Design Results for MOXD1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 8 To Exon 11 (Pair 1)
Forward (1372,24)CAGTATCTAAAGGAAGAACAAACAAmplicon SizecDNA: 299 bpgenomic: 24,819
Reverse (1670,24)ATAGCATCCATGAAAGAAAGGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers-0.521 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.223 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceCAGTATCTAAAGGAAGAACAAACAATCTTACCAGGAGATAACCTAATTACTGAGTGTCGC
TACAACACGAAAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATG
TGTCTCTCATACCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCA
GACATTATGGAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACC
TGGCCTTTCATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2991372 - 1670
Exon 8 To Exon 11 (Pair 2)
Forward (1372,24)CAGTATCTAAAGGAAGAACAAACAAmplicon SizecDNA: 300 bpgenomic: 24,820
Reverse (1671,23)CATAGCATCCATGAAAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers-0.521 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.223 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceCAGTATCTAAAGGAAGAACAAACAATCTTACCAGGAGATAACCTAATTACTGAGTGTCGC
TACAACACGAAAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATG
TGTCTCTCATACCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCA
GACATTATGGAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACC
TGGCCTTTCATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)3001372 - 1671
Exon 8 To Exon 11 (Pair 3)
Forward (1372,24)CAGTATCTAAAGGAAGAACAAACAAmplicon SizecDNA: 301 bpgenomic: 24,821
Reverse (1672,23)TCATAGCATCCATGAAAGAAAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers-0.521 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.223 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceCAGTATCTAAAGGAAGAACAAACAATCTTACCAGGAGATAACCTAATTACTGAGTGTCGC
TACAACACGAAAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATG
TGTCTCTCATACCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCA
GACATTATGGAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACC
TGGCCTTTCATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTATG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)3011372 - 1672
Exon 8 To Exon 11 (Pair 4)
Forward (1371,24)TCAGTATCTAAAGGAAGAACAAACAmplicon SizecDNA: 300 bpgenomic: 24,820
Reverse (1670,24)ATAGCATCCATGAAAGAAAGGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers-0.521 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.223 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceTCAGTATCTAAAGGAAGAACAAACAATCTTACCAGGAGATAACCTAATTACTGAGTGTCG
CTACAACACGAAAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAAT
GTGTCTCTCATACCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCC
AGACATTATGGAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGAC
CTGGCCTTTCATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)3001371 - 1670
Exon 8 To Exon 11 (Pair 5)
Forward (1371,24)TCAGTATCTAAAGGAAGAACAAACAmplicon SizecDNA: 301 bpgenomic: 24,821
Reverse (1671,23)CATAGCATCCATGAAAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.791 kcal/mol
Forward Dimers-0.521 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.223 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceTCAGTATCTAAAGGAAGAACAAACAATCTTACCAGGAGATAACCTAATTACTGAGTGTCG
CTACAACACGAAAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAAT
GTGTCTCTCATACCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCC
AGACATTATGGAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGAC
CTGGCCTTTCATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTAT
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)3011371 - 1671
Exon 9 To Exon 11 (Pair 1)
Forward (1443,22)AGATAGAGCTGAGATGACTTGGAmplicon SizecDNA: 229 bpgenomic: 22,759
Reverse (1671,23)CATAGCATCCATGAAAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.2 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATGTGTCTCTCATA
CCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCAGACATTATGGA
ACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACCTGGCCTTTCAT
TATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2291443 - 1671
Exon 9 To Exon 11 (Pair 2)
Forward (1443,22)AGATAGAGCTGAGATGACTTGGAmplicon SizecDNA: 230 bpgenomic: 22,760
Reverse (1672,23)TCATAGCATCCATGAAAGAAAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.2 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATGTGTCTCTCATA
CCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCAGACATTATGGA
ACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACCTGGCCTTTCAT
TATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2301443 - 1672
Exon 9 To Exon 11 (Pair 3)
Forward (1443,22)AGATAGAGCTGAGATGACTTGGAmplicon SizecDNA: 232 bpgenomic: 22,762
Reverse (1674,24)ATTCATAGCATCCATGAAAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.2 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATGTGTCTCTCATA
CCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCAGACATTATGGA
ACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACCTGGCCTTTCAT
TATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTATGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2321443 - 1674
Exon 9 To Exon 11 (Pair 4)
Forward (1441,23)AAAGATAGAGCTGAGATGACTTGAmplicon SizecDNA: 231 bpgenomic: 22,761
Reverse (1671,23)CATAGCATCCATGAAAGAAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.2 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceAAAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATGTGTCTCTCA
TACCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCAGACATTATG
GAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACCTGGCCTTTC
ATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2311441 - 1671
Exon 9 To Exon 11 (Pair 5)
Forward (1443,22)AGATAGAGCTGAGATGACTTGGAmplicon SizecDNA: 235 bpgenomic: 22,765
Reverse (1677,24)CTTATTCATAGCATCCATGAAAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.2 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATGTGTCTCTCATA
CCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCAGACATTATGGA
ACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACCTGGCCTTTCAT
TATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTATGAATAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2351443 - 1677
Exon 9 To Exon 11 (Pair 6)
Forward (1443,22)AGATAGAGCTGAGATGACTTGGAmplicon SizecDNA: 228 bpgenomic: 22,758
Reverse (1670,24)ATAGCATCCATGAAAGAAAGGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.2 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATGTGTCTCTCATA
CCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCAGACATTATGGA
ACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACCTGGCCTTTCAT
TATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2281443 - 1670
Exon 9 To Exon 11 (Pair 7)
Forward (1441,23)AAAGATAGAGCTGAGATGACTTGAmplicon SizecDNA: 237 bpgenomic: 22,767
Reverse (1677,24)CTTATTCATAGCATCCATGAAAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.2 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceAAAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATGTGTCTCTCA
TACCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCAGACATTATG
GAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACCTGGCCTTTC
ATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTATGAATAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2371441 - 1677
Exon 9 To Exon 11 (Pair 8)
Forward (1441,23)AAAGATAGAGCTGAGATGACTTGAmplicon SizecDNA: 230 bpgenomic: 22,760
Reverse (1670,24)ATAGCATCCATGAAAGAAAGGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.2 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceAAAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATGTGTCTCTCA
TACCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCAGACATTATG
GAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACCTGGCCTTTC
ATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2301441 - 1670
Exon 9 To Exon 11 (Pair 9)
Forward (1441,23)AAAGATAGAGCTGAGATGACTTGAmplicon SizecDNA: 234 bpgenomic: 22,764
Reverse (1674,24)ATTCATAGCATCCATGAAAGAAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.2 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceAAAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATGTGTCTCTCA
TACCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCAGACATTATG
GAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACCTGGCCTTTC
ATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTATGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2341441 - 1674
Exon 9 To Exon 11 (Pair 10)
Forward (1441,23)AAAGATAGAGCTGAGATGACTTGAmplicon SizecDNA: 232 bpgenomic: 22,762
Reverse (1672,23)TCATAGCATCCATGAAAGAAAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.2 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.224 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-0.086 kcal/mol outside primersite
Amplicon SequenceAAAGATAGAGCTGAGATGACTTGGGGAGGACTAAGCACCAGGAGTGAAATGTGTCTCTCA
TACCTTCTTTATTACCCAAGAATTAATCTTACTCGATGTGCAAGTATTCCAGACATTATG
GAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACAGACCAGTCACGACCTGGCCTTTC
ATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTTTCATGGATGCTATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2321441 - 1672
Exon 10 To Exon 11 (Pair 1)
Forward (1538,23)GTGCAAGTATTCCAGACATTATGAmplicon SizecDNA: 225 bpgenomic: 17,904
Reverse (1762,22)TGTCTGTCTTGGAACATCTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.114 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers-0.483 kcal/mol
Forward-Reverse Dimers-2.405 kcal/mol
Amplicon Folding-1.726 kcal/mol outside primersite
Amplicon SequenceGTGCAAGTATTCCAGACATTATGGAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACA
GACCAGTCACGACCTGGCCTTTCATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTT
TCATGGATGCTATGAATAAGTTTAAATGGACTAAAAAGGAAGGTCTCTCCTTCAACAAGC
TGGTCCTCAGCCTGCCAGTGAATGTGAGATGTTCCAAGACAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2251538 - 1762
Exon 10 To Exon 11 (Pair 2)
Forward (1538,23)GTGCAAGTATTCCAGACATTATGAmplicon SizecDNA: 223 bpgenomic: 17,902
Reverse (1760,23)TCTGTCTTGGAACATCTCACATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.114 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers-0.483 kcal/mol
Forward-Reverse Dimers-2.37 kcal/mol
Amplicon Folding-1.726 kcal/mol outside primersite
Amplicon SequenceGTGCAAGTATTCCAGACATTATGGAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACA
GACCAGTCACGACCTGGCCTTTCATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTT
TCATGGATGCTATGAATAAGTTTAAATGGACTAAAAAGGAAGGTCTCTCCTTCAACAAGC
TGGTCCTCAGCCTGCCAGTGAATGTGAGATGTTCCAAGACAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2231538 - 1760
Exon 10 To Exon 11 (Pair 3)
Forward (1538,23)GTGCAAGTATTCCAGACATTATGAmplicon SizecDNA: 221 bpgenomic: 17,900
Reverse (1758,23)TGTCTTGGAACATCTCACATTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.114 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers-0.483 kcal/mol
Forward-Reverse Dimers-2.37 kcal/mol
Amplicon Folding-1.726 kcal/mol outside primersite
Amplicon SequenceGTGCAAGTATTCCAGACATTATGGAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACA
GACCAGTCACGACCTGGCCTTTCATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTT
TCATGGATGCTATGAATAAGTTTAAATGGACTAAAAAGGAAGGTCTCTCCTTCAACAAGC
TGGTCCTCAGCCTGCCAGTGAATGTGAGATGTTCCAAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2211538 - 1758
Exon 10 To Exon 11 (Pair 4)
Forward (1538,23)GTGCAAGTATTCCAGACATTATGAmplicon SizecDNA: 227 bpgenomic: 17,906
Reverse (1764,23)ATTGTCTGTCTTGGAACATCTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.114 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers-0.554 kcal/mol
Forward-Reverse Dimers-2.476 kcal/mol
Amplicon Folding-1.726 kcal/mol outside primersite
Amplicon SequenceGTGCAAGTATTCCAGACATTATGGAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACA
GACCAGTCACGACCTGGCCTTTCATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTT
TCATGGATGCTATGAATAAGTTTAAATGGACTAAAAAGGAAGGTCTCTCCTTCAACAAGC
TGGTCCTCAGCCTGCCAGTGAATGTGAGATGTTCCAAGACAGACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2271538 - 1764
Exon 10 To Exon 11 (Pair 5)
Forward (1538,23)GTGCAAGTATTCCAGACATTATGAmplicon SizecDNA: 224 bpgenomic: 17,903
Reverse (1761,22)GTCTGTCTTGGAACATCTCACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.114 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers-0.483 kcal/mol
Forward-Reverse Dimers-2.37 kcal/mol
Amplicon Folding-1.726 kcal/mol outside primersite
Amplicon SequenceGTGCAAGTATTCCAGACATTATGGAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACA
GACCAGTCACGACCTGGCCTTTCATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTT
TCATGGATGCTATGAATAAGTTTAAATGGACTAAAAAGGAAGGTCTCTCCTTCAACAAGC
TGGTCCTCAGCCTGCCAGTGAATGTGAGATGTTCCAAGACAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2241538 - 1761
Exon 10 To Exon 11 (Pair 6)
Forward (1538,23)GTGCAAGTATTCCAGACATTATGAmplicon SizecDNA: 219 bpgenomic: 17,898
Reverse (1756,23)TCTTGGAACATCTCACATTCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.114 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.939 kcal/mol
Amplicon Folding-1.726 kcal/mol outside primersite
Amplicon SequenceGTGCAAGTATTCCAGACATTATGGAACAACTTCAGTTCATTGGGGTTAAGGAGATCTACA
GACCAGTCACGACCTGGCCTTTCATTATCAAAAGTCCCAAGCAATATAAAAACCTTTCTT
TCATGGATGCTATGAATAAGTTTAAATGGACTAAAAAGGAAGGTCTCTCCTTCAACAAGC
TGGTCCTCAGCCTGCCAGTGAATGTGAGATGTTCCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015529 (MOXD1)2191538 - 1756
 

See below for some more details.

Program Output:

Loading ...