Design Results for Myoc

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size200
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (729,20)TCAGGAGTGGAGAGGGAGACAmplicon SizecDNA: 105 bpgenomic: 1,992
Reverse (833,21)TCCACACACCATACTTGCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.076 kcal/mol
Forward Dimers0.273 kcal/mol in 3' area
Reverse Loops2.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol
Forward-Reverse Dimers-2.879 kcal/mol
Amplicon Folding-0.612 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGGAGAGGGAGACACCGGATGTGGAGAACTAGTTTGGGTAGGAGAGCCTCTCA
CGCTGAGAACAGCAGAAACAATTACTGGCAAGTATGGTGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000261 (MYOC)105729 - 833
Exon 2 To Exon 3 (Pair 2)
Forward (729,20)TCAGGAGTGGAGAGGGAGACAmplicon SizecDNA: 99 bpgenomic: 1,986
Reverse (827,23)CACCATACTTGCCAGTAATTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.076 kcal/mol
Forward Dimers0.273 kcal/mol in 3' area
Reverse Loops1.126 kcal/mol
Reverse Dimers-0.954 kcal/mol
Forward-Reverse Dimers-1.596 kcal/mol
Amplicon Folding-0.612 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGGAGAGGGAGACACCGGATGTGGAGAACTAGTTTGGGTAGGAGAGCCTCTCA
CGCTGAGAACAGCAGAAACAATTACTGGCAAGTATGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000261 (MYOC)99729 - 827
Exon 2 To Exon 3 (Pair 3)
Forward (727,20)TCTCAGGAGTGGAGAGGGAGAmplicon SizecDNA: 101 bpgenomic: 1,988
Reverse (827,23)CACCATACTTGCCAGTAATTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.26 kcal/mol
Forward Dimers-0.778 kcal/mol
Reverse Loops1.126 kcal/mol
Reverse Dimers-0.954 kcal/mol
Forward-Reverse Dimers-1.596 kcal/mol
Amplicon Folding-0.612 kcal/mol outside primersite
Amplicon SequenceTCTCAGGAGTGGAGAGGGAGACACCGGATGTGGAGAACTAGTTTGGGTAGGAGAGCCTCT
CACGCTGAGAACAGCAGAAACAATTACTGGCAAGTATGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000261 (MYOC)101727 - 827
Exon 2 To Exon 3 (Pair 4)
Forward (729,20)TCAGGAGTGGAGAGGGAGACAmplicon SizecDNA: 97 bpgenomic: 1,984
Reverse (825,23)CCATACTTGCCAGTAATTGTTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.076 kcal/mol
Forward Dimers0.273 kcal/mol in 3' area
Reverse Loops1.126 kcal/mol
Reverse Dimers-0.954 kcal/mol
Forward-Reverse Dimers-1.456 kcal/mol
Amplicon Folding-0.612 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGGAGAGGGAGACACCGGATGTGGAGAACTAGTTTGGGTAGGAGAGCCTCTCA
CGCTGAGAACAGCAGAAACAATTACTGGCAAGTATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000261 (MYOC)97729 - 825
Exon 2 To Exon 3 (Pair 5)
Forward (727,20)TCTCAGGAGTGGAGAGGGAGAmplicon SizecDNA: 102 bpgenomic: 1,989
Reverse (828,23)ACACCATACTTGCCAGTAATTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.26 kcal/mol
Forward Dimers-0.778 kcal/mol
Reverse Loops1.126 kcal/mol
Reverse Dimers-0.954 kcal/mol
Forward-Reverse Dimers-1.596 kcal/mol
Amplicon Folding-0.612 kcal/mol outside primersite
Amplicon SequenceTCTCAGGAGTGGAGAGGGAGACACCGGATGTGGAGAACTAGTTTGGGTAGGAGAGCCTCT
CACGCTGAGAACAGCAGAAACAATTACTGGCAAGTATGGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000261 (MYOC)102727 - 828
Exon 2 To Exon 3 (Pair 6)
Forward (727,20)TCTCAGGAGTGGAGAGGGAGAmplicon SizecDNA: 107 bpgenomic: 1,994
Reverse (833,21)TCCACACACCATACTTGCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.26 kcal/mol
Forward Dimers-0.778 kcal/mol
Reverse Loops2.202 kcal/mol in 3' area
Reverse Dimers0.132 kcal/mol
Forward-Reverse Dimers-2.879 kcal/mol
Amplicon Folding-0.612 kcal/mol outside primersite
Amplicon SequenceTCTCAGGAGTGGAGAGGGAGACACCGGATGTGGAGAACTAGTTTGGGTAGGAGAGCCTCT
CACGCTGAGAACAGCAGAAACAATTACTGGCAAGTATGGTGTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000261 (MYOC)107727 - 833
Exon 2 To Exon 3 (Pair 7)
Forward (727,20)TCTCAGGAGTGGAGAGGGAGAmplicon SizecDNA: 99 bpgenomic: 1,986
Reverse (825,23)CCATACTTGCCAGTAATTGTTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.26 kcal/mol
Forward Dimers-0.778 kcal/mol
Reverse Loops1.126 kcal/mol
Reverse Dimers-0.954 kcal/mol
Forward-Reverse Dimers-1.456 kcal/mol
Amplicon Folding-0.612 kcal/mol outside primersite
Amplicon SequenceTCTCAGGAGTGGAGAGGGAGACACCGGATGTGGAGAACTAGTTTGGGTAGGAGAGCCTCT
CACGCTGAGAACAGCAGAAACAATTACTGGCAAGTATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000261 (MYOC)99727 - 825
Exon 2 To Exon 3 (Pair 8)
Forward (729,20)TCAGGAGTGGAGAGGGAGACAmplicon SizecDNA: 107 bpgenomic: 1,994
Reverse (835,21)CATCCACACACCATACTTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.076 kcal/mol
Forward Dimers0.273 kcal/mol in 3' area
Reverse Loops2.202 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.918 kcal/mol
Amplicon Folding-0.612 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGGAGAGGGAGACACCGGATGTGGAGAACTAGTTTGGGTAGGAGAGCCTCTCA
CGCTGAGAACAGCAGAAACAATTACTGGCAAGTATGGTGTGTGGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000261 (MYOC)107729 - 835
Exon 2 To Exon 3 (Pair 9)
Forward (727,20)TCTCAGGAGTGGAGAGGGAGAmplicon SizecDNA: 109 bpgenomic: 1,996
Reverse (835,21)CATCCACACACCATACTTGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.26 kcal/mol
Forward Dimers-0.778 kcal/mol
Reverse Loops2.202 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.918 kcal/mol
Amplicon Folding-0.612 kcal/mol outside primersite
Amplicon SequenceTCTCAGGAGTGGAGAGGGAGACACCGGATGTGGAGAACTAGTTTGGGTAGGAGAGCCTCT
CACGCTGAGAACAGCAGAAACAATTACTGGCAAGTATGGTGTGTGGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000261 (MYOC)109727 - 835
Exon 2 To Exon 3 (Pair 10)
Forward (729,20)TCAGGAGTGGAGAGGGAGACAmplicon SizecDNA: 100 bpgenomic: 1,987
Reverse (828,23)ACACCATACTTGCCAGTAATTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.076 kcal/mol
Forward Dimers0.273 kcal/mol in 3' area
Reverse Loops1.126 kcal/mol
Reverse Dimers-0.954 kcal/mol
Forward-Reverse Dimers-1.596 kcal/mol
Amplicon Folding-0.612 kcal/mol outside primersite
Amplicon SequenceTCAGGAGTGGAGAGGGAGACACCGGATGTGGAGAACTAGTTTGGGTAGGAGAGCCTCTCA
CGCTGAGAACAGCAGAAACAATTACTGGCAAGTATGGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000261 (MYOC)100729 - 828
 

See below for some more details.

Program Output:

Loading ...