
Reverse (979,23)CAGTCTGAAGAATGATGAGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-0.857 kcal/mol
Reverse Loops0.718 kcal/mol in 3' area
Reverse Dimers-1.337 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGCTCGATTGT
GTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACTCATCATTC
TTCAGACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)129752 - 880
Exon 5 To Exon 6 (Pair 39)
Forward (830,23)TGTAAGCAGCATTACAAGAAAGGAmplicon SizecDNA: 143 bpgenomic: 4,043
Reverse (972,23)AAGAATGATGAGTTCTTCCAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.418 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.213 kcal/mol
Reverse Dimers-0.658 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGAC
AACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCG
GACTGGAAGAACTCATCATTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)143731 - 873
Exon 5 To Exon 6 (Pair 40)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 110 bpgenomic: 4,010
Reverse (938,21)TGGAGAGGTCCTGAAGGTCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.92 kcal/mol
Reverse Dimers-2.404 kcal/mol
Forward-Reverse Dimers-1.154 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)110730 - 839
Exon 5 To Exon 6 (Pair 41)
Forward (834,22)AGCAGCATTACAAGAAAGGGACAmplicon SizecDNA: 109 bpgenomic: 4,009
Reverse (942,21)TTCTTGGAGAGGTCCTGAAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.261 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.92 kcal/mol
Reverse Dimers-2.404 kcal/mol
Forward-Reverse Dimers-2.065 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACG
ACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)109735 - 843
Exon 5 To Exon 6 (Pair 42)
Forward (834,22)AGCAGCATTACAAGAAAGGGACAmplicon SizecDNA: 108 bpgenomic: 4,008
Reverse (941,21)TCTTGGAGAGGTCCTGAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.261 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.92 kcal/mol
Reverse Dimers-2.404 kcal/mol
Forward-Reverse Dimers-1.812 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACG
ACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)108735 - 842
Exon 5 To Exon 6 (Pair 43)
Forward (851,22)GGGACCATGTTTCCTTCTAATGAmplicon SizecDNA: 133 bpgenomic: 4,033
Reverse (983,23)ATTCCAGTCTGAAGAATGATGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-0.857 kcal/mol
Reverse Loops0.834 kcal/mol
Reverse Dimers-1.548 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACGACGTTGAGCTCGATTGT
GTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACTGGAAGAACTCATCATTC
TTCAGACTGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)133752 - 884
Exon 5 To Exon 6 (Pair 44)
Forward (832,23)TAAGCAGCATTACAAGAAAGGGAAmplicon SizecDNA: 110 bpgenomic: 4,010
Reverse (941,21)TCTTGGAGAGGTCCTGAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.261 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.92 kcal/mol
Reverse Dimers-2.404 kcal/mol
Forward-Reverse Dimers-1.812 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAA
CGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)110733 - 842
Exon 5 To Exon 6 (Pair 45)
Forward (829,23)CTGTAAGCAGCATTACAAGAAAGAmplicon SizecDNA: 104 bpgenomic: 4,004
Reverse (932,22)GGTCCTGAAGGTCTAATTGAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.458 kcal/mol
Reverse Dimers-0.924 kcal/mol
Forward-Reverse Dimers-1.154 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceCTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGA
CAACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)104730 - 833
Exon 5 To Exon 6 (Pair 46)
Forward (834,22)AGCAGCATTACAAGAAAGGGACAmplicon SizecDNA: 139 bpgenomic: 4,039
Reverse (972,23)AAGAATGATGAGTTCTTCCAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.261 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops0.213 kcal/mol
Reverse Dimers-0.658 kcal/mol
Forward-Reverse Dimers-2.872 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACG
ACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACT
GGAAGAACTCATCATTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)139735 - 873
Exon 5 To Exon 6 (Pair 47)
Forward (830,23)TGTAAGCAGCATTACAAGAAAGGAmplicon SizecDNA: 100 bpgenomic: 4,000
Reverse (929,23)CCTGAAGGTCTAATTGAACACAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.418 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.763 kcal/mol
Reverse Dimers-0.619 kcal/mol
Forward-Reverse Dimers-1.154 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceTGTAAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGAC
AACGACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)100731 - 830
Exon 5 To Exon 6 (Pair 48)
Forward (834,22)AGCAGCATTACAAGAAAGGGACAmplicon SizecDNA: 136 bpgenomic: 4,036
Reverse (969,22)AATGATGAGTTCTTCCAGTCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.261 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops2.042 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-2.468 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAGCAGCATTACAAGAAAGGGACCATGTTTCCTTCTAATGAGACACTGAATATTGACAACG
ACGTTGAGCTCGATTGTGTTCAATTAGACCTTCAGGACCTCTCCAAGAAGCCTCCGGACT
GGAAGAACTCATCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)136735 - 870
Exon 9 To Exon 10 (Pair 1)
Forward (1272,23)CCATTGTTCTTGCTCTAAGGTTAAmplicon SizecDNA: 144 bpgenomic: 1,320
Reverse (1415,23)TGATTGTCATTAGGTCGCTGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.59 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.542 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTACA
AGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTGA
TTATCAGCGACCTAATGACAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1441173 - 1316
Exon 9 To Exon 10 (Pair 2)
Forward (1270,23)ATCCATTGTTCTTGCTCTAAGGTAmplicon SizecDNA: 148 bpgenomic: 1,324
Reverse (1417,23)AATGATTGTCATTAGGTCGCTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.499 kcal/mol
Reverse Dimers-0.973 kcal/mol
Forward-Reverse Dimers-1.338 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceATCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTA
CAAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGT
GATTATCAGCGACCTAATGACAATCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1481171 - 1318
Exon 9 To Exon 10 (Pair 3)
Forward (1272,23)CCATTGTTCTTGCTCTAAGGTTAAmplicon SizecDNA: 148 bpgenomic: 1,324
Reverse (1419,22)CCAATGATTGTCATTAGGTCGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.184 kcal/mol
Reverse Dimers-1.288 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTACA
AGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTGA
TTATCAGCGACCTAATGACAATCATTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1481173 - 1320
Exon 9 To Exon 10 (Pair 4)
Forward (1272,23)CCATTGTTCTTGCTCTAAGGTTAAmplicon SizecDNA: 146 bpgenomic: 1,322
Reverse (1417,23)AATGATTGTCATTAGGTCGCTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.499 kcal/mol
Reverse Dimers-0.973 kcal/mol
Forward-Reverse Dimers-1.338 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTACA
AGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTGA
TTATCAGCGACCTAATGACAATCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1461173 - 1318
Exon 9 To Exon 10 (Pair 5)
Forward (1270,23)ATCCATTGTTCTTGCTCTAAGGTAmplicon SizecDNA: 147 bpgenomic: 1,323
Reverse (1416,23)ATGATTGTCATTAGGTCGCTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.04 kcal/mol
Reverse Dimers-0.432 kcal/mol
Forward-Reverse Dimers-0.797 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceATCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTA
CAAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGT
GATTATCAGCGACCTAATGACAATCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1471171 - 1317
Exon 9 To Exon 10 (Pair 6)
Forward (1272,23)CCATTGTTCTTGCTCTAAGGTTAAmplicon SizecDNA: 149 bpgenomic: 1,325
Reverse (1420,22)GCCAATGATTGTCATTAGGTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.184 kcal/mol
Reverse Dimers-1.288 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTACA
AGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTGA
TTATCAGCGACCTAATGACAATCATTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1491173 - 1321
Exon 9 To Exon 10 (Pair 7)
Forward (1268,23)AGATCCATTGTTCTTGCTCTAAGAmplicon SizecDNA: 149 bpgenomic: 1,325
Reverse (1416,23)ATGATTGTCATTAGGTCGCTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.674 kcal/mol in 3' area
Forward Dimers-0.2 kcal/mol
Reverse Loops1.04 kcal/mol
Reverse Dimers-0.432 kcal/mol
Forward-Reverse Dimers-0.797 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceAGATCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAG
TACAAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTG
GTGATTATCAGCGACCTAATGACAATCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1491169 - 1317
Exon 9 To Exon 10 (Pair 8)
Forward (1271,23)TCCATTGTTCTTGCTCTAAGGTTAmplicon SizecDNA: 150 bpgenomic: 1,326
Reverse (1420,22)GCCAATGATTGTCATTAGGTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.184 kcal/mol
Reverse Dimers-1.288 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceTCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTAC
AAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTG
ATTATCAGCGACCTAATGACAATCATTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1501172 - 1321
Exon 9 To Exon 10 (Pair 9)
Forward (1271,23)TCCATTGTTCTTGCTCTAAGGTTAmplicon SizecDNA: 147 bpgenomic: 1,323
Reverse (1417,23)AATGATTGTCATTAGGTCGCTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.499 kcal/mol
Reverse Dimers-0.973 kcal/mol
Forward-Reverse Dimers-1.338 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceTCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTAC
AAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTG
ATTATCAGCGACCTAATGACAATCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1471172 - 1318
Exon 9 To Exon 10 (Pair 10)
Forward (1271,23)TCCATTGTTCTTGCTCTAAGGTTAmplicon SizecDNA: 144 bpgenomic: 1,320
Reverse (1414,23)GATTGTCATTAGGTCGCTGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.59 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.542 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceTCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTAC
AAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTG
ATTATCAGCGACCTAATGACAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1441172 - 1315
Exon 9 To Exon 10 (Pair 11)
Forward (1272,23)CCATTGTTCTTGCTCTAAGGTTAAmplicon SizecDNA: 145 bpgenomic: 1,321
Reverse (1416,23)ATGATTGTCATTAGGTCGCTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.04 kcal/mol
Reverse Dimers-0.432 kcal/mol
Forward-Reverse Dimers-0.797 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTACA
AGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTGA
TTATCAGCGACCTAATGACAATCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1451173 - 1317
Exon 9 To Exon 10 (Pair 12)
Forward (1271,23)TCCATTGTTCTTGCTCTAAGGTTAmplicon SizecDNA: 146 bpgenomic: 1,322
Reverse (1416,23)ATGATTGTCATTAGGTCGCTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.04 kcal/mol
Reverse Dimers-0.432 kcal/mol
Forward-Reverse Dimers-0.797 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceTCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTAC
AAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTG
ATTATCAGCGACCTAATGACAATCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1461172 - 1317
Exon 9 To Exon 10 (Pair 13)
Forward (1270,23)ATCCATTGTTCTTGCTCTAAGGTAmplicon SizecDNA: 151 bpgenomic: 1,327
Reverse (1420,22)GCCAATGATTGTCATTAGGTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.184 kcal/mol
Reverse Dimers-1.288 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceATCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTA
CAAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGT
GATTATCAGCGACCTAATGACAATCATTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1511171 - 1321
Exon 9 To Exon 10 (Pair 14)
Forward (1272,23)CCATTGTTCTTGCTCTAAGGTTAAmplicon SizecDNA: 143 bpgenomic: 1,319
Reverse (1414,23)GATTGTCATTAGGTCGCTGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.59 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.542 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTACA
AGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTGA
TTATCAGCGACCTAATGACAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1431173 - 1315
Exon 9 To Exon 10 (Pair 15)
Forward (1271,23)TCCATTGTTCTTGCTCTAAGGTTAmplicon SizecDNA: 149 bpgenomic: 1,325
Reverse (1419,22)CCAATGATTGTCATTAGGTCGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.184 kcal/mol
Reverse Dimers-1.288 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceTCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTAC
AAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTG
ATTATCAGCGACCTAATGACAATCATTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1491172 - 1320
Exon 9 To Exon 10 (Pair 16)
Forward (1270,23)ATCCATTGTTCTTGCTCTAAGGTAmplicon SizecDNA: 150 bpgenomic: 1,326
Reverse (1419,22)CCAATGATTGTCATTAGGTCGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops0.184 kcal/mol
Reverse Dimers-1.288 kcal/mol
Forward-Reverse Dimers-1.751 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceATCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTA
CAAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGT
GATTATCAGCGACCTAATGACAATCATTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1501171 - 1320
Exon 9 To Exon 10 (Pair 17)
Forward (1268,23)AGATCCATTGTTCTTGCTCTAAGAmplicon SizecDNA: 148 bpgenomic: 1,324
Reverse (1415,23)TGATTGTCATTAGGTCGCTGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.674 kcal/mol in 3' area
Forward Dimers-0.2 kcal/mol
Reverse Loops1.59 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.635 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceAGATCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAG
TACAAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTG
GTGATTATCAGCGACCTAATGACAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1481169 - 1316
Exon 9 To Exon 10 (Pair 18)
Forward (1268,23)AGATCCATTGTTCTTGCTCTAAGAmplicon SizecDNA: 147 bpgenomic: 1,323
Reverse (1414,23)GATTGTCATTAGGTCGCTGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.674 kcal/mol in 3' area
Forward Dimers-0.2 kcal/mol
Reverse Loops1.59 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.635 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceAGATCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAG
TACAAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTG
GTGATTATCAGCGACCTAATGACAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1471169 - 1315
Exon 9 To Exon 10 (Pair 19)
Forward (1268,23)AGATCCATTGTTCTTGCTCTAAGAmplicon SizecDNA: 150 bpgenomic: 1,326
Reverse (1417,23)AATGATTGTCATTAGGTCGCTGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.674 kcal/mol in 3' area
Forward Dimers-0.2 kcal/mol
Reverse Loops0.499 kcal/mol
Reverse Dimers-0.973 kcal/mol
Forward-Reverse Dimers-1.338 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceAGATCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAG
TACAAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTG
GTGATTATCAGCGACCTAATGACAATCATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1501169 - 1318
Exon 9 To Exon 10 (Pair 20)
Forward (1270,23)ATCCATTGTTCTTGCTCTAAGGTAmplicon SizecDNA: 145 bpgenomic: 1,321
Reverse (1414,23)GATTGTCATTAGGTCGCTGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.59 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.542 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceATCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTA
CAAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGT
GATTATCAGCGACCTAATGACAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1451171 - 1315
Exon 9 To Exon 10 (Pair 21)
Forward (1271,23)TCCATTGTTCTTGCTCTAAGGTTAmplicon SizecDNA: 145 bpgenomic: 1,321
Reverse (1415,23)TGATTGTCATTAGGTCGCTGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.59 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.542 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceTCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTAC
AAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGTG
ATTATCAGCGACCTAATGACAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1451172 - 1316
Exon 9 To Exon 10 (Pair 22)
Forward (1266,23)CAAGATCCATTGTTCTTGCTCTAAmplicon SizecDNA: 149 bpgenomic: 1,325
Reverse (1414,23)GATTGTCATTAGGTCGCTGATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.328 kcal/mol
Forward Dimers-0.86 kcal/mol
Reverse Loops1.59 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.895 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceCAAGATCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGA
AGTACAAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCC
TGGTGATTATCAGCGACCTAATGACAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1491167 - 1315
Exon 9 To Exon 10 (Pair 23)
Forward (1270,23)ATCCATTGTTCTTGCTCTAAGGTAmplicon SizecDNA: 146 bpgenomic: 1,322
Reverse (1415,23)TGATTGTCATTAGGTCGCTGATANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.497 kcal/mol in 3' area
Forward Dimers0.006 kcal/mol
Reverse Loops1.59 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.542 kcal/mol
Amplicon Folding-1.26 kcal/mol outside primersite
Amplicon SequenceATCCATTGTTCTTGCTCTAAGGTTACGGAAGAGATTTCTAAATTTCTTCCTGGAGAAGTA
CAAGCGGCCTGTGTGTGACACCGACCAGTGGGAGTTCATCAACGGCTGGTATGTCCTGGT
GATTATCAGCGACCTAATGACAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1461171 - 1316
Exon 10 To Exon 11 (Pair 1)
Forward (1408,24)GACAATCATTGGCTCCATATTAAAAmplicon SizecDNA: 136 bpgenomic: 1,606
Reverse (1543,22)CTGGAAATAACCCAGGTATCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.361 kcal/mol
Forward Dimers-0.943 kcal/mol
Reverse Loops1.024 kcal/mol
Reverse Dimers-1.612 kcal/mol
Forward-Reverse Dimers-1.358 kcal/mol
Amplicon Folding0.025 kcal/mol inside primersite
Amplicon SequenceGACAATCATTGGCTCCATATTAAAAATGGAAATCAAAGCAAAGAATCTCACAAACTATGA
TCTCTGCAGCATTTTTCTTGGAACCTCTACGCTCTTGGTTTGGGTTGGAGTCATCAGATA
CCTGGGTTATTTCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1361309 - 1444
Exon 10 To Exon 11 (Pair 2)
Forward (1407,24)TGACAATCATTGGCTCCATATTAAAmplicon SizecDNA: 137 bpgenomic: 1,607
Reverse (1543,22)CTGGAAATAACCCAGGTATCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.361 kcal/mol
Forward Dimers-0.943 kcal/mol
Reverse Loops1.024 kcal/mol
Reverse Dimers-1.612 kcal/mol
Forward-Reverse Dimers-1.358 kcal/mol
Amplicon Folding0.025 kcal/mol inside primersite
Amplicon SequenceTGACAATCATTGGCTCCATATTAAAAATGGAAATCAAAGCAAAGAATCTCACAAACTATG
ATCTCTGCAGCATTTTTCTTGGAACCTCTACGCTCTTGGTTTGGGTTGGAGTCATCAGAT
ACCTGGGTTATTTCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1371308 - 1444
Exon 10 To Exon 11 (Pair 3)
Forward (1373,21)GGCTGGTATGTCCTGGTGATTAmplicon SizecDNA: 102 bpgenomic: 1,572
Reverse (1474,23)GCAGAGATCATAGTTTGTGAGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-0.226 kcal/mol
Reverse Loops1.443 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.268 kcal/mol
Amplicon Folding0.467 kcal/mol outside primersite
Amplicon SequenceGGCTGGTATGTCCTGGTGATTATCAGCGACCTAATGACAATCATTGGCTCCATATTAAAA
ATGGAAATCAAAGCAAAGAATCTCACAAACTATGATCTCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1021274 - 1375
Exon 10 To Exon 11 (Pair 4)
Forward (1373,21)GGCTGGTATGTCCTGGTGATTAmplicon SizecDNA: 103 bpgenomic: 1,573
Reverse (1475,23)TGCAGAGATCATAGTTTGTGAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-0.226 kcal/mol
Reverse Loops1.443 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.268 kcal/mol
Amplicon Folding0.467 kcal/mol outside primersite
Amplicon SequenceGGCTGGTATGTCCTGGTGATTATCAGCGACCTAATGACAATCATTGGCTCCATATTAAAA
ATGGAAATCAAAGCAAAGAATCTCACAAACTATGATCTCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1031274 - 1376
Exon 10 To Exon 11 (Pair 5)
Forward (1374,22)GCTGGTATGTCCTGGTGATTATAmplicon SizecDNA: 102 bpgenomic: 1,572
Reverse (1475,23)TGCAGAGATCATAGTTTGTGAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-0.226 kcal/mol
Reverse Loops1.443 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.268 kcal/mol
Amplicon Folding0.467 kcal/mol outside primersite
Amplicon SequenceGCTGGTATGTCCTGGTGATTATCAGCGACCTAATGACAATCATTGGCTCCATATTAAAAA
TGGAAATCAAAGCAAAGAATCTCACAAACTATGATCTCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1021275 - 1376
Exon 10 To Exon 11 (Pair 6)
Forward (1374,22)GCTGGTATGTCCTGGTGATTATAmplicon SizecDNA: 101 bpgenomic: 1,571
Reverse (1474,23)GCAGAGATCATAGTTTGTGAGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.269 kcal/mol
Forward Dimers-0.226 kcal/mol
Reverse Loops1.443 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.268 kcal/mol
Amplicon Folding0.467 kcal/mol outside primersite
Amplicon SequenceGCTGGTATGTCCTGGTGATTATCAGCGACCTAATGACAATCATTGGCTCCATATTAAAAA
TGGAAATCAAAGCAAAGAATCTCACAAACTATGATCTCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1011275 - 1375
Exon 10 To Exon 11 (Pair 7)
Forward (1406,24)ATGACAATCATTGGCTCCATATTAAmplicon SizecDNA: 138 bpgenomic: 1,608
Reverse (1543,22)CTGGAAATAACCCAGGTATCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.04 kcal/mol
Forward Dimers-0.943 kcal/mol
Reverse Loops1.024 kcal/mol
Reverse Dimers-1.612 kcal/mol
Forward-Reverse Dimers-1.358 kcal/mol
Amplicon Folding0.025 kcal/mol inside primersite
Amplicon SequenceATGACAATCATTGGCTCCATATTAAAAATGGAAATCAAAGCAAAGAATCTCACAAACTAT
GATCTCTGCAGCATTTTTCTTGGAACCTCTACGCTCTTGGTTTGGGTTGGAGTCATCAGA
TACCTGGGTTATTTCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1381307 - 1444
Exon 12 To Exon 13 (Pair 1)
Forward (1639,21)CTGTGGCTGGATTGTCTTAGGAmplicon SizecDNA: 131 bpgenomic: 6,317
Reverse (1769,21)TGCTCTTCTGCTGGATTTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.253 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.665 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.631 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceCTGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTTGAAAATCTGAACACAGTTGC
TGAGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTTGCAACCTTTGCCCAAATCCA
GCAGAAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1311540 - 1670
Exon 12 To Exon 13 (Pair 2)
Forward (1629,22)GTTACACATTCTGTGGCTGGATAmplicon SizecDNA: 141 bpgenomic: 6,327
Reverse (1769,21)TGCTCTTCTGCTGGATTTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-0.912 kcal/mol
Reverse Loops1.665 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.542 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceGTTACACATTCTGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTTGAAAATCTGA
ACACAGTTGCTGAGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTTGCAACCTTTG
CCCAAATCCAGCAGAAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1411530 - 1670
Exon 12 To Exon 13 (Pair 3)
Forward (1639,21)CTGTGGCTGGATTGTCTTAGGAmplicon SizecDNA: 122 bpgenomic: 6,308
Reverse (1760,21)GCTGGATTTGGGCAAAGGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.253 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.691 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-0.788 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceCTGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTTGAAAATCTGAACACAGTTGC
TGAGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTTGCAACCTTTGCCCAAATCCA
GC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1221540 - 1661
Exon 12 To Exon 13 (Pair 4)
Forward (1635,22)CATTCTGTGGCTGGATTGTCTTAmplicon SizecDNA: 135 bpgenomic: 6,321
Reverse (1769,21)TGCTCTTCTGCTGGATTTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.221 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.665 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.631 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceCATTCTGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTTGAAAATCTGAACACAG
TTGCTGAGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTTGCAACCTTTGCCCAAA
TCCAGCAGAAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1351536 - 1670
Exon 12 To Exon 13 (Pair 5)
Forward (1641,21)GTGGCTGGATTGTCTTAGGACAmplicon SizecDNA: 122 bpgenomic: 6,308
Reverse (1762,21)CTGCTGGATTTGGGCAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.335 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.29 kcal/mol
Reverse Dimers-0.608 kcal/mol
Forward-Reverse Dimers-0.788 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTTGAAAATCTGAACACAGTTGCTG
AGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTTGCAACCTTTGCCCAAATCCAGC
AG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1221542 - 1663
Exon 12 To Exon 13 (Pair 6)
Forward (1619,24)ATTTATCTGGGTTACACATTCTGTAmplicon SizecDNA: 151 bpgenomic: 6,337
Reverse (1769,21)TGCTCTTCTGCTGGATTTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.264 kcal/mol in 3' area
Forward Dimers-0.594 kcal/mol
Reverse Loops1.665 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.542 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceATTTATCTGGGTTACACATTCTGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTT
GAAAATCTGAACACAGTTGCTGAGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTT
GCAACCTTTGCCCAAATCCAGCAGAAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1511520 - 1670
Exon 12 To Exon 13 (Pair 7)
Forward (1637,22)TTCTGTGGCTGGATTGTCTTAGAmplicon SizecDNA: 133 bpgenomic: 6,319
Reverse (1769,21)TGCTCTTCTGCTGGATTTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.253 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.665 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.631 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceTTCTGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTTGAAAATCTGAACACAGTT
GCTGAGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTTGCAACCTTTGCCCAAATC
CAGCAGAAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1331538 - 1670
Exon 12 To Exon 13 (Pair 8)
Forward (1628,21)GGTTACACATTCTGTGGCTGGAmplicon SizecDNA: 142 bpgenomic: 6,328
Reverse (1769,21)TGCTCTTCTGCTGGATTTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-0.912 kcal/mol
Reverse Loops1.665 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.542 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceGGTTACACATTCTGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTTGAAAATCTG
AACACAGTTGCTGAGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTTGCAACCTTT
GCCCAAATCCAGCAGAAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1421529 - 1670
Exon 12 To Exon 13 (Pair 9)
Forward (1613,23)GGTATGATTTATCTGGGTTACACAmplicon SizecDNA: 150 bpgenomic: 6,336
Reverse (1762,21)CTGCTGGATTTGGGCAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.748 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.29 kcal/mol
Reverse Dimers-0.608 kcal/mol
Forward-Reverse Dimers-0.631 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceGGTATGATTTATCTGGGTTACACATTCTGTGGCTGGATTGTCTTAGGACCATACCATGAC
AAGTTTGAAAATCTGAACACAGTTGCTGAGTGTCTGTTTTCTCTGGTCAACGGTGATGAC
ATGTTTGCAACCTTTGCCCAAATCCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1501514 - 1663
Exon 12 To Exon 13 (Pair 10)
Forward (1611,23)CTGGTATGATTTATCTGGGTTACAmplicon SizecDNA: 150 bpgenomic: 6,336
Reverse (1760,21)GCTGGATTTGGGCAAAGGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.691 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-0.631 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceCTGGTATGATTTATCTGGGTTACACATTCTGTGGCTGGATTGTCTTAGGACCATACCATG
ACAAGTTTGAAAATCTGAACACAGTTGCTGAGTGTCTGTTTTCTCTGGTCAACGGTGATG
ACATGTTTGCAACCTTTGCCCAAATCCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1501512 - 1661
Exon 12 To Exon 13 (Pair 11)
Forward (1634,22)ACATTCTGTGGCTGGATTGTCTAmplicon SizecDNA: 136 bpgenomic: 6,322
Reverse (1769,21)TGCTCTTCTGCTGGATTTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.38 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.665 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.631 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceACATTCTGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTTGAAAATCTGAACACA
GTTGCTGAGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTTGCAACCTTTGCCCAA
ATCCAGCAGAAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1361535 - 1670
Exon 12 To Exon 13 (Pair 12)
Forward (1641,21)GTGGCTGGATTGTCTTAGGACAmplicon SizecDNA: 120 bpgenomic: 6,306
Reverse (1760,21)GCTGGATTTGGGCAAAGGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.335 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.691 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-0.788 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTTGAAAATCTGAACACAGTTGCTG
AGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTTGCAACCTTTGCCCAAATCCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1201542 - 1661
Exon 12 To Exon 13 (Pair 13)
Forward (1613,23)GGTATGATTTATCTGGGTTACACAmplicon SizecDNA: 148 bpgenomic: 6,334
Reverse (1760,21)GCTGGATTTGGGCAAAGGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.748 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.691 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-0.631 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceGGTATGATTTATCTGGGTTACACATTCTGTGGCTGGATTGTCTTAGGACCATACCATGAC
AAGTTTGAAAATCTGAACACAGTTGCTGAGTGTCTGTTTTCTCTGGTCAACGGTGATGAC
ATGTTTGCAACCTTTGCCCAAATCCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1481514 - 1661
Exon 12 To Exon 13 (Pair 14)
Forward (1639,21)CTGTGGCTGGATTGTCTTAGGAmplicon SizecDNA: 124 bpgenomic: 6,310
Reverse (1762,21)CTGCTGGATTTGGGCAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.253 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.29 kcal/mol
Reverse Dimers-0.608 kcal/mol
Forward-Reverse Dimers-0.788 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceCTGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTTGAAAATCTGAACACAGTTGC
TGAGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTTGCAACCTTTGCCCAAATCCA
GCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1241540 - 1663
Exon 12 To Exon 13 (Pair 15)
Forward (1641,21)GTGGCTGGATTGTCTTAGGACAmplicon SizecDNA: 129 bpgenomic: 6,315
Reverse (1769,21)TGCTCTTCTGCTGGATTTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.335 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.665 kcal/mol
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-0.631 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceGTGGCTGGATTGTCTTAGGACCATACCATGACAAGTTTGAAAATCTGAACACAGTTGCTG
AGTGTCTGTTTTCTCTGGTCAACGGTGATGACATGTTTGCAACCTTTGCCCAAATCCAGC
AGAAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1291542 - 1670
Exon 12 To Exon 13 (Pair 16)
Forward (1610,23)GCTGGTATGATTTATCTGGGTTAAmplicon SizecDNA: 151 bpgenomic: 6,337
Reverse (1760,21)GCTGGATTTGGGCAAAGGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.963 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.691 kcal/mol in 3' area
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-0.631 kcal/mol
Amplicon Folding-0.053 kcal/mol outside primersite
Amplicon SequenceGCTGGTATGATTTATCTGGGTTACACATTCTGTGGCTGGATTGTCTTAGGACCATACCAT
GACAAGTTTGAAAATCTGAACACAGTTGCTGAGTGTCTGTTTTCTCTGGTCAACGGTGAT
GACATGTTTGCAACCTTTGCCCAAATCCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1511511 - 1661
Exon 13 To Exon 14 (Pair 1)
Forward (1768,21)CATCTTGGTGTGGCTGTTCAGAmplicon SizecDNA: 145 bpgenomic: 1,827
Reverse (1912,22)CGTTTCAGGAAACCCATTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.962 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.194 kcal/mol
Reverse Dimers-0.845 kcal/mol
Forward-Reverse Dimers-1.566 kcal/mol
Amplicon Folding0.259 kcal/mol inside primersite
Amplicon SequenceCATCTTGGTGTGGCTGTTCAGTCGTCTGTATTTATATTCCTTCATCAGCCTTTTTATATA
TATGATTCTCAGTCTTTTTATTGCACTTATTACAGATTCTTATGACACCATTAAGAAATT
CCAACAGAATGGGTTTCCTGAAACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1451669 - 1813
Exon 13 To Exon 14 (Pair 2)
Forward (1768,21)CATCTTGGTGTGGCTGTTCAGAmplicon SizecDNA: 147 bpgenomic: 1,829
Reverse (1914,22)TCCGTTTCAGGAAACCCATTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.962 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.145 kcal/mol
Reverse Dimers-0.845 kcal/mol
Forward-Reverse Dimers-1.566 kcal/mol
Amplicon Folding0.259 kcal/mol inside primersite
Amplicon SequenceCATCTTGGTGTGGCTGTTCAGTCGTCTGTATTTATATTCCTTCATCAGCCTTTTTATATA
TATGATTCTCAGTCTTTTTATTGCACTTATTACAGATTCTTATGACACCATTAAGAAATT
CCAACAGAATGGGTTTCCTGAAACGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1471669 - 1815
Exon 13 To Exon 14 (Pair 3)
Forward (1767,21)GCATCTTGGTGTGGCTGTTCAAmplicon SizecDNA: 146 bpgenomic: 1,828
Reverse (1912,22)CGTTTCAGGAAACCCATTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.194 kcal/mol
Reverse Dimers-0.845 kcal/mol
Forward-Reverse Dimers-1.566 kcal/mol
Amplicon Folding0.259 kcal/mol inside primersite
Amplicon SequenceGCATCTTGGTGTGGCTGTTCAGTCGTCTGTATTTATATTCCTTCATCAGCCTTTTTATAT
ATATGATTCTCAGTCTTTTTATTGCACTTATTACAGATTCTTATGACACCATTAAGAAAT
TCCAACAGAATGGGTTTCCTGAAACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1461668 - 1813
Exon 13 To Exon 14 (Pair 4)
Forward (1768,21)CATCTTGGTGTGGCTGTTCAGAmplicon SizecDNA: 142 bpgenomic: 1,824
Reverse (1909,22)TTCAGGAAACCCATTCTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.962 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.59 kcal/mol
Forward-Reverse Dimers-1.566 kcal/mol
Amplicon Folding0.259 kcal/mol inside primersite
Amplicon SequenceCATCTTGGTGTGGCTGTTCAGTCGTCTGTATTTATATTCCTTCATCAGCCTTTTTATATA
TATGATTCTCAGTCTTTTTATTGCACTTATTACAGATTCTTATGACACCATTAAGAAATT
CCAACAGAATGGGTTTCCTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1421669 - 1810
Exon 13 To Exon 14 (Pair 5)
Forward (1767,21)GCATCTTGGTGTGGCTGTTCAAmplicon SizecDNA: 148 bpgenomic: 1,830
Reverse (1914,22)TCCGTTTCAGGAAACCCATTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.145 kcal/mol
Reverse Dimers-0.845 kcal/mol
Forward-Reverse Dimers-1.566 kcal/mol
Amplicon Folding0.259 kcal/mol inside primersite
Amplicon SequenceGCATCTTGGTGTGGCTGTTCAGTCGTCTGTATTTATATTCCTTCATCAGCCTTTTTATAT
ATATGATTCTCAGTCTTTTTATTGCACTTATTACAGATTCTTATGACACCATTAAGAAAT
TCCAACAGAATGGGTTTCCTGAAACGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1481668 - 1815
Exon 13 To Exon 14 (Pair 6)
Forward (1768,21)CATCTTGGTGTGGCTGTTCAGAmplicon SizecDNA: 148 bpgenomic: 1,830
Reverse (1915,22)ATCCGTTTCAGGAAACCCATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.962 kcal/mol
Forward Dimers-0.004 kcal/mol
Reverse Loops1.036 kcal/mol
Reverse Dimers-0.845 kcal/mol
Forward-Reverse Dimers-1.566 kcal/mol
Amplicon Folding0.259 kcal/mol inside primersite
Amplicon SequenceCATCTTGGTGTGGCTGTTCAGTCGTCTGTATTTATATTCCTTCATCAGCCTTTTTATATA
TATGATTCTCAGTCTTTTTATTGCACTTATTACAGATTCTTATGACACCATTAAGAAATT
CCAACAGAATGGGTTTCCTGAAACGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_153259 (MCOLN2)1481669 - 1816
 

See below for some more details.

Program Output:

Loading ...