Design Results for NAIP

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size90Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 6 (Pair 1)
Forward (1185,21)GGACGGACAGAGCATTTGTTCAmplicon SizecDNA: 120 bpgenomic: 7,860
Reverse (1304,20)CAGAGGCTTTCTGCTGGGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.629 kcal/mol
Reverse Dimers-2.669 kcal/mol
Forward-Reverse Dimers-2.41 kcal/mol
Amplicon Folding-0.442 kcal/mol outside primersite
Amplicon SequenceGGACGGACAGAGCATTTGTTCTTCAGCCACATACTTTCCTTCCACTGGCCAGCATTCTCC
TCTATTAGACTAGAACTGTGGATAAACCTCAGAAAATGGCCACCCAGCAGAAAGCCTCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)120624 - 743
Exon 5 To Exon 6 (Pair 2)
Forward (1190,22)GACAGAGCATTTGTTCTTCAGCAmplicon SizecDNA: 115 bpgenomic: 7,855
Reverse (1304,20)CAGAGGCTTTCTGCTGGGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops0.629 kcal/mol
Reverse Dimers-2.669 kcal/mol
Forward-Reverse Dimers-2.41 kcal/mol
Amplicon Folding-0.442 kcal/mol outside primersite
Amplicon SequenceGACAGAGCATTTGTTCTTCAGCCACATACTTTCCTTCCACTGGCCAGCATTCTCCTCTAT
TAGACTAGAACTGTGGATAAACCTCAGAAAATGGCCACCCAGCAGAAAGCCTCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)115629 - 743
Exon 5 To Exon 6 (Pair 3)
Forward (1190,22)GACAGAGCATTTGTTCTTCAGCAmplicon SizecDNA: 114 bpgenomic: 7,854
Reverse (1303,20)AGAGGCTTTCTGCTGGGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops0.876 kcal/mol
Reverse Dimers-2.669 kcal/mol
Forward-Reverse Dimers-2.41 kcal/mol
Amplicon Folding-0.442 kcal/mol outside primersite
Amplicon SequenceGACAGAGCATTTGTTCTTCAGCCACATACTTTCCTTCCACTGGCCAGCATTCTCCTCTAT
TAGACTAGAACTGTGGATAAACCTCAGAAAATGGCCACCCAGCAGAAAGCCTCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)114629 - 742
Exon 5 To Exon 6 (Pair 4)
Forward (1183,22)AAGGACGGACAGAGCATTTGTTAmplicon SizecDNA: 122 bpgenomic: 7,862
Reverse (1304,20)CAGAGGCTTTCTGCTGGGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.629 kcal/mol
Reverse Dimers-2.669 kcal/mol
Forward-Reverse Dimers-2.41 kcal/mol
Amplicon Folding-0.442 kcal/mol outside primersite
Amplicon SequenceAAGGACGGACAGAGCATTTGTTCTTCAGCCACATACTTTCCTTCCACTGGCCAGCATTCT
CCTCTATTAGACTAGAACTGTGGATAAACCTCAGAAAATGGCCACCCAGCAGAAAGCCTC
TG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)122622 - 743
Exon 5 To Exon 6 (Pair 5)
Forward (1185,21)GGACGGACAGAGCATTTGTTCAmplicon SizecDNA: 119 bpgenomic: 7,859
Reverse (1303,20)AGAGGCTTTCTGCTGGGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.876 kcal/mol
Reverse Dimers-2.669 kcal/mol
Forward-Reverse Dimers-2.41 kcal/mol
Amplicon Folding-0.442 kcal/mol outside primersite
Amplicon SequenceGGACGGACAGAGCATTTGTTCTTCAGCCACATACTTTCCTTCCACTGGCCAGCATTCTCC
TCTATTAGACTAGAACTGTGGATAAACCTCAGAAAATGGCCACCCAGCAGAAAGCCTCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)119624 - 742
Exon 5 To Exon 6 (Pair 6)
Forward (1183,22)AAGGACGGACAGAGCATTTGTTAmplicon SizecDNA: 121 bpgenomic: 7,861
Reverse (1303,20)AGAGGCTTTCTGCTGGGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.876 kcal/mol
Reverse Dimers-2.669 kcal/mol
Forward-Reverse Dimers-2.41 kcal/mol
Amplicon Folding-0.442 kcal/mol outside primersite
Amplicon SequenceAAGGACGGACAGAGCATTTGTTCTTCAGCCACATACTTTCCTTCCACTGGCCAGCATTCT
CCTCTATTAGACTAGAACTGTGGATAAACCTCAGAAAATGGCCACCCAGCAGAAAGCCTC
T
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)121622 - 742
Exon 7 To Exon 8 (Pair 1)
Forward (1916,22)CCTTGGAAGGAACATGCCAAATAmplicon SizecDNA: 104 bpgenomic: 7,521
Reverse (2019,24)ACAAATCCCTTGTAGCTTTGAATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.366 kcal/mol
Forward Dimers-1.869 kcal/mol
Reverse Loops0.528 kcal/mol
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.539 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceCCTTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCC
TCAGAGGAAATTACCCAGTATATTCAAAGCTACAAGGGATTTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)1041355 - 1458
Exon 7 To Exon 8 (Pair 2)
Forward (1916,22)CCTTGGAAGGAACATGCCAAATAmplicon SizecDNA: 96 bpgenomic: 7,513
Reverse (2011,23)CTTGTAGCTTTGAATATACTGGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.366 kcal/mol
Forward Dimers-1.869 kcal/mol
Reverse Loops2.37 kcal/mol in 3' area
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-0.946 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceCCTTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCC
TCAGAGGAAATTACCCAGTATATTCAAAGCTACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)961355 - 1450
Exon 7 To Exon 8 (Pair 3)
Forward (1919,22)TGGAAGGAACATGCCAAATGGTAmplicon SizecDNA: 93 bpgenomic: 7,510
Reverse (2011,23)CTTGTAGCTTTGAATATACTGGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.085 kcal/mol in 3' area
Forward Dimers-1.092 kcal/mol
Reverse Loops2.37 kcal/mol in 3' area
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-0.946 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCCTCA
GAGGAAATTACCCAGTATATTCAAAGCTACAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)931358 - 1450
Exon 7 To Exon 8 (Pair 4)
Forward (1916,22)CCTTGGAAGGAACATGCCAAATAmplicon SizecDNA: 97 bpgenomic: 7,514
Reverse (2012,23)CCTTGTAGCTTTGAATATACTGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.366 kcal/mol
Forward Dimers-1.869 kcal/mol
Reverse Loops2.37 kcal/mol in 3' area
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.328 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceCCTTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCC
TCAGAGGAAATTACCCAGTATATTCAAAGCTACAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)971355 - 1451
Exon 7 To Exon 8 (Pair 5)
Forward (1916,22)CCTTGGAAGGAACATGCCAAATAmplicon SizecDNA: 100 bpgenomic: 7,517
Reverse (2015,24)ATCCCTTGTAGCTTTGAATATACTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.366 kcal/mol
Forward Dimers-1.869 kcal/mol
Reverse Loops2.475 kcal/mol
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.539 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceCCTTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCC
TCAGAGGAAATTACCCAGTATATTCAAAGCTACAAGGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1001355 - 1454
Exon 7 To Exon 8 (Pair 6)
Forward (1919,22)TGGAAGGAACATGCCAAATGGTAmplicon SizecDNA: 100 bpgenomic: 7,517
Reverse (2018,24)CAAATCCCTTGTAGCTTTGAATATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.085 kcal/mol in 3' area
Forward Dimers-1.092 kcal/mol
Reverse Loops1.864 kcal/mol
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.539 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCCTCA
GAGGAAATTACCCAGTATATTCAAAGCTACAAGGGATTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)1001358 - 1457
Exon 7 To Exon 8 (Pair 7)
Forward (1919,22)TGGAAGGAACATGCCAAATGGTAmplicon SizecDNA: 94 bpgenomic: 7,511
Reverse (2012,23)CCTTGTAGCTTTGAATATACTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.085 kcal/mol in 3' area
Forward Dimers-1.092 kcal/mol
Reverse Loops2.37 kcal/mol in 3' area
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.328 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCCTCA
GAGGAAATTACCCAGTATATTCAAAGCTACAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)941358 - 1451
Exon 7 To Exon 8 (Pair 8)
Forward (1916,22)CCTTGGAAGGAACATGCCAAATAmplicon SizecDNA: 98 bpgenomic: 7,515
Reverse (2013,23)CCCTTGTAGCTTTGAATATACTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.366 kcal/mol
Forward Dimers-1.869 kcal/mol
Reverse Loops2.37 kcal/mol in 3' area
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.539 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceCCTTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCC
TCAGAGGAAATTACCCAGTATATTCAAAGCTACAAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)981355 - 1452
Exon 7 To Exon 8 (Pair 9)
Forward (1916,22)CCTTGGAAGGAACATGCCAAATAmplicon SizecDNA: 101 bpgenomic: 7,518
Reverse (2016,24)AATCCCTTGTAGCTTTGAATATACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.366 kcal/mol
Forward Dimers-1.869 kcal/mol
Reverse Loops2.475 kcal/mol
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.539 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceCCTTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCC
TCAGAGGAAATTACCCAGTATATTCAAAGCTACAAGGGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1011355 - 1455
Exon 7 To Exon 8 (Pair 10)
Forward (1919,22)TGGAAGGAACATGCCAAATGGTAmplicon SizecDNA: 97 bpgenomic: 7,514
Reverse (2015,24)ATCCCTTGTAGCTTTGAATATACTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.085 kcal/mol in 3' area
Forward Dimers-1.092 kcal/mol
Reverse Loops2.475 kcal/mol
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.539 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCCTCA
GAGGAAATTACCCAGTATATTCAAAGCTACAAGGGAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)971358 - 1454
Exon 7 To Exon 8 (Pair 11)
Forward (1919,22)TGGAAGGAACATGCCAAATGGTAmplicon SizecDNA: 95 bpgenomic: 7,512
Reverse (2013,23)CCCTTGTAGCTTTGAATATACTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.085 kcal/mol in 3' area
Forward Dimers-1.092 kcal/mol
Reverse Loops2.37 kcal/mol in 3' area
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.539 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCCTCA
GAGGAAATTACCCAGTATATTCAAAGCTACAAGGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)951358 - 1452
Exon 7 To Exon 8 (Pair 12)
Forward (1916,22)CCTTGGAAGGAACATGCCAAATAmplicon SizecDNA: 103 bpgenomic: 7,520
Reverse (2018,24)CAAATCCCTTGTAGCTTTGAATATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.366 kcal/mol
Forward Dimers-1.869 kcal/mol
Reverse Loops1.864 kcal/mol
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.539 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceCCTTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCC
TCAGAGGAAATTACCCAGTATATTCAAAGCTACAAGGGATTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1031355 - 1457
Exon 7 To Exon 8 (Pair 13)
Forward (1919,22)TGGAAGGAACATGCCAAATGGTAmplicon SizecDNA: 98 bpgenomic: 7,515
Reverse (2016,24)AATCCCTTGTAGCTTTGAATATACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.085 kcal/mol in 3' area
Forward Dimers-1.092 kcal/mol
Reverse Loops2.475 kcal/mol
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.539 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCCTCA
GAGGAAATTACCCAGTATATTCAAAGCTACAAGGGATT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)981358 - 1455
Exon 7 To Exon 8 (Pair 14)
Forward (1919,22)TGGAAGGAACATGCCAAATGGTAmplicon SizecDNA: 101 bpgenomic: 7,518
Reverse (2019,24)ACAAATCCCTTGTAGCTTTGAATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.085 kcal/mol in 3' area
Forward Dimers-1.092 kcal/mol
Reverse Loops0.528 kcal/mol
Reverse Dimers-2.282 kcal/mol
Forward-Reverse Dimers-2.539 kcal/mol
Amplicon Folding-0.423 kcal/mol outside primersite
Amplicon SequenceTGGAAGGAACATGCCAAATGGTTCCCCAAATGTGAATTTCTTCGGAGTAAGAAATCCTCA
GAGGAAATTACCCAGTATATTCAAAGCTACAAGGGATTTGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004536 (NAIP)1011358 - 1458
Exon 8 To Exon 10 (Pair 1)
Forward (1996,24)TATTCAAAGCTACAAGGGATTTGTAmplicon SizecDNA: 136 bpgenomic: 2,042
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.675 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceTATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGT
CCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGA
ACTACGGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)136764 - 899
NM_004536 (NAIP)1361435 - 1570
Exon 8 To Exon 10 (Pair 2)
Forward (2000,23)CAAAGCTACAAGGGATTTGTTGAAmplicon SizecDNA: 129 bpgenomic: 2,035
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAG
AGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTA
CGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1291439 - 1567
NM_022892 (NAIP)129768 - 896
Exon 8 To Exon 10 (Pair 3)
Forward (1999,23)TCAAAGCTACAAGGGATTTGTTGAmplicon SizecDNA: 130 bpgenomic: 2,036
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCA
GAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACT
ACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1301438 - 1567
NM_022892 (NAIP)130767 - 896
Exon 8 To Exon 10 (Pair 4)
Forward (1995,24)ATATTCAAAGCTACAAGGGATTTGAmplicon SizecDNA: 137 bpgenomic: 2,043
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.683 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGG
TCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAG
AACTACGGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)137763 - 899
NM_004536 (NAIP)1371434 - 1570
Exon 8 To Exon 10 (Pair 5)
Forward (1996,24)TATTCAAAGCTACAAGGGATTTGTAmplicon SizecDNA: 134 bpgenomic: 2,040
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.675 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceTATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGT
CCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGA
ACTACGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1341435 - 1568
NM_022892 (NAIP)134764 - 897
Exon 8 To Exon 10 (Pair 6)
Forward (1989,23)CCCAGTATATTCAAAGCTACAAGAmplicon SizecDNA: 141 bpgenomic: 2,047
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.038 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATT
CCTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTT
ACGAAGAACTACGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1411428 - 1568
NM_022892 (NAIP)141757 - 897
Exon 8 To Exon 10 (Pair 7)
Forward (1992,24)AGTATATTCAAAGCTACAAGGGATAmplicon SizecDNA: 137 bpgenomic: 2,043
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.73 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCT
GGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACG
AAGAACTACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)137760 - 896
NM_004536 (NAIP)1371431 - 1567
Exon 8 To Exon 10 (Pair 8)
Forward (1997,24)ATTCAAAGCTACAAGGGATTTGTTAmplicon SizecDNA: 132 bpgenomic: 2,038
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTC
CAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAA
CTACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1321436 - 1567
NM_022892 (NAIP)132765 - 896
Exon 8 To Exon 10 (Pair 9)
Forward (1993,24)GTATATTCAAAGCTACAAGGGATTAmplicon SizecDNA: 136 bpgenomic: 2,042
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.061 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTG
GGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGA
AGAACTACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1361432 - 1567
NM_022892 (NAIP)136761 - 896
Exon 8 To Exon 10 (Pair 10)
Forward (1996,24)TATTCAAAGCTACAAGGGATTTGTAmplicon SizecDNA: 133 bpgenomic: 2,039
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.675 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceTATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGT
CCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGA
ACTACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1331435 - 1567
NM_022892 (NAIP)133764 - 896
Exon 8 To Exon 10 (Pair 11)
Forward (2000,23)CAAAGCTACAAGGGATTTGTTGAAmplicon SizecDNA: 130 bpgenomic: 2,036
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAG
AGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTA
CGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1301439 - 1568
NM_022892 (NAIP)130768 - 897
Exon 8 To Exon 10 (Pair 12)
Forward (2003,23)AGCTACAAGGGATTTGTTGACATAmplicon SizecDNA: 127 bpgenomic: 2,033
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGAGA
GAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTACGG
CTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)127771 - 897
NM_004536 (NAIP)1271442 - 1568
Exon 8 To Exon 10 (Pair 13)
Forward (2004,23)GCTACAAGGGATTTGTTGACATAAmplicon SizecDNA: 126 bpgenomic: 2,032
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-0.684 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.443 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGAGAG
AATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTACGGC
TGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)126772 - 897
NM_004536 (NAIP)1261443 - 1568
Exon 8 To Exon 10 (Pair 14)
Forward (2003,23)AGCTACAAGGGATTTGTTGACATAmplicon SizecDNA: 126 bpgenomic: 2,032
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGAGA
GAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTACGG
CTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)126771 - 896
NM_004536 (NAIP)1261442 - 1567
Exon 8 To Exon 10 (Pair 15)
Forward (1978,24)AGAGGAAATTACCCAGTATATTCAAmplicon SizecDNA: 151 bpgenomic: 2,057
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.74 kcal/mol
Forward Dimers-0.892 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAGAGGAAATTACCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACA
TTTTGTGAATTCCTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAG
CATCTTTGCTTACGAAGAACTACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)151746 - 896
NM_004536 (NAIP)1511417 - 1567
Exon 8 To Exon 10 (Pair 16)
Forward (1979,24)GAGGAAATTACCCAGTATATTCAAAmplicon SizecDNA: 150 bpgenomic: 2,056
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.74 kcal/mol
Forward Dimers-0.892 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceGAGGAAATTACCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACAT
TTTGTGAATTCCTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGC
ATCTTTGCTTACGAAGAACTACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)150747 - 896
NM_004536 (NAIP)1501418 - 1567
Exon 8 To Exon 10 (Pair 17)
Forward (1997,24)ATTCAAAGCTACAAGGGATTTGTTAmplicon SizecDNA: 135 bpgenomic: 2,041
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTC
CAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAA
CTACGGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)135765 - 899
NM_004536 (NAIP)1351436 - 1570
Exon 8 To Exon 10 (Pair 18)
Forward (2001,23)AAAGCTACAAGGGATTTGTTGACAmplicon SizecDNA: 128 bpgenomic: 2,034
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGA
GAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTAC
GGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)128769 - 896
NM_004536 (NAIP)1281440 - 1567
Exon 8 To Exon 10 (Pair 19)
Forward (1991,23)CAGTATATTCAAAGCTACAAGGGAmplicon SizecDNA: 139 bpgenomic: 2,045
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.038 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCC
TGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTAC
GAAGAACTACGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)139759 - 897
NM_004536 (NAIP)1391430 - 1568
Exon 8 To Exon 10 (Pair 20)
Forward (1981,24)GGAAATTACCCAGTATATTCAAAGAmplicon SizecDNA: 148 bpgenomic: 2,054
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.098 kcal/mol
Forward Dimers-0.892 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceGGAAATTACCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTT
TGTGAATTCCTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCAT
CTTTGCTTACGAAGAACTACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)148749 - 896
NM_004536 (NAIP)1481420 - 1567
Exon 8 To Exon 10 (Pair 21)
Forward (2002,23)AAGCTACAAGGGATTTGTTGACAAmplicon SizecDNA: 130 bpgenomic: 2,036
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGAG
AGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTACG
GCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1301441 - 1570
NM_022892 (NAIP)130770 - 899
Exon 8 To Exon 10 (Pair 22)
Forward (1997,24)ATTCAAAGCTACAAGGGATTTGTTAmplicon SizecDNA: 133 bpgenomic: 2,039
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTC
CAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAA
CTACGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1331436 - 1568
NM_022892 (NAIP)133765 - 897
Exon 8 To Exon 10 (Pair 23)
Forward (1991,23)CAGTATATTCAAAGCTACAAGGGAmplicon SizecDNA: 138 bpgenomic: 2,044
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.038 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCC
TGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTAC
GAAGAACTACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)138759 - 896
NM_004536 (NAIP)1381430 - 1567
Exon 8 To Exon 10 (Pair 24)
Forward (1990,23)CCAGTATATTCAAAGCTACAAGGAmplicon SizecDNA: 140 bpgenomic: 2,046
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.038 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTC
CTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTA
CGAAGAACTACGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1401429 - 1568
NM_022892 (NAIP)140758 - 897
Exon 8 To Exon 10 (Pair 25)
Forward (1989,23)CCCAGTATATTCAAAGCTACAAGAmplicon SizecDNA: 140 bpgenomic: 2,046
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.038 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATT
CCTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTT
ACGAAGAACTACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)140757 - 896
NM_004536 (NAIP)1401428 - 1567
Exon 8 To Exon 10 (Pair 26)
Forward (2001,23)AAAGCTACAAGGGATTTGTTGACAmplicon SizecDNA: 129 bpgenomic: 2,035
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGA
GAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTAC
GGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)129769 - 897
NM_004536 (NAIP)1291440 - 1568
Exon 8 To Exon 10 (Pair 27)
Forward (2002,23)AAGCTACAAGGGATTTGTTGACAAmplicon SizecDNA: 128 bpgenomic: 2,034
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGAG
AGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTACG
GCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)128770 - 897
NM_004536 (NAIP)1281441 - 1568
Exon 8 To Exon 10 (Pair 28)
Forward (1995,24)ATATTCAAAGCTACAAGGGATTTGAmplicon SizecDNA: 134 bpgenomic: 2,040
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.683 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGG
TCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAG
AACTACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1341434 - 1567
NM_022892 (NAIP)134763 - 896
Exon 8 To Exon 10 (Pair 29)
Forward (2002,23)AAGCTACAAGGGATTTGTTGACAAmplicon SizecDNA: 127 bpgenomic: 2,033
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGAG
AGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTACG
GCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)127770 - 896
NM_004536 (NAIP)1271441 - 1567
Exon 8 To Exon 10 (Pair 30)
Forward (1992,24)AGTATATTCAAAGCTACAAGGGATAmplicon SizecDNA: 140 bpgenomic: 2,046
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.73 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCT
GGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACG
AAGAACTACGGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)140760 - 899
NM_004536 (NAIP)1401431 - 1570
Exon 8 To Exon 10 (Pair 31)
Forward (1992,24)AGTATATTCAAAGCTACAAGGGATAmplicon SizecDNA: 138 bpgenomic: 2,044
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.73 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCT
GGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACG
AAGAACTACGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1381431 - 1568
NM_022892 (NAIP)138760 - 897
Exon 8 To Exon 10 (Pair 32)
Forward (1999,23)TCAAAGCTACAAGGGATTTGTTGAmplicon SizecDNA: 131 bpgenomic: 2,037
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCA
GAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACT
ACGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)131767 - 897
NM_004536 (NAIP)1311438 - 1568
Exon 8 To Exon 9 (Pair 1)
Forward (1955,23)TTTCTTCGGAGTAAGAAATCCTCAmplicon SizecDNA: 123 bpgenomic: 1,755
Reverse (2077,22)TGCCATAGGTAATTCTCTCTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.017 kcal/mol
Forward Dimers-1.24 kcal/mol
Reverse Loops1.257 kcal/mol
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-1.492 kcal/mol
Amplicon Folding0.169 kcal/mol outside primersite
Amplicon SequenceTTTCTTCGGAGTAAGAAATCCTCAGAGGAAATTACCCAGTATATTCAAAGCTACAAGGGA
TTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGAGAGAATTACCTATG
GCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1231394 - 1516
NM_022892 (NAIP)123723 - 845
Exon 8 To Exon 10 (Pair 33)
Forward (2004,23)GCTACAAGGGATTTGTTGACATAAmplicon SizecDNA: 125 bpgenomic: 2,031
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-0.684 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.443 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGAGAG
AATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTACGGC
TGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)125772 - 896
NM_004536 (NAIP)1251443 - 1567
Exon 8 To Exon 10 (Pair 34)
Forward (2003,23)AGCTACAAGGGATTTGTTGACATAmplicon SizecDNA: 129 bpgenomic: 2,035
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGAGA
GAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTACGG
CTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1291442 - 1570
NM_022892 (NAIP)129771 - 899
Exon 8 To Exon 9 (Pair 2)
Forward (1989,23)CCCAGTATATTCAAAGCTACAAGAmplicon SizecDNA: 92 bpgenomic: 1,724
Reverse (2080,23)TGATGCCATAGGTAATTCTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.038 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.257 kcal/mol
Reverse Dimers-0.925 kcal/mol
Forward-Reverse Dimers-0.413 kcal/mol
Amplicon Folding0.169 kcal/mol inside primersite
Amplicon SequenceCCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATT
CCTGGGTCCAGAGAGAATTACCTATGGCATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)92757 - 848
NM_004536 (NAIP)921428 - 1519
Exon 8 To Exon 10 (Pair 35)
Forward (1999,23)TCAAAGCTACAAGGGATTTGTTGAmplicon SizecDNA: 133 bpgenomic: 2,039
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCA
GAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACT
ACGGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1331438 - 1570
NM_022892 (NAIP)133767 - 899
Exon 8 To Exon 10 (Pair 36)
Forward (2000,23)CAAAGCTACAAGGGATTTGTTGAAmplicon SizecDNA: 132 bpgenomic: 2,038
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAG
AGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTA
CGGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1321439 - 1570
NM_022892 (NAIP)132768 - 899
Exon 8 To Exon 10 (Pair 37)
Forward (1993,24)GTATATTCAAAGCTACAAGGGATTAmplicon SizecDNA: 139 bpgenomic: 2,045
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.061 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTG
GGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGA
AGAACTACGGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)139761 - 899
NM_004536 (NAIP)1391432 - 1570
Exon 8 To Exon 10 (Pair 38)
Forward (1981,24)GGAAATTACCCAGTATATTCAAAGAmplicon SizecDNA: 151 bpgenomic: 2,057
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.098 kcal/mol
Forward Dimers-0.892 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceGGAAATTACCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTT
TGTGAATTCCTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCAT
CTTTGCTTACGAAGAACTACGGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1511420 - 1570
NM_022892 (NAIP)151749 - 899
Exon 8 To Exon 10 (Pair 39)
Forward (1991,23)CAGTATATTCAAAGCTACAAGGGAmplicon SizecDNA: 141 bpgenomic: 2,047
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.038 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCC
TGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTAC
GAAGAACTACGGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)141759 - 899
NM_004536 (NAIP)1411430 - 1570
Exon 8 To Exon 10 (Pair 40)
Forward (2001,23)AAAGCTACAAGGGATTTGTTGACAmplicon SizecDNA: 131 bpgenomic: 2,037
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGA
GAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTAC
GGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1311440 - 1570
NM_022892 (NAIP)131769 - 899
Exon 8 To Exon 10 (Pair 41)
Forward (1979,24)GAGGAAATTACCCAGTATATTCAAAmplicon SizecDNA: 151 bpgenomic: 2,057
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.74 kcal/mol
Forward Dimers-0.892 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceGAGGAAATTACCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACAT
TTTGTGAATTCCTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGC
ATCTTTGCTTACGAAGAACTACGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)151747 - 897
NM_004536 (NAIP)1511418 - 1568
Exon 8 To Exon 10 (Pair 42)
Forward (1981,24)GGAAATTACCCAGTATATTCAAAGAmplicon SizecDNA: 149 bpgenomic: 2,055
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.098 kcal/mol
Forward Dimers-0.892 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceGGAAATTACCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTT
TGTGAATTCCTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCAT
CTTTGCTTACGAAGAACTACGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)149749 - 897
NM_004536 (NAIP)1491420 - 1568
Exon 8 To Exon 10 (Pair 43)
Forward (2004,23)GCTACAAGGGATTTGTTGACATAAmplicon SizecDNA: 128 bpgenomic: 2,034
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-0.684 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.443 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGAGAG
AATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAGAACTACGGC
TGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)128772 - 899
NM_004536 (NAIP)1281443 - 1570
Exon 8 To Exon 10 (Pair 44)
Forward (1995,24)ATATTCAAAGCTACAAGGGATTTGAmplicon SizecDNA: 135 bpgenomic: 2,041
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.683 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGG
TCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGAAG
AACTACGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)135763 - 897
NM_004536 (NAIP)1351434 - 1568
Exon 8 To Exon 10 (Pair 45)
Forward (1989,23)CCCAGTATATTCAAAGCTACAAGAmplicon SizecDNA: 143 bpgenomic: 2,049
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.038 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATT
CCTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTT
ACGAAGAACTACGGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1431428 - 1570
NM_022892 (NAIP)143757 - 899
Exon 8 To Exon 10 (Pair 46)
Forward (1990,23)CCAGTATATTCAAAGCTACAAGGAmplicon SizecDNA: 139 bpgenomic: 2,045
Reverse (2128,21)GTCCAGCCGTAGTTCTTCGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.038 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTC
CTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTA
CGAAGAACTACGGCTGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1391429 - 1567
NM_022892 (NAIP)139758 - 896
Exon 8 To Exon 10 (Pair 47)
Forward (1990,23)CCAGTATATTCAAAGCTACAAGGAmplicon SizecDNA: 142 bpgenomic: 2,048
Reverse (2131,21)AGAGTCCAGCCGTAGTTCTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.038 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceCCAGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTC
CTGGGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTA
CGAAGAACTACGGCTGGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1421429 - 1570
NM_022892 (NAIP)142758 - 899
Exon 8 To Exon 9 (Pair 3)
Forward (1956,23)TTCTTCGGAGTAAGAAATCCTCAAmplicon SizecDNA: 122 bpgenomic: 1,754
Reverse (2077,22)TGCCATAGGTAATTCTCTCTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.177 kcal/mol in 3' area
Forward Dimers-0.865 kcal/mol
Reverse Loops1.257 kcal/mol
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-1.492 kcal/mol
Amplicon Folding0.169 kcal/mol outside primersite
Amplicon SequenceTTCTTCGGAGTAAGAAATCCTCAGAGGAAATTACCCAGTATATTCAAAGCTACAAGGGAT
TTGTTGACATAACGGGAGAACATTTTGTGAATTCCTGGGTCCAGAGAGAATTACCTATGG
CA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1221395 - 1516
NM_022892 (NAIP)122724 - 845
Exon 8 To Exon 10 (Pair 48)
Forward (1993,24)GTATATTCAAAGCTACAAGGGATTAmplicon SizecDNA: 137 bpgenomic: 2,043
Reverse (2129,21)AGTCCAGCCGTAGTTCTTCGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.061 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops2.27 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol
Forward-Reverse Dimers-1.77 kcal/mol
Amplicon Folding-0.854 kcal/mol outside primersite
Amplicon SequenceGTATATTCAAAGCTACAAGGGATTTGTTGACATAACGGGAGAACATTTTGTGAATTCCTG
GGTCCAGAGAGAATTACCTATGGCATCAGCTTATTGCAATGACAGCATCTTTGCTTACGA
AGAACTACGGCTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)137761 - 897
NM_004536 (NAIP)1371432 - 1568
Exon 10 To Exon 11 (Pair 1)
Forward (2108,21)TACGAAGAACTACGGCTGGACAmplicon SizecDNA: 149 bpgenomic: 3,023
Reverse (2256,22)TGCCATTTCTCTAAACACCCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.784 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.097 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.735 kcal/mol outside primersite
Amplicon SequenceTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGAGTT
GCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTGCTTT
TCCTGTGGAGGGTGTTTAGAGAAATGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)149876 - 1024
NM_004536 (NAIP)1491547 - 1695
Exon 10 To Exon 11 (Pair 2)
Forward (2106,21)CTTACGAAGAACTACGGCTGGAmplicon SizecDNA: 119 bpgenomic: 2,993
Reverse (2224,22)GCACTGGACGATGTCCTTTATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.491 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGAG
TTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1191545 - 1663
NM_022892 (NAIP)119874 - 992
Exon 10 To Exon 11 (Pair 3)
Forward (2109,21)ACGAAGAACTACGGCTGGACTAmplicon SizecDNA: 149 bpgenomic: 3,023
Reverse (2257,22)CTGCCATTTCTCTAAACACCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.784 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.097 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.735 kcal/mol outside primersite
Amplicon SequenceACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGAGTTG
CAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTGCTTTT
CCTGTGGAGGGTGTTTAGAGAAATGGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1491548 - 1696
NM_022892 (NAIP)149877 - 1025
Exon 10 To Exon 11 (Pair 4)
Forward (2112,22)AAGAACTACGGCTGGACTCTTTAmplicon SizecDNA: 112 bpgenomic: 2,986
Reverse (2223,22)CACTGGACGATGTCCTTTATACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.031 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.345 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGAGTTGCAG
CACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1121551 - 1662
NM_022892 (NAIP)112880 - 991
Exon 10 To Exon 11 (Pair 5)
Forward (2098,23)CATCTTTGCTTACGAAGAACTACAmplicon SizecDNA: 126 bpgenomic: 3,000
Reverse (2223,22)CACTGGACGATGTCCTTTATACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.816 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceCATCTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGC
TGTGGGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGT
CCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1261537 - 1662
NM_022892 (NAIP)126866 - 991
Exon 10 To Exon 11 (Pair 6)
Forward (2111,21)GAAGAACTACGGCTGGACTCTAmplicon SizecDNA: 114 bpgenomic: 2,988
Reverse (2224,22)GCACTGGACGATGTCCTTTATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.211 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.345 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGAGTTGCA
GCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1141550 - 1663
NM_022892 (NAIP)114879 - 992
Exon 10 To Exon 11 (Pair 7)
Forward (2105,21)GCTTACGAAGAACTACGGCTGAmplicon SizecDNA: 120 bpgenomic: 2,994
Reverse (2224,22)GCACTGGACGATGTCCTTTATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGA
GTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1201544 - 1663
NM_022892 (NAIP)120873 - 992
Exon 10 To Exon 11 (Pair 8)
Forward (2103,22)TTGCTTACGAAGAACTACGGCTAmplicon SizecDNA: 151 bpgenomic: 3,025
Reverse (2253,22)CATTTCTCTAAACACCCTCCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.097 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.218 kcal/mol
Amplicon Folding-1.735 kcal/mol outside primersite
Amplicon SequenceTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGG
GAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGT
GCTTTTCCTGTGGAGGGTGTTTAGAGAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)151871 - 1021
NM_004536 (NAIP)1511542 - 1692
Exon 10 To Exon 11 (Pair 9)
Forward (2101,22)CTTTGCTTACGAAGAACTACGGAmplicon SizecDNA: 123 bpgenomic: 2,997
Reverse (2223,22)CACTGGACGATGTCCTTTATACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceCTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGT
GGGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCA
GTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1231540 - 1662
NM_022892 (NAIP)123869 - 991
Exon 10 To Exon 11 (Pair 10)
Forward (2099,23)ATCTTTGCTTACGAAGAACTACGAmplicon SizecDNA: 126 bpgenomic: 3,000
Reverse (2224,22)GCACTGGACGATGTCCTTTATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.816 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceATCTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCT
GTGGGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTC
CAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)126867 - 992
NM_004536 (NAIP)1261538 - 1663
Exon 10 To Exon 11 (Pair 11)
Forward (2106,21)CTTACGAAGAACTACGGCTGGAmplicon SizecDNA: 146 bpgenomic: 3,020
Reverse (2251,22)TTTCTCTAAACACCCTCCACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.491 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.398 kcal/mol
Reverse Dimers0.399 kcal/mol in 3' area
Forward-Reverse Dimers-1.218 kcal/mol
Amplicon Folding-1.735 kcal/mol outside primersite
Amplicon SequenceCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGAG
TTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTGCT
TTTCCTGTGGAGGGTGTTTAGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)146874 - 1019
NM_004536 (NAIP)1461545 - 1690
Exon 10 To Exon 11 (Pair 12)
Forward (2101,22)CTTTGCTTACGAAGAACTACGGAmplicon SizecDNA: 124 bpgenomic: 2,998
Reverse (2224,22)GCACTGGACGATGTCCTTTATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceCTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGT
GGGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCA
GTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)124869 - 992
NM_004536 (NAIP)1241540 - 1663
Exon 10 To Exon 11 (Pair 13)
Forward (2109,21)ACGAAGAACTACGGCTGGACTAmplicon SizecDNA: 148 bpgenomic: 3,022
Reverse (2256,22)TGCCATTTCTCTAAACACCCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.784 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.097 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.735 kcal/mol outside primersite
Amplicon SequenceACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGAGTTG
CAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTGCTTTT
CCTGTGGAGGGTGTTTAGAGAAATGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)148877 - 1024
NM_004536 (NAIP)1481548 - 1695
Exon 10 To Exon 11 (Pair 14)
Forward (2097,23)GCATCTTTGCTTACGAAGAACTAAmplicon SizecDNA: 128 bpgenomic: 3,002
Reverse (2224,22)GCACTGGACGATGTCCTTTATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.816 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceGCATCTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAG
CTGTGGGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCG
TCCAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)128865 - 992
NM_004536 (NAIP)1281536 - 1663
Exon 10 To Exon 11 (Pair 15)
Forward (2105,21)GCTTACGAAGAACTACGGCTGAmplicon SizecDNA: 147 bpgenomic: 3,021
Reverse (2251,22)TTTCTCTAAACACCCTCCACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.398 kcal/mol
Reverse Dimers0.399 kcal/mol in 3' area
Forward-Reverse Dimers-1.218 kcal/mol
Amplicon Folding-1.735 kcal/mol outside primersite
Amplicon SequenceGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGA
GTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTGC
TTTTCCTGTGGAGGGTGTTTAGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)147873 - 1019
NM_004536 (NAIP)1471544 - 1690
Exon 10 To Exon 11 (Pair 16)
Forward (2106,21)CTTACGAAGAACTACGGCTGGAmplicon SizecDNA: 149 bpgenomic: 3,023
Reverse (2254,22)CCATTTCTCTAAACACCCTCCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.491 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.097 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.218 kcal/mol
Amplicon Folding-1.735 kcal/mol outside primersite
Amplicon SequenceCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGAG
TTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTGCT
TTTCCTGTGGAGGGTGTTTAGAGAAATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)149874 - 1022
NM_004536 (NAIP)1491545 - 1693
Exon 10 To Exon 11 (Pair 17)
Forward (2112,22)AAGAACTACGGCTGGACTCTTTAmplicon SizecDNA: 145 bpgenomic: 3,019
Reverse (2256,22)TGCCATTTCTCTAAACACCCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.031 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops2.097 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.735 kcal/mol outside primersite
Amplicon SequenceAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGAGTTGCAG
CACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTGCTTTTCCT
GTGGAGGGTGTTTAGAGAAATGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)145880 - 1024
NM_004536 (NAIP)1451551 - 1695
Exon 10 To Exon 11 (Pair 18)
Forward (2106,21)CTTACGAAGAACTACGGCTGGAmplicon SizecDNA: 118 bpgenomic: 2,992
Reverse (2223,22)CACTGGACGATGTCCTTTATACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.491 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGAG
TTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)118874 - 991
NM_004536 (NAIP)1181545 - 1662
Exon 10 To Exon 11 (Pair 19)
Forward (2102,22)TTTGCTTACGAAGAACTACGGCAmplicon SizecDNA: 123 bpgenomic: 2,997
Reverse (2224,22)GCACTGGACGATGTCCTTTATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTG
GGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAG
TGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1231541 - 1663
NM_022892 (NAIP)123870 - 992
Exon 10 To Exon 11 (Pair 20)
Forward (2103,22)TTGCTTACGAAGAACTACGGCTAmplicon SizecDNA: 121 bpgenomic: 2,995
Reverse (2223,22)CACTGGACGATGTCCTTTATACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGG
GAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGT
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1211542 - 1662
NM_022892 (NAIP)121871 - 991
Exon 10 To Exon 11 (Pair 21)
Forward (2099,23)ATCTTTGCTTACGAAGAACTACGAmplicon SizecDNA: 125 bpgenomic: 2,999
Reverse (2223,22)CACTGGACGATGTCCTTTATACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.816 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceATCTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCT
GTGGGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTC
CAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)125867 - 991
NM_004536 (NAIP)1251538 - 1662
Exon 10 To Exon 11 (Pair 22)
Forward (2105,21)GCTTACGAAGAACTACGGCTGAmplicon SizecDNA: 119 bpgenomic: 2,993
Reverse (2223,22)CACTGGACGATGTCCTTTATACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGA
GTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)119873 - 991
NM_004536 (NAIP)1191544 - 1662
Exon 10 To Exon 11 (Pair 23)
Forward (2102,22)TTTGCTTACGAAGAACTACGGCAmplicon SizecDNA: 122 bpgenomic: 2,996
Reverse (2223,22)CACTGGACGATGTCCTTTATACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTG
GGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAG
TG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1221541 - 1662
NM_022892 (NAIP)122870 - 991
Exon 10 To Exon 11 (Pair 24)
Forward (2103,22)TTGCTTACGAAGAACTACGGCTAmplicon SizecDNA: 122 bpgenomic: 2,996
Reverse (2224,22)GCACTGGACGATGTCCTTTATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGG
GAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGT
GC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)122871 - 992
NM_004536 (NAIP)1221542 - 1663
Exon 10 To Exon 11 (Pair 25)
Forward (2097,23)GCATCTTTGCTTACGAAGAACTAAmplicon SizecDNA: 127 bpgenomic: 3,001
Reverse (2223,22)CACTGGACGATGTCCTTTATACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.816 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceGCATCTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAG
CTGTGGGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCG
TCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1271536 - 1662
NM_022892 (NAIP)127865 - 991
Exon 10 To Exon 11 (Pair 26)
Forward (2105,21)GCTTACGAAGAACTACGGCTGAmplicon SizecDNA: 149 bpgenomic: 3,023
Reverse (2253,22)CATTTCTCTAAACACCCTCCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.097 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.218 kcal/mol
Amplicon Folding-1.735 kcal/mol outside primersite
Amplicon SequenceGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTGGGA
GTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAGTGC
TTTTCCTGTGGAGGGTGTTTAGAGAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1491544 - 1692
NM_022892 (NAIP)149873 - 1021
Exon 10 To Exon 11 (Pair 27)
Forward (2102,22)TTTGCTTACGAAGAACTACGGCAmplicon SizecDNA: 150 bpgenomic: 3,024
Reverse (2251,22)TTTCTCTAAACACCCTCCACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.398 kcal/mol
Reverse Dimers0.399 kcal/mol in 3' area
Forward-Reverse Dimers-1.218 kcal/mol
Amplicon Folding-1.735 kcal/mol outside primersite
Amplicon SequenceTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGTG
GGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCAG
TGCTTTTCCTGTGGAGGGTGTTTAGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004536 (NAIP)1501541 - 1690
NM_022892 (NAIP)150870 - 1019
Exon 10 To Exon 11 (Pair 28)
Forward (2098,23)CATCTTTGCTTACGAAGAACTACAmplicon SizecDNA: 127 bpgenomic: 3,001
Reverse (2224,22)GCACTGGACGATGTCCTTTATANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.816 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops0.372 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.119 kcal/mol
Amplicon Folding-0.427 kcal/mol outside primersite
Amplicon SequenceCATCTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGC
TGTGGGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGT
CCAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)127866 - 992
NM_004536 (NAIP)1271537 - 1663
Exon 10 To Exon 11 (Pair 29)
Forward (2101,22)CTTTGCTTACGAAGAACTACGGAmplicon SizecDNA: 151 bpgenomic: 3,025
Reverse (2251,22)TTTCTCTAAACACCCTCCACAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.117 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.398 kcal/mol
Reverse Dimers0.399 kcal/mol in 3' area
Forward-Reverse Dimers-1.218 kcal/mol
Amplicon Folding-1.735 kcal/mol outside primersite
Amplicon SequenceCTTTGCTTACGAAGAACTACGGCTGGACTCTTTTAAGGACTGGCCCCGGGAATCAGCTGT
GGGAGTTGCAGCACTGGCCAAAGCAGGTCTTTTCTACACAGGTATAAAGGACATCGTCCA
GTGCTTTTCCTGTGGAGGGTGTTTAGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_022892 (NAIP)151869 - 1019
NM_004536 (NAIP)1511540 - 1690
 

See below for some more details.

Program Output:

Loading ...