Design Results for NFASC

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (150,21)TTTGGGACGCTGGAGTTTACCAmplicon SizecDNA: 134 bpgenomic: 23,619
Reverse (283,21)TGTCACCTCGAGCCGCTTTAANr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.493 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTGTTG
CAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAAAGC
GGCTCGAGGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)134150 - 283
NM_001160333 (NFASC)134150 - 283
NM_001005389 (NFASC)134150 - 283
NM_001005388 (NFASC)134150 - 283
NM_001160332 (NFASC)134150 - 283
Exon 2 To Exon 3 (Pair 2)
Forward (156,21)ACGCTGGAGTTTACCTTCCCTAmplicon SizecDNA: 129 bpgenomic: 23,614
Reverse (284,21)TTGTCACCTCGAGCCGCTTTANr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.566 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTGTTGCAAGGA
AGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAAAGCGGCTCG
AGGTGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)129156 - 284
NM_015090 (NFASC)129156 - 284
NM_001160333 (NFASC)129156 - 284
NM_001005389 (NFASC)129156 - 284
NM_001005388 (NFASC)129156 - 284
Exon 2 To Exon 3 (Pair 3)
Forward (147,22)CAATTTGGGACGCTGGAGTTTAAmplicon SizecDNA: 139 bpgenomic: 23,624
Reverse (285,20)CTTGTCACCTCGAGCCGCTTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.884 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTG
TTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAA
AGCGGCTCGAGGTGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001005388 (NFASC)139147 - 285
NM_001005389 (NFASC)139147 - 285
NM_001160333 (NFASC)139147 - 285
NM_015090 (NFASC)139147 - 285
NM_001160332 (NFASC)139147 - 285
Exon 2 To Exon 3 (Pair 4)
Forward (145,21)TGCAATTTGGGACGCTGGAGTAmplicon SizecDNA: 137 bpgenomic: 23,622
Reverse (281,21)TCACCTCGAGCCGCTTTAACTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGG
TGTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTT
AAAGCGGCTCGAGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)137145 - 281
NM_001005388 (NFASC)137145 - 281
NM_001005389 (NFASC)137145 - 281
NM_001160333 (NFASC)137145 - 281
NM_015090 (NFASC)137145 - 281
Exon 2 To Exon 3 (Pair 5)
Forward (145,21)TGCAATTTGGGACGCTGGAGTAmplicon SizecDNA: 140 bpgenomic: 23,625
Reverse (284,21)TTGTCACCTCGAGCCGCTTTANr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGG
TGTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTT
AAAGCGGCTCGAGGTGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)140145 - 284
NM_015090 (NFASC)140145 - 284
NM_001160333 (NFASC)140145 - 284
NM_001005389 (NFASC)140145 - 284
NM_001005388 (NFASC)140145 - 284
Exon 2 To Exon 3 (Pair 6)
Forward (150,21)TTTGGGACGCTGGAGTTTACCAmplicon SizecDNA: 135 bpgenomic: 23,620
Reverse (284,21)TTGTCACCTCGAGCCGCTTTANr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.493 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTGTTG
CAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAAAGC
GGCTCGAGGTGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001005389 (NFASC)135150 - 284
NM_001005388 (NFASC)135150 - 284
NM_015090 (NFASC)135150 - 284
NM_001160333 (NFASC)135150 - 284
NM_001160332 (NFASC)135150 - 284
Exon 2 To Exon 3 (Pair 7)
Forward (145,21)TGCAATTTGGGACGCTGGAGTAmplicon SizecDNA: 130 bpgenomic: 23,615
Reverse (274,20)GAGCCGCTTTAACTGGGCCTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.445 kcal/mol in 3' area
Reverse Dimers-2.772 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGG
TGTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTT
AAAGCGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001005389 (NFASC)130145 - 274
NM_001005388 (NFASC)130145 - 274
NM_015090 (NFASC)130145 - 274
NM_001160333 (NFASC)130145 - 274
NM_001160332 (NFASC)130145 - 274
Exon 2 To Exon 3 (Pair 8)
Forward (146,21)GCAATTTGGGACGCTGGAGTTAmplicon SizecDNA: 139 bpgenomic: 23,624
Reverse (284,21)TTGTCACCTCGAGCCGCTTTANr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.884 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGT
GTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTA
AAGCGGCTCGAGGTGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)139146 - 284
NM_001160333 (NFASC)139146 - 284
NM_001005389 (NFASC)139146 - 284
NM_001005388 (NFASC)139146 - 284
NM_001160332 (NFASC)139146 - 284
Exon 2 To Exon 3 (Pair 9)
Forward (156,21)ACGCTGGAGTTTACCTTCCCTAmplicon SizecDNA: 114 bpgenomic: 23,599
Reverse (269,20)GCTTTAACTGGGCCTCCTGGNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.566 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.902 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTGTTGCAAGGA
AGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)114156 - 269
NM_001160333 (NFASC)114156 - 269
NM_001005389 (NFASC)114156 - 269
NM_001005388 (NFASC)114156 - 269
NM_001160332 (NFASC)114156 - 269
Exon 2 To Exon 3 (Pair 10)
Forward (156,21)ACGCTGGAGTTTACCTTCCCTAmplicon SizecDNA: 128 bpgenomic: 23,613
Reverse (283,21)TGTCACCTCGAGCCGCTTTAANr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.566 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTGTTGCAAGGA
AGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAAAGCGGCTCG
AGGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160333 (NFASC)128156 - 283
NM_015090 (NFASC)128156 - 283
NM_001005388 (NFASC)128156 - 283
NM_001005389 (NFASC)128156 - 283
NM_001160332 (NFASC)128156 - 283
Exon 2 To Exon 3 (Pair 11)
Forward (156,21)ACGCTGGAGTTTACCTTCCCTAmplicon SizecDNA: 119 bpgenomic: 23,604
Reverse (274,20)GAGCCGCTTTAACTGGGCCTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.566 kcal/mol
Reverse Loops0.445 kcal/mol in 3' area
Reverse Dimers-2.772 kcal/mol
Forward-Reverse Dimers-1.902 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTGTTGCAAGGA
AGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAAAGCGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)119156 - 274
NM_001005389 (NFASC)119156 - 274
NM_001005388 (NFASC)119156 - 274
NM_015090 (NFASC)119156 - 274
NM_001160333 (NFASC)119156 - 274
Exon 2 To Exon 3 (Pair 12)
Forward (145,21)TGCAATTTGGGACGCTGGAGTAmplicon SizecDNA: 139 bpgenomic: 23,624
Reverse (283,21)TGTCACCTCGAGCCGCTTTAANr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGG
TGTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTT
AAAGCGGCTCGAGGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160333 (NFASC)139145 - 283
NM_015090 (NFASC)139145 - 283
NM_001005388 (NFASC)139145 - 283
NM_001005389 (NFASC)139145 - 283
NM_001160332 (NFASC)139145 - 283
Exon 2 To Exon 3 (Pair 13)
Forward (150,21)TTTGGGACGCTGGAGTTTACCAmplicon SizecDNA: 136 bpgenomic: 23,621
Reverse (285,20)CTTGTCACCTCGAGCCGCTTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.493 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTGTTG
CAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAAAGC
GGCTCGAGGTGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)136150 - 285
NM_001005389 (NFASC)136150 - 285
NM_001005388 (NFASC)136150 - 285
NM_015090 (NFASC)136150 - 285
NM_001160333 (NFASC)136150 - 285
Exon 2 To Exon 3 (Pair 14)
Forward (156,21)ACGCTGGAGTTTACCTTCCCTAmplicon SizecDNA: 126 bpgenomic: 23,611
Reverse (281,21)TCACCTCGAGCCGCTTTAACTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.566 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTGTTGCAAGGA
AGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAAAGCGGCTCG
AGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)126156 - 281
NM_001160333 (NFASC)126156 - 281
NM_015090 (NFASC)126156 - 281
NM_001005388 (NFASC)126156 - 281
NM_001005389 (NFASC)126156 - 281
Exon 2 To Exon 3 (Pair 15)
Forward (150,21)TTTGGGACGCTGGAGTTTACCAmplicon SizecDNA: 132 bpgenomic: 23,617
Reverse (281,21)TCACCTCGAGCCGCTTTAACTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.493 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTGTTG
CAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAAAGC
GGCTCGAGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001005388 (NFASC)132150 - 281
NM_001005389 (NFASC)132150 - 281
NM_001160333 (NFASC)132150 - 281
NM_015090 (NFASC)132150 - 281
NM_001160332 (NFASC)132150 - 281
Exon 2 To Exon 3 (Pair 16)
Forward (147,22)CAATTTGGGACGCTGGAGTTTAAmplicon SizecDNA: 135 bpgenomic: 23,620
Reverse (281,21)TCACCTCGAGCCGCTTTAACTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.884 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTG
TTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAA
AGCGGCTCGAGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)135147 - 281
NM_001160333 (NFASC)135147 - 281
NM_001005389 (NFASC)135147 - 281
NM_001005388 (NFASC)135147 - 281
NM_001160332 (NFASC)135147 - 281
Exon 2 To Exon 3 (Pair 17)
Forward (146,21)GCAATTTGGGACGCTGGAGTTAmplicon SizecDNA: 138 bpgenomic: 23,623
Reverse (283,21)TGTCACCTCGAGCCGCTTTAANr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.884 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGT
GTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTA
AAGCGGCTCGAGGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001005389 (NFASC)138146 - 283
NM_001005388 (NFASC)138146 - 283
NM_015090 (NFASC)138146 - 283
NM_001160333 (NFASC)138146 - 283
NM_001160332 (NFASC)138146 - 283
Exon 2 To Exon 3 (Pair 18)
Forward (146,21)GCAATTTGGGACGCTGGAGTTAmplicon SizecDNA: 136 bpgenomic: 23,621
Reverse (281,21)TCACCTCGAGCCGCTTTAACTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.884 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGT
GTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTA
AAGCGGCTCGAGGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)136146 - 281
NM_015090 (NFASC)136146 - 281
NM_001160333 (NFASC)136146 - 281
NM_001005389 (NFASC)136146 - 281
NM_001005388 (NFASC)136146 - 281
Exon 2 To Exon 3 (Pair 19)
Forward (156,21)ACGCTGGAGTTTACCTTCCCTAmplicon SizecDNA: 130 bpgenomic: 23,615
Reverse (285,20)CTTGTCACCTCGAGCCGCTTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.566 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTGTTGCAAGGA
AGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAAAGCGGCTCG
AGGTGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)130156 - 285
NM_001160333 (NFASC)130156 - 285
NM_001005389 (NFASC)130156 - 285
NM_001005388 (NFASC)130156 - 285
NM_001160332 (NFASC)130156 - 285
Exon 2 To Exon 3 (Pair 20)
Forward (145,21)TGCAATTTGGGACGCTGGAGTAmplicon SizecDNA: 134 bpgenomic: 23,619
Reverse (278,20)CCTCGAGCCGCTTTAACTGGNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.739 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGG
TGTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTT
AAAGCGGCTCGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)134145 - 278
NM_001160333 (NFASC)134145 - 278
NM_015090 (NFASC)134145 - 278
NM_001005388 (NFASC)134145 - 278
NM_001005389 (NFASC)134145 - 278
Exon 2 To Exon 3 (Pair 21)
Forward (146,21)GCAATTTGGGACGCTGGAGTTAmplicon SizecDNA: 140 bpgenomic: 23,625
Reverse (285,20)CTTGTCACCTCGAGCCGCTTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.884 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGT
GTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTA
AAGCGGCTCGAGGTGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)140146 - 285
NM_001160333 (NFASC)140146 - 285
NM_015090 (NFASC)140146 - 285
NM_001005388 (NFASC)140146 - 285
NM_001005389 (NFASC)140146 - 285
Exon 2 To Exon 3 (Pair 22)
Forward (145,21)TGCAATTTGGGACGCTGGAGTAmplicon SizecDNA: 133 bpgenomic: 23,618
Reverse (277,20)CTCGAGCCGCTTTAACTGGGNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.739 kcal/mol
Reverse Dimers-2.772 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGG
TGTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTT
AAAGCGGCTCGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001005388 (NFASC)133145 - 277
NM_001005389 (NFASC)133145 - 277
NM_001160333 (NFASC)133145 - 277
NM_015090 (NFASC)133145 - 277
NM_001160332 (NFASC)133145 - 277
Exon 2 To Exon 3 (Pair 23)
Forward (147,22)CAATTTGGGACGCTGGAGTTTAAmplicon SizecDNA: 138 bpgenomic: 23,623
Reverse (284,21)TTGTCACCTCGAGCCGCTTTANr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.884 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTG
TTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAA
AGCGGCTCGAGGTGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)138147 - 284
NM_001160333 (NFASC)138147 - 284
NM_015090 (NFASC)138147 - 284
NM_001005388 (NFASC)138147 - 284
NM_001005389 (NFASC)138147 - 284
Exon 2 To Exon 3 (Pair 24)
Forward (145,21)TGCAATTTGGGACGCTGGAGTAmplicon SizecDNA: 141 bpgenomic: 23,626
Reverse (285,20)CTTGTCACCTCGAGCCGCTTNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGG
TGTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTT
AAAGCGGCTCGAGGTGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)141145 - 285
NM_001005389 (NFASC)141145 - 285
NM_001005388 (NFASC)141145 - 285
NM_015090 (NFASC)141145 - 285
NM_001160333 (NFASC)141145 - 285
Exon 2 To Exon 3 (Pair 25)
Forward (145,21)TGCAATTTGGGACGCTGGAGTAmplicon SizecDNA: 132 bpgenomic: 23,617
Reverse (276,20)TCGAGCCGCTTTAACTGGGCNr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.564 kcal/mol in 3' area
Reverse Dimers-2.772 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceTGCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGG
TGTTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTT
AAAGCGGCTCGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)132145 - 276
NM_001160333 (NFASC)132145 - 276
NM_001005389 (NFASC)132145 - 276
NM_001005388 (NFASC)132145 - 276
NM_001160332 (NFASC)132145 - 276
Exon 2 To Exon 3 (Pair 26)
Forward (147,22)CAATTTGGGACGCTGGAGTTTAAmplicon SizecDNA: 137 bpgenomic: 23,622
Reverse (283,21)TGTCACCTCGAGCCGCTTTAANr. of Isoforms 5 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.236 kcal/mol
Forward Dimers-0.884 kcal/mol
Reverse Loops1.718 kcal/mol
Reverse Dimers-2.794 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-2.074 kcal/mol outside primersite
Amplicon SequenceCAATTTGGGACGCTGGAGTTTACCTTCCCTCCGCAGCCTGGAACAGAGCCTCCTCTGGTG
TTGCAAGGAAGAGGCTGAATGAGGCAGAGAAGCTGAGTGCTGTCCAGGAGGCCCAGTTAA
AGCGGCTCGAGGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001005388 (NFASC)137147 - 283
NM_001005389 (NFASC)137147 - 283
NM_001160333 (NFASC)137147 - 283
NM_015090 (NFASC)137147 - 283
NM_001160332 (NFASC)137147 - 283
Exon 3 To Exon 6 (Pair 1)
Forward (369,20)TCCTCCTCTGCCTCCTCAGTAmplicon SizecDNA: 211 bpgenomic: 9,868
Reverse (579,23)ATGTTGAAGAATCTGCTGTTTCGNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTC
AGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGG
ACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCC
ACTGGACACGAAACAGCAGATTCTTCAACAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160333 (NFASC)193369 - 561
NM_015090 (NFASC)193369 - 561
NM_001160331 (NFASC)193131 - 323
NM_001005388 (NFASC)211369 - 579
NM_001005389 (NFASC)211369 - 579
NM_001160332 (NFASC)193369 - 561
Exon 3 To Exon 6 (Pair 2)
Forward (368,20)TTCCTCCTCTGCCTCCTCAGAmplicon SizecDNA: 214 bpgenomic: 9,871
Reverse (581,23)CGATGTTGAAGAATCTGCTGTTTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol in 3' area
Forward Dimers0.091 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATT
CAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTG
GACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTC
CACTGGACACGAAACAGCAGATTCTTCAACATCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)196368 - 563
NM_001160331 (NFASC)196130 - 325
NM_015090 (NFASC)196368 - 563
NM_001160333 (NFASC)196368 - 563
NM_001005389 (NFASC)214368 - 581
NM_001005388 (NFASC)214368 - 581
Exon 3 To Exon 6 (Pair 3)
Forward (369,20)TCCTCCTCTGCCTCCTCAGTAmplicon SizecDNA: 219 bpgenomic: 9,876
Reverse (587,22)CCTTGGCGATGTTGAAGAATCTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTC
AGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGG
ACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCC
ACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_015090 (NFASC)201369 - 569
NM_001160333 (NFASC)201369 - 569
NM_001005389 (NFASC)219369 - 587
NM_001005388 (NFASC)219369 - 587
NM_001160331 (NFASC)201131 - 331
NM_001160332 (NFASC)201369 - 569
Exon 3 To Exon 6 (Pair 4)
Forward (371,20)CTCCTCTGCCTCCTCAGTCTAmplicon SizecDNA: 210 bpgenomic: 9,867
Reverse (580,23)GATGTTGAAGAATCTGCTGTTTCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTCAG
AATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGGAC
CCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCCAC
TGGACACGAAACAGCAGATTCTTCAACATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_015090 (NFASC)192371 - 562
NM_001160333 (NFASC)192371 - 562
NM_001005389 (NFASC)210371 - 580
NM_001005388 (NFASC)210371 - 580
NM_001160331 (NFASC)192133 - 324
NM_001160332 (NFASC)192371 - 562
Exon 3 To Exon 6 (Pair 5)
Forward (367,20)CTTCCTCCTCTGCCTCCTCAAmplicon SizecDNA: 218 bpgenomic: 9,875
Reverse (584,22)TGGCGATGTTGAAGAATCTGCTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.797 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCAT
TCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGT
GGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTT
CCACTGGACACGAAACAGCAGATTCTTCAACATCGCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_015090 (NFASC)200367 - 566
NM_001160333 (NFASC)200367 - 566
NM_001005389 (NFASC)218367 - 584
NM_001005388 (NFASC)218367 - 584
NM_001160332 (NFASC)200367 - 566
NM_001160331 (NFASC)200129 - 328
Exon 3 To Exon 6 (Pair 6)
Forward (368,20)TTCCTCCTCTGCCTCCTCAGAmplicon SizecDNA: 220 bpgenomic: 9,877
Reverse (587,22)CCTTGGCGATGTTGAAGAATCTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol in 3' area
Forward Dimers0.091 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATT
CAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTG
GACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTC
CACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)202368 - 569
NM_001160331 (NFASC)202130 - 331
NM_001005388 (NFASC)220368 - 587
NM_001005389 (NFASC)220368 - 587
NM_001160333 (NFASC)202368 - 569
NM_015090 (NFASC)202368 - 569
Exon 3 To Exon 6 (Pair 7)
Forward (365,19)GCCTTCCTCCTCTGCCTCCAmplicon SizecDNA: 215 bpgenomic: 9,872
Reverse (579,23)ATGTTGAAGAATCTGCTGTTTCGNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.397 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceGCCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGC
ATTCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATC
GTGGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGC
TTCCACTGGACACGAAACAGCAGATTCTTCAACAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160331 (NFASC)197127 - 323
NM_001160332 (NFASC)197365 - 561
NM_001160333 (NFASC)197365 - 561
NM_015090 (NFASC)197365 - 561
NM_001005388 (NFASC)215365 - 579
NM_001005389 (NFASC)215365 - 579
Exon 3 To Exon 6 (Pair 8)
Forward (369,20)TCCTCCTCTGCCTCCTCAGTAmplicon SizecDNA: 222 bpgenomic: 9,879
Reverse (590,21)GGTCCTTGGCGATGTTGAAGANr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTC
AGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGG
ACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCC
ACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_015090 (NFASC)204369 - 572
NM_001160333 (NFASC)204369 - 572
NM_001005389 (NFASC)222369 - 590
NM_001005388 (NFASC)222369 - 590
NM_001160332 (NFASC)204369 - 572
NM_001160331 (NFASC)204131 - 334
Exon 3 To Exon 6 (Pair 9)
Forward (369,20)TCCTCCTCTGCCTCCTCAGTAmplicon SizecDNA: 220 bpgenomic: 9,877
Reverse (588,22)TCCTTGGCGATGTTGAAGAATCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTC
AGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGG
ACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCC
ACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)202369 - 570
NM_001160331 (NFASC)202131 - 332
NM_001005388 (NFASC)220369 - 588
NM_001005389 (NFASC)220369 - 588
NM_001160333 (NFASC)202369 - 570
NM_015090 (NFASC)202369 - 570
Exon 3 To Exon 6 (Pair 10)
Forward (371,20)CTCCTCTGCCTCCTCAGTCTAmplicon SizecDNA: 212 bpgenomic: 9,869
Reverse (582,22)GCGATGTTGAAGAATCTGCTGTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTCAG
AATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGGAC
CCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCCAC
TGGACACGAAACAGCAGATTCTTCAACATCGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)194371 - 564
NM_001160331 (NFASC)194133 - 326
NM_015090 (NFASC)194371 - 564
NM_001160333 (NFASC)194371 - 564
NM_001005389 (NFASC)212371 - 582
NM_001005388 (NFASC)212371 - 582
Exon 3 To Exon 6 (Pair 11)
Forward (371,20)CTCCTCTGCCTCCTCAGTCTAmplicon SizecDNA: 216 bpgenomic: 9,873
Reverse (586,22)CTTGGCGATGTTGAAGAATCTGNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTCAG
AATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGGAC
CCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCCAC
TGGACACGAAACAGCAGATTCTTCAACATCGCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)198371 - 568
NM_001160331 (NFASC)198133 - 330
NM_001005389 (NFASC)216371 - 586
NM_001005388 (NFASC)216371 - 586
NM_015090 (NFASC)198371 - 568
NM_001160333 (NFASC)198371 - 568
Exon 3 To Exon 6 (Pair 12)
Forward (365,19)GCCTTCCTCCTCTGCCTCCAmplicon SizecDNA: 217 bpgenomic: 9,874
Reverse (581,23)CGATGTTGAAGAATCTGCTGTTTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.397 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceGCCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGC
ATTCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATC
GTGGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGC
TTCCACTGGACACGAAACAGCAGATTCTTCAACATCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001005389 (NFASC)217365 - 581
NM_001005388 (NFASC)217365 - 581
NM_015090 (NFASC)199365 - 563
NM_001160333 (NFASC)199365 - 563
NM_001160331 (NFASC)199127 - 325
NM_001160332 (NFASC)199365 - 563
Exon 3 To Exon 6 (Pair 13)
Forward (367,20)CTTCCTCCTCTGCCTCCTCAAmplicon SizecDNA: 220 bpgenomic: 9,877
Reverse (586,22)CTTGGCGATGTTGAAGAATCTGNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.797 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCAT
TCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGT
GGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTT
CCACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160331 (NFASC)202129 - 330
NM_001160332 (NFASC)202367 - 568
NM_001005389 (NFASC)220367 - 586
NM_001005388 (NFASC)220367 - 586
NM_015090 (NFASC)202367 - 568
NM_001160333 (NFASC)202367 - 568
Exon 3 To Exon 6 (Pair 14)
Forward (369,20)TCCTCCTCTGCCTCCTCAGTAmplicon SizecDNA: 217 bpgenomic: 9,874
Reverse (585,22)TTGGCGATGTTGAAGAATCTGCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTC
AGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGG
ACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCC
ACTGGACACGAAACAGCAGATTCTTCAACATCGCCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001005389 (NFASC)217369 - 585
NM_001005388 (NFASC)217369 - 585
NM_015090 (NFASC)199369 - 567
NM_001160333 (NFASC)199369 - 567
NM_001160331 (NFASC)199131 - 329
NM_001160332 (NFASC)199369 - 567
Exon 3 To Exon 6 (Pair 15)
Forward (367,20)CTTCCTCCTCTGCCTCCTCAAmplicon SizecDNA: 221 bpgenomic: 9,878
Reverse (587,22)CCTTGGCGATGTTGAAGAATCTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.797 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCAT
TCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGT
GGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTT
CCACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_015090 (NFASC)203367 - 569
NM_001160333 (NFASC)203367 - 569
NM_001005389 (NFASC)221367 - 587
NM_001005388 (NFASC)221367 - 587
NM_001160331 (NFASC)203129 - 331
NM_001160332 (NFASC)203367 - 569
Exon 3 To Exon 6 (Pair 16)
Forward (367,20)CTTCCTCCTCTGCCTCCTCAAmplicon SizecDNA: 216 bpgenomic: 9,873
Reverse (582,22)GCGATGTTGAAGAATCTGCTGTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.797 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.1 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCAT
TCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGT
GGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTT
CCACTGGACACGAAACAGCAGATTCTTCAACATCGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160331 (NFASC)198129 - 326
NM_001160332 (NFASC)198367 - 564
NM_001160333 (NFASC)198367 - 564
NM_015090 (NFASC)198367 - 564
NM_001005388 (NFASC)216367 - 582
NM_001005389 (NFASC)216367 - 582
Exon 3 To Exon 6 (Pair 17)
Forward (367,20)CTTCCTCCTCTGCCTCCTCAAmplicon SizecDNA: 219 bpgenomic: 9,876
Reverse (585,22)TTGGCGATGTTGAAGAATCTGCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.797 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCAT
TCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGT
GGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTT
CCACTGGACACGAAACAGCAGATTCTTCAACATCGCCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160331 (NFASC)201129 - 329
NM_001160332 (NFASC)201367 - 567
NM_001005389 (NFASC)219367 - 585
NM_001005388 (NFASC)219367 - 585
NM_015090 (NFASC)201367 - 567
NM_001160333 (NFASC)201367 - 567
Exon 3 To Exon 6 (Pair 18)
Forward (367,20)CTTCCTCCTCTGCCTCCTCAAmplicon SizecDNA: 215 bpgenomic: 9,872
Reverse (581,23)CGATGTTGAAGAATCTGCTGTTTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.797 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-1.1 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCAT
TCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGT
GGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTT
CCACTGGACACGAAACAGCAGATTCTTCAACATCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160331 (NFASC)197129 - 325
NM_001160332 (NFASC)197367 - 563
NM_001005388 (NFASC)215367 - 581
NM_001005389 (NFASC)215367 - 581
NM_001160333 (NFASC)197367 - 563
NM_015090 (NFASC)197367 - 563
Exon 3 To Exon 6 (Pair 19)
Forward (371,20)CTCCTCTGCCTCCTCAGTCTAmplicon SizecDNA: 209 bpgenomic: 9,866
Reverse (579,23)ATGTTGAAGAATCTGCTGTTTCGNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTCAG
AATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGGAC
CCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCCAC
TGGACACGAAACAGCAGATTCTTCAACAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001005389 (NFASC)209371 - 579
NM_001005388 (NFASC)209371 - 579
NM_015090 (NFASC)191371 - 561
NM_001160333 (NFASC)191371 - 561
NM_001160331 (NFASC)191133 - 323
NM_001160332 (NFASC)191371 - 561
Exon 3 To Exon 6 (Pair 20)
Forward (367,20)CTTCCTCCTCTGCCTCCTCAAmplicon SizecDNA: 223 bpgenomic: 9,880
Reverse (589,22)GTCCTTGGCGATGTTGAAGAATNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.797 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCAT
TCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGT
GGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTT
CCACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001005389 (NFASC)223367 - 589
NM_001005388 (NFASC)223367 - 589
NM_015090 (NFASC)205367 - 571
NM_001160333 (NFASC)205367 - 571
NM_001160332 (NFASC)205367 - 571
NM_001160331 (NFASC)205129 - 333
Exon 3 To Exon 6 (Pair 21)
Forward (369,20)TCCTCCTCTGCCTCCTCAGTAmplicon SizecDNA: 212 bpgenomic: 9,869
Reverse (580,23)GATGTTGAAGAATCTGCTGTTTCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTC
AGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGG
ACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCC
ACTGGACACGAAACAGCAGATTCTTCAACATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160333 (NFASC)194369 - 562
NM_015090 (NFASC)194369 - 562
NM_001005388 (NFASC)212369 - 580
NM_001005389 (NFASC)212369 - 580
NM_001160331 (NFASC)194131 - 324
NM_001160332 (NFASC)194369 - 562
Exon 3 To Exon 6 (Pair 22)
Forward (369,20)TCCTCCTCTGCCTCCTCAGTAmplicon SizecDNA: 214 bpgenomic: 9,871
Reverse (582,22)GCGATGTTGAAGAATCTGCTGTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTC
AGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGG
ACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCC
ACTGGACACGAAACAGCAGATTCTTCAACATCGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001005388 (NFASC)214369 - 582
NM_001005389 (NFASC)214369 - 582
NM_001160333 (NFASC)196369 - 564
NM_015090 (NFASC)196369 - 564
NM_001160332 (NFASC)196369 - 564
NM_001160331 (NFASC)196131 - 326
Exon 3 To Exon 6 (Pair 23)
Forward (368,20)TTCCTCCTCTGCCTCCTCAGAmplicon SizecDNA: 219 bpgenomic: 9,876
Reverse (586,22)CTTGGCGATGTTGAAGAATCTGNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol in 3' area
Forward Dimers0.091 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATT
CAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTG
GACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTC
CACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_015090 (NFASC)201368 - 568
NM_001160333 (NFASC)201368 - 568
NM_001005389 (NFASC)219368 - 586
NM_001005388 (NFASC)219368 - 586
NM_001160331 (NFASC)201130 - 330
NM_001160332 (NFASC)201368 - 568
Exon 3 To Exon 6 (Pair 24)
Forward (368,20)TTCCTCCTCTGCCTCCTCAGAmplicon SizecDNA: 223 bpgenomic: 9,880
Reverse (590,21)GGTCCTTGGCGATGTTGAAGANr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol in 3' area
Forward Dimers0.091 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATT
CAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTG
GACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTC
CACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160331 (NFASC)205130 - 334
NM_001160332 (NFASC)205368 - 572
NM_015090 (NFASC)205368 - 572
NM_001160333 (NFASC)205368 - 572
NM_001005389 (NFASC)223368 - 590
NM_001005388 (NFASC)223368 - 590
Exon 3 To Exon 6 (Pair 25)
Forward (368,20)TTCCTCCTCTGCCTCCTCAGAmplicon SizecDNA: 213 bpgenomic: 9,870
Reverse (580,23)GATGTTGAAGAATCTGCTGTTTCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol in 3' area
Forward Dimers0.091 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATT
CAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTG
GACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTC
CACTGGACACGAAACAGCAGATTCTTCAACATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_015090 (NFASC)195368 - 562
NM_001160333 (NFASC)195368 - 562
NM_001005389 (NFASC)213368 - 580
NM_001005388 (NFASC)213368 - 580
NM_001160331 (NFASC)195130 - 324
NM_001160332 (NFASC)195368 - 562
Exon 3 To Exon 6 (Pair 26)
Forward (371,20)CTCCTCTGCCTCCTCAGTCTAmplicon SizecDNA: 219 bpgenomic: 9,876
Reverse (589,22)GTCCTTGGCGATGTTGAAGAATNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTCAG
AATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGGAC
CCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCCAC
TGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_015090 (NFASC)201371 - 571
NM_001160333 (NFASC)201371 - 571
NM_001005389 (NFASC)219371 - 589
NM_001005388 (NFASC)219371 - 589
NM_001160332 (NFASC)201371 - 571
NM_001160331 (NFASC)201133 - 333
Exon 3 To Exon 6 (Pair 27)
Forward (368,20)TTCCTCCTCTGCCTCCTCAGAmplicon SizecDNA: 222 bpgenomic: 9,879
Reverse (589,22)GTCCTTGGCGATGTTGAAGAATNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol in 3' area
Forward Dimers0.091 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATT
CAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTG
GACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTC
CACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)204368 - 571
NM_001160331 (NFASC)204130 - 333
NM_001005388 (NFASC)222368 - 589
NM_001005389 (NFASC)222368 - 589
NM_001160333 (NFASC)204368 - 571
NM_015090 (NFASC)204368 - 571
Exon 3 To Exon 6 (Pair 28)
Forward (368,20)TTCCTCCTCTGCCTCCTCAGAmplicon SizecDNA: 217 bpgenomic: 9,874
Reverse (584,22)TGGCGATGTTGAAGAATCTGCTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol in 3' area
Forward Dimers0.091 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATT
CAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTG
GACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTC
CACTGGACACGAAACAGCAGATTCTTCAACATCGCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_015090 (NFASC)199368 - 566
NM_001160333 (NFASC)199368 - 566
NM_001005389 (NFASC)217368 - 584
NM_001005388 (NFASC)217368 - 584
NM_001160331 (NFASC)199130 - 328
NM_001160332 (NFASC)199368 - 566
Exon 3 To Exon 6 (Pair 29)
Forward (367,20)CTTCCTCCTCTGCCTCCTCAAmplicon SizecDNA: 214 bpgenomic: 9,871
Reverse (580,23)GATGTTGAAGAATCTGCTGTTTCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.797 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-1.1 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCAT
TCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGT
GGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTT
CCACTGGACACGAAACAGCAGATTCTTCAACATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001005389 (NFASC)214367 - 580
NM_001005388 (NFASC)214367 - 580
NM_015090 (NFASC)196367 - 562
NM_001160333 (NFASC)196367 - 562
NM_001160331 (NFASC)196129 - 324
NM_001160332 (NFASC)196367 - 562
Exon 3 To Exon 6 (Pair 30)
Forward (368,20)TTCCTCCTCTGCCTCCTCAGAmplicon SizecDNA: 221 bpgenomic: 9,878
Reverse (588,22)TCCTTGGCGATGTTGAAGAATCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol in 3' area
Forward Dimers0.091 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATT
CAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTG
GACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTC
CACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160331 (NFASC)203130 - 332
NM_001160332 (NFASC)203368 - 570
NM_001005388 (NFASC)221368 - 588
NM_001005389 (NFASC)221368 - 588
NM_001160333 (NFASC)203368 - 570
NM_015090 (NFASC)203368 - 570
Exon 3 To Exon 6 (Pair 31)
Forward (367,20)CTTCCTCCTCTGCCTCCTCAAmplicon SizecDNA: 224 bpgenomic: 9,881
Reverse (590,21)GGTCCTTGGCGATGTTGAAGANr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.797 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCAT
TCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGT
GGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTT
CCACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160331 (NFASC)206129 - 334
NM_001160332 (NFASC)206367 - 572
NM_001005388 (NFASC)224367 - 590
NM_001005389 (NFASC)224367 - 590
NM_001160333 (NFASC)206367 - 572
NM_015090 (NFASC)206367 - 572
Exon 3 To Exon 6 (Pair 32)
Forward (368,20)TTCCTCCTCTGCCTCCTCAGAmplicon SizecDNA: 212 bpgenomic: 9,869
Reverse (579,23)ATGTTGAAGAATCTGCTGTTTCGNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol in 3' area
Forward Dimers0.091 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATT
CAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTG
GACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTC
CACTGGACACGAAACAGCAGATTCTTCAACAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160333 (NFASC)194368 - 561
NM_015090 (NFASC)194368 - 561
NM_001005388 (NFASC)212368 - 579
NM_001005389 (NFASC)212368 - 579
NM_001160331 (NFASC)194130 - 323
NM_001160332 (NFASC)194368 - 561
Exon 3 To Exon 6 (Pair 33)
Forward (371,20)CTCCTCTGCCTCCTCAGTCTAmplicon SizecDNA: 218 bpgenomic: 9,875
Reverse (588,22)TCCTTGGCGATGTTGAAGAATCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTCAG
AATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGGAC
CCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCCAC
TGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160331 (NFASC)200133 - 332
NM_001160332 (NFASC)200371 - 570
NM_001160333 (NFASC)200371 - 570
NM_015090 (NFASC)200371 - 570
NM_001005388 (NFASC)218371 - 588
NM_001005389 (NFASC)218371 - 588
Exon 3 To Exon 6 (Pair 34)
Forward (367,20)CTTCCTCCTCTGCCTCCTCAAmplicon SizecDNA: 222 bpgenomic: 9,879
Reverse (588,22)TCCTTGGCGATGTTGAAGAATCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.797 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCAT
TCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGT
GGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTT
CCACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160331 (NFASC)204129 - 332
NM_001160332 (NFASC)204367 - 570
NM_001005388 (NFASC)222367 - 588
NM_001005389 (NFASC)222367 - 588
NM_001160333 (NFASC)204367 - 570
NM_015090 (NFASC)204367 - 570
Exon 3 To Exon 6 (Pair 35)
Forward (371,20)CTCCTCTGCCTCCTCAGTCTAmplicon SizecDNA: 217 bpgenomic: 9,874
Reverse (587,22)CCTTGGCGATGTTGAAGAATCTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTCAG
AATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGGAC
CCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCCAC
TGGACACGAAACAGCAGATTCTTCAACATCGCCAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)199371 - 569
NM_001160331 (NFASC)199133 - 331
NM_001005389 (NFASC)217371 - 587
NM_001005388 (NFASC)217371 - 587
NM_015090 (NFASC)199371 - 569
NM_001160333 (NFASC)199371 - 569
Exon 3 To Exon 6 (Pair 36)
Forward (368,20)TTCCTCCTCTGCCTCCTCAGAmplicon SizecDNA: 215 bpgenomic: 9,872
Reverse (582,22)GCGATGTTGAAGAATCTGCTGTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol in 3' area
Forward Dimers0.091 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATT
CAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTG
GACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTC
CACTGGACACGAAACAGCAGATTCTTCAACATCGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160331 (NFASC)197130 - 326
NM_001160332 (NFASC)197368 - 564
NM_001005389 (NFASC)215368 - 582
NM_001005388 (NFASC)215368 - 582
NM_015090 (NFASC)197368 - 564
NM_001160333 (NFASC)197368 - 564
Exon 3 To Exon 6 (Pair 37)
Forward (369,20)TCCTCCTCTGCCTCCTCAGTAmplicon SizecDNA: 216 bpgenomic: 9,873
Reverse (584,22)TGGCGATGTTGAAGAATCTGCTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTC
AGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGG
ACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCC
ACTGGACACGAAACAGCAGATTCTTCAACATCGCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001005388 (NFASC)216369 - 584
NM_001005389 (NFASC)216369 - 584
NM_001160333 (NFASC)198369 - 566
NM_015090 (NFASC)198369 - 566
NM_001160332 (NFASC)198369 - 566
NM_001160331 (NFASC)198131 - 328
Exon 3 To Exon 6 (Pair 38)
Forward (365,19)GCCTTCCTCCTCTGCCTCCAmplicon SizecDNA: 216 bpgenomic: 9,873
Reverse (580,23)GATGTTGAAGAATCTGCTGTTTCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.397 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceGCCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGC
ATTCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATC
GTGGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGC
TTCCACTGGACACGAAACAGCAGATTCTTCAACATC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)198365 - 562
NM_001160331 (NFASC)198127 - 324
NM_001005388 (NFASC)216365 - 580
NM_001005389 (NFASC)216365 - 580
NM_001160333 (NFASC)198365 - 562
NM_015090 (NFASC)198365 - 562
Exon 3 To Exon 6 (Pair 39)
Forward (368,20)TTCCTCCTCTGCCTCCTCAGAmplicon SizecDNA: 218 bpgenomic: 9,875
Reverse (585,22)TTGGCGATGTTGAAGAATCTGCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol in 3' area
Forward Dimers0.091 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATT
CAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTG
GACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTC
CACTGGACACGAAACAGCAGATTCTTCAACATCGCCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001005389 (NFASC)218368 - 585
NM_001005388 (NFASC)218368 - 585
NM_015090 (NFASC)200368 - 567
NM_001160333 (NFASC)200368 - 567
NM_001160331 (NFASC)200130 - 329
NM_001160332 (NFASC)200368 - 567
Exon 3 To Exon 6 (Pair 40)
Forward (371,20)CTCCTCTGCCTCCTCAGTCTAmplicon SizecDNA: 215 bpgenomic: 9,872
Reverse (585,22)TTGGCGATGTTGAAGAATCTGCNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTCAG
AATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGGAC
CCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCCAC
TGGACACGAAACAGCAGATTCTTCAACATCGCCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001005388 (NFASC)215371 - 585
NM_001005389 (NFASC)215371 - 585
NM_001160333 (NFASC)197371 - 567
NM_015090 (NFASC)197371 - 567
NM_001160331 (NFASC)197133 - 329
NM_001160332 (NFASC)197371 - 567
Exon 3 To Exon 6 (Pair 41)
Forward (369,20)TCCTCCTCTGCCTCCTCAGTAmplicon SizecDNA: 213 bpgenomic: 9,870
Reverse (581,23)CGATGTTGAAGAATCTGCTGTTTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTC
AGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGG
ACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCC
ACTGGACACGAAACAGCAGATTCTTCAACATCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)195369 - 563
NM_001160331 (NFASC)195131 - 325
NM_001005388 (NFASC)213369 - 581
NM_001005389 (NFASC)213369 - 581
NM_001160333 (NFASC)195369 - 563
NM_015090 (NFASC)195369 - 563
Exon 3 To Exon 6 (Pair 42)
Forward (371,20)CTCCTCTGCCTCCTCAGTCTAmplicon SizecDNA: 211 bpgenomic: 9,868
Reverse (581,23)CGATGTTGAAGAATCTGCTGTTTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-0.844 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTCAG
AATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGGAC
CCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCCAC
TGGACACGAAACAGCAGATTCTTCAACATCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001005389 (NFASC)211371 - 581
NM_001005388 (NFASC)211371 - 581
NM_015090 (NFASC)193371 - 563
NM_001160333 (NFASC)193371 - 563
NM_001160331 (NFASC)193133 - 325
NM_001160332 (NFASC)193371 - 563
Exon 3 To Exon 6 (Pair 43)
Forward (371,20)CTCCTCTGCCTCCTCAGTCTAmplicon SizecDNA: 214 bpgenomic: 9,871
Reverse (584,22)TGGCGATGTTGAAGAATCTGCTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTCAG
AATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGGAC
CCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCCAC
TGGACACGAAACAGCAGATTCTTCAACATCGCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_015090 (NFASC)196371 - 566
NM_001160333 (NFASC)196371 - 566
NM_001005389 (NFASC)214371 - 584
NM_001005388 (NFASC)214371 - 584
NM_001160332 (NFASC)196371 - 566
NM_001160331 (NFASC)196133 - 328
Exon 3 To Exon 6 (Pair 44)
Forward (371,20)CTCCTCTGCCTCCTCAGTCTAmplicon SizecDNA: 220 bpgenomic: 9,877
Reverse (590,21)GGTCCTTGGCGATGTTGAAGANr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTCAG
AATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGGAC
CCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCCAC
TGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_015090 (NFASC)202371 - 572
NM_001160333 (NFASC)202371 - 572
NM_001005389 (NFASC)220371 - 590
NM_001005388 (NFASC)220371 - 590
NM_001160332 (NFASC)202371 - 572
NM_001160331 (NFASC)202133 - 334
Exon 3 To Exon 6 (Pair 45)
Forward (369,20)TCCTCCTCTGCCTCCTCAGTAmplicon SizecDNA: 221 bpgenomic: 9,878
Reverse (589,22)GTCCTTGGCGATGTTGAAGAATNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTC
AGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGG
ACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCC
ACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAGGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)203369 - 571
NM_001160331 (NFASC)203131 - 333
NM_015090 (NFASC)203369 - 571
NM_001160333 (NFASC)203369 - 571
NM_001005389 (NFASC)221369 - 589
NM_001005388 (NFASC)221369 - 589
Exon 3 To Exon 6 (Pair 46)
Forward (369,20)TCCTCCTCTGCCTCCTCAGTAmplicon SizecDNA: 218 bpgenomic: 9,875
Reverse (586,22)CTTGGCGATGTTGAAGAATCTGNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers0.063 kcal/mol in 3' area
Reverse Loops1.757 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.831 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCATTC
AGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGTGG
ACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTTCC
ACTGGACACGAAACAGCAGATTCTTCAACATCGCCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)200369 - 568
NM_001160331 (NFASC)200131 - 330
NM_001160333 (NFASC)200369 - 568
NM_015090 (NFASC)200369 - 568
NM_001005388 (NFASC)218369 - 586
NM_001005389 (NFASC)218369 - 586
Exon 3 To Exon 6 (Pair 47)
Forward (367,20)CTTCCTCCTCTGCCTCCTCAAmplicon SizecDNA: 213 bpgenomic: 9,870
Reverse (579,23)ATGTTGAAGAATCTGCTGTTTCGNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.797 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.316 kcal/mol
Forward-Reverse Dimers-1.1 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGCAT
TCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATCGT
GGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGCTT
CCACTGGACACGAAACAGCAGATTCTTCAACAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001005388 (NFASC)213367 - 579
NM_001005389 (NFASC)213367 - 579
NM_001160333 (NFASC)195367 - 561
NM_015090 (NFASC)195367 - 561
NM_001160331 (NFASC)195129 - 323
NM_001160332 (NFASC)195367 - 561
Exon 3 To Exon 6 (Pair 48)
Forward (365,19)GCCTTCCTCCTCTGCCTCCAmplicon SizecDNA: 218 bpgenomic: 9,875
Reverse (582,22)GCGATGTTGAAGAATCTGCTGTNr. of Isoforms 2 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops2.397 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops1.869 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.311 kcal/mol
Amplicon Folding-2.876 kcal/mol outside primersite
Amplicon SequenceGCCTTCCTCCTCTGCCTCCTCAGTCTTGGCGGAGCCATCGAAATTCCTATGGATCCAAGC
ATTCAGAATGAGCTGACGCAGCCGCCAACCATCACCAAGCAGTCAGCGAAGGATCACATC
GTGGACCCCCGTGATAACATCCTGATTGAGTGTGAAGCAAAAGGGAACCCTGCCCCCAGC
TTCCACTGGACACGAAACAGCAGATTCTTCAACATCGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001160332 (NFASC)200365 - 564
NM_001160331 (NFASC)200127 - 326
NM_001005388 (NFASC)218365 - 582
NM_001005389 (NFASC)218365 - 582
NM_001160333 (NFASC)200365 - 564
NM_015090 (NFASC)200365 - 564
Exon 6 To Exon 8 (Pair 1)
Forward (675,20)ATCAGTGCTTCGCCCGCAACAmplicon SizecDNA: 266 bpgenomic: 3,414
Reverse (940,22)CAGCATCACGTTGGAGAAGTATNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops1.965 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceATCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGG
TGTCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCG
CTCCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGA
TGAGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAG
ACCTATACTTCTCCAACGTGATGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)266657 - 922
NM_001005389 (NFASC)266675 - 940
NM_001160331 (NFASC)266419 - 684
NM_001005388 (NFASC)266675 - 940
NM_015090 (NFASC)266657 - 922
NM_001160333 (NFASC)266657 - 922
Exon 6 To Exon 8 (Pair 2)
Forward (678,21)AGTGCTTCGCCCGCAACAAATAmplicon SizecDNA: 265 bpgenomic: 3,413
Reverse (942,21)TGCAGCATCACGTTGGAGAAGNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.348 kcal/mol
Reverse Loops1.88 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGT
CTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTC
CTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGA
GCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACC
TATACTTCTCCAACGTGATGCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)265660 - 924
NM_001160331 (NFASC)265422 - 686
NM_001005388 (NFASC)265678 - 942
NM_001005389 (NFASC)265678 - 942
NM_001160333 (NFASC)265660 - 924
NM_015090 (NFASC)265660 - 924
Exon 6 To Exon 8 (Pair 3)
Forward (679,21)GTGCTTCGCCCGCAACAAATTAmplicon SizecDNA: 255 bpgenomic: 3,403
Reverse (933,22)ACGTTGGAGAAGTATAGGTCTCNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.348 kcal/mol
Reverse Loops1.572 kcal/mol in 3' area
Reverse Dimers-1.942 kcal/mol
Forward-Reverse Dimers-1.936 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGTC
TAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTCC
TTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGAG
CAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACCT
ATACTTCTCCAACGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160331 (NFASC)255423 - 677
NM_001160332 (NFASC)255661 - 915
NM_015090 (NFASC)255661 - 915
NM_001160333 (NFASC)255661 - 915
NM_001005389 (NFASC)255679 - 933
NM_001005388 (NFASC)255679 - 933
Exon 6 To Exon 8 (Pair 4)
Forward (675,20)ATCAGTGCTTCGCCCGCAACAmplicon SizecDNA: 259 bpgenomic: 3,407
Reverse (933,22)ACGTTGGAGAAGTATAGGTCTCNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops1.572 kcal/mol in 3' area
Reverse Dimers-1.942 kcal/mol
Forward-Reverse Dimers-1.936 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceATCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGG
TGTCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCG
CTCCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGA
TGAGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAG
ACCTATACTTCTCCAACGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)259657 - 915
NM_001160333 (NFASC)259657 - 915
NM_001005389 (NFASC)259675 - 933
NM_001005388 (NFASC)259675 - 933
NM_001160332 (NFASC)259657 - 915
NM_001160331 (NFASC)259419 - 677
Exon 6 To Exon 8 (Pair 5)
Forward (676,20)TCAGTGCTTCGCCCGCAACAAmplicon SizecDNA: 267 bpgenomic: 3,415
Reverse (942,21)TGCAGCATCACGTTGGAGAAGNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops1.88 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceTCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGT
GTCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGC
TCCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGAT
GAGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGA
CCTATACTTCTCCAACGTGATGCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160331 (NFASC)267420 - 686
NM_001160332 (NFASC)267658 - 924
NM_001005388 (NFASC)267676 - 942
NM_001005389 (NFASC)267676 - 942
NM_001160333 (NFASC)267658 - 924
NM_015090 (NFASC)267658 - 924
Exon 6 To Exon 8 (Pair 6)
Forward (675,20)ATCAGTGCTTCGCCCGCAACAmplicon SizecDNA: 269 bpgenomic: 3,417
Reverse (943,21)CTGCAGCATCACGTTGGAGAANr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops0.581 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceATCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGG
TGTCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCG
CTCCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGA
TGAGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAG
ACCTATACTTCTCCAACGTGATGCTGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001005388 (NFASC)269675 - 943
NM_001005389 (NFASC)269675 - 943
NM_001160333 (NFASC)269657 - 925
NM_015090 (NFASC)269657 - 925
NM_001160332 (NFASC)269657 - 925
NM_001160331 (NFASC)269419 - 687
Exon 6 To Exon 8 (Pair 7)
Forward (678,21)AGTGCTTCGCCCGCAACAAATAmplicon SizecDNA: 258 bpgenomic: 3,406
Reverse (935,22)TCACGTTGGAGAAGTATAGGTCNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.348 kcal/mol
Reverse Loops1.965 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.936 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGT
CTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTC
CTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGA
GCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACC
TATACTTCTCCAACGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)258660 - 917
NM_001160333 (NFASC)258660 - 917
NM_001005389 (NFASC)258678 - 935
NM_001005388 (NFASC)258678 - 935
NM_001160331 (NFASC)258422 - 679
NM_001160332 (NFASC)258660 - 917
Exon 6 To Exon 8 (Pair 8)
Forward (678,21)AGTGCTTCGCCCGCAACAAATAmplicon SizecDNA: 264 bpgenomic: 3,412
Reverse (941,21)GCAGCATCACGTTGGAGAAGTNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.348 kcal/mol
Reverse Loops1.88 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGT
CTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTC
CTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGA
GCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACC
TATACTTCTCCAACGTGATGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001005389 (NFASC)264678 - 941
NM_001005388 (NFASC)264678 - 941
NM_015090 (NFASC)264660 - 923
NM_001160333 (NFASC)264660 - 923
NM_001160332 (NFASC)264660 - 923
NM_001160331 (NFASC)264422 - 685
Exon 6 To Exon 8 (Pair 9)
Forward (692,21)AACAAATTTGGCACGGCCCTGAmplicon SizecDNA: 252 bpgenomic: 3,400
Reverse (943,21)CTGCAGCATCACGTTGGAGAANr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops0.395 kcal/mol in 3' area
Forward Dimers-2.774 kcal/mol
Reverse Loops0.581 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.084 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGTCTAAATCTCCTCTG
TGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTCCTTTGACGCTCCAG
TGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGAGCAGCTCCATGGAG
CCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACCTATACTTCTCCAAC
GTGATGCTGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)252674 - 925
NM_001160333 (NFASC)252674 - 925
NM_001005389 (NFASC)252692 - 943
NM_001005388 (NFASC)252692 - 943
NM_001160332 (NFASC)252674 - 925
NM_001160331 (NFASC)252436 - 687
Exon 6 To Exon 8 (Pair 10)
Forward (672,21)AATATCAGTGCTTCGCCCGCAAmplicon SizecDNA: 269 bpgenomic: 3,417
Reverse (940,22)CAGCATCACGTTGGAGAAGTATNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.575 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops1.965 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAATATCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGC
AGGTGTCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGG
GCGCTCCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCT
GGATGAGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACG
GAGACCTATACTTCTCCAACGTGATGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160331 (NFASC)269416 - 684
NM_001160332 (NFASC)269654 - 922
NM_015090 (NFASC)269654 - 922
NM_001160333 (NFASC)269654 - 922
NM_001005389 (NFASC)269672 - 940
NM_001005388 (NFASC)269672 - 940
Exon 6 To Exon 8 (Pair 11)
Forward (677,20)CAGTGCTTCGCCCGCAACAAAmplicon SizecDNA: 240 bpgenomic: 3,388
Reverse (916,20)GTCTCCGTTATGGCCCTGAGNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops0.83 kcal/mol
Reverse Dimers-2.544 kcal/mol
Forward-Reverse Dimers-1.44 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTG
TCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCT
CCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATG
AGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160331 (NFASC)240421 - 660
NM_001160332 (NFASC)240659 - 898
NM_001160333 (NFASC)240659 - 898
NM_015090 (NFASC)240659 - 898
NM_001005388 (NFASC)240677 - 916
NM_001005389 (NFASC)240677 - 916
Exon 6 To Exon 8 (Pair 12)
Forward (692,21)AACAAATTTGGCACGGCCCTGAmplicon SizecDNA: 243 bpgenomic: 3,391
Reverse (934,22)CACGTTGGAGAAGTATAGGTCTNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops0.395 kcal/mol in 3' area
Forward Dimers-2.774 kcal/mol
Reverse Loops1.965 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.084 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGTCTAAATCTCCTCTG
TGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTCCTTTGACGCTCCAG
TGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGAGCAGCTCCATGGAG
CCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACCTATACTTCTCCAAC
GTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)243674 - 916
NM_001160333 (NFASC)243674 - 916
NM_001005389 (NFASC)243692 - 934
NM_001005388 (NFASC)243692 - 934
NM_001160331 (NFASC)243436 - 678
NM_001160332 (NFASC)243674 - 916
Exon 6 To Exon 8 (Pair 13)
Forward (692,21)AACAAATTTGGCACGGCCCTGAmplicon SizecDNA: 246 bpgenomic: 3,394
Reverse (937,22)CATCACGTTGGAGAAGTATAGGNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops0.395 kcal/mol in 3' area
Forward Dimers-2.774 kcal/mol
Reverse Loops1.965 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.084 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGTCTAAATCTCCTCTG
TGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTCCTTTGACGCTCCAG
TGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGAGCAGCTCCATGGAG
CCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACCTATACTTCTCCAAC
GTGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160333 (NFASC)246674 - 919
NM_015090 (NFASC)246674 - 919
NM_001005388 (NFASC)246692 - 937
NM_001005389 (NFASC)246692 - 937
NM_001160331 (NFASC)246436 - 681
NM_001160332 (NFASC)246674 - 919
Exon 6 To Exon 8 (Pair 14)
Forward (676,20)TCAGTGCTTCGCCCGCAACAAmplicon SizecDNA: 258 bpgenomic: 3,406
Reverse (933,22)ACGTTGGAGAAGTATAGGTCTCNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops1.572 kcal/mol in 3' area
Reverse Dimers-1.942 kcal/mol
Forward-Reverse Dimers-1.936 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceTCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGT
GTCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGC
TCCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGAT
GAGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGA
CCTATACTTCTCCAACGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)258658 - 915
NM_001160333 (NFASC)258658 - 915
NM_001005389 (NFASC)258676 - 933
NM_001005388 (NFASC)258676 - 933
NM_001160332 (NFASC)258658 - 915
NM_001160331 (NFASC)258420 - 677
Exon 6 To Exon 8 (Pair 15)
Forward (677,20)CAGTGCTTCGCCCGCAACAAAmplicon SizecDNA: 259 bpgenomic: 3,407
Reverse (935,22)TCACGTTGGAGAAGTATAGGTCNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops1.965 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.936 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTG
TCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCT
CCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATG
AGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGAC
CTATACTTCTCCAACGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160333 (NFASC)259659 - 917
NM_015090 (NFASC)259659 - 917
NM_001005388 (NFASC)259677 - 935
NM_001005389 (NFASC)259677 - 935
NM_001160332 (NFASC)259659 - 917
NM_001160331 (NFASC)259421 - 679
Exon 6 To Exon 8 (Pair 16)
Forward (692,21)AACAAATTTGGCACGGCCCTGAmplicon SizecDNA: 250 bpgenomic: 3,398
Reverse (941,21)GCAGCATCACGTTGGAGAAGTNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops0.395 kcal/mol in 3' area
Forward Dimers-2.774 kcal/mol
Reverse Loops1.88 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.084 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGTCTAAATCTCCTCTG
TGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTCCTTTGACGCTCCAG
TGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGAGCAGCTCCATGGAG
CCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACCTATACTTCTCCAAC
GTGATGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001005388 (NFASC)250692 - 941
NM_001005389 (NFASC)250692 - 941
NM_001160333 (NFASC)250674 - 923
NM_015090 (NFASC)250674 - 923
NM_001160331 (NFASC)250436 - 685
NM_001160332 (NFASC)250674 - 923
Exon 6 To Exon 8 (Pair 17)
Forward (672,21)AATATCAGTGCTTCGCCCGCAAmplicon SizecDNA: 272 bpgenomic: 3,420
Reverse (943,21)CTGCAGCATCACGTTGGAGAANr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.575 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops0.581 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAATATCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGC
AGGTGTCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGG
GCGCTCCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCT
GGATGAGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACG
GAGACCTATACTTCTCCAACGTGATGCTGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160331 (NFASC)272416 - 687
NM_001160332 (NFASC)272654 - 925
NM_001005388 (NFASC)272672 - 943
NM_001005389 (NFASC)272672 - 943
NM_001160333 (NFASC)272654 - 925
NM_015090 (NFASC)272654 - 925
Exon 6 To Exon 8 (Pair 18)
Forward (672,21)AATATCAGTGCTTCGCCCGCAAmplicon SizecDNA: 270 bpgenomic: 3,418
Reverse (941,21)GCAGCATCACGTTGGAGAAGTNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.575 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops1.88 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAATATCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGC
AGGTGTCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGG
GCGCTCCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCT
GGATGAGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACG
GAGACCTATACTTCTCCAACGTGATGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)270654 - 923
NM_001160333 (NFASC)270654 - 923
NM_001005389 (NFASC)270672 - 941
NM_001005388 (NFASC)270672 - 941
NM_001160332 (NFASC)270654 - 923
NM_001160331 (NFASC)270416 - 685
Exon 6 To Exon 8 (Pair 19)
Forward (692,21)AACAAATTTGGCACGGCCCTGAmplicon SizecDNA: 247 bpgenomic: 3,395
Reverse (938,22)GCATCACGTTGGAGAAGTATAGNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops0.395 kcal/mol in 3' area
Forward Dimers-2.774 kcal/mol
Reverse Loops1.965 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.084 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGTCTAAATCTCCTCTG
TGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTCCTTTGACGCTCCAG
TGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGAGCAGCTCCATGGAG
CCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACCTATACTTCTCCAAC
GTGATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160333 (NFASC)247674 - 920
NM_015090 (NFASC)247674 - 920
NM_001005388 (NFASC)247692 - 938
NM_001005389 (NFASC)247692 - 938
NM_001160331 (NFASC)247436 - 682
NM_001160332 (NFASC)247674 - 920
Exon 6 To Exon 8 (Pair 20)
Forward (679,21)GTGCTTCGCCCGCAACAAATTAmplicon SizecDNA: 238 bpgenomic: 3,386
Reverse (916,20)GTCTCCGTTATGGCCCTGAGNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.348 kcal/mol
Reverse Loops0.83 kcal/mol
Reverse Dimers-2.544 kcal/mol
Forward-Reverse Dimers-1.44 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGTC
TAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTCC
TTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGAG
CAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160333 (NFASC)238661 - 898
NM_015090 (NFASC)238661 - 898
NM_001005388 (NFASC)238679 - 916
NM_001005389 (NFASC)238679 - 916
NM_001160331 (NFASC)238423 - 660
NM_001160332 (NFASC)238661 - 898
Exon 6 To Exon 8 (Pair 21)
Forward (676,20)TCAGTGCTTCGCCCGCAACAAmplicon SizecDNA: 268 bpgenomic: 3,416
Reverse (943,21)CTGCAGCATCACGTTGGAGAANr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops0.581 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceTCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGT
GTCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGC
TCCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGAT
GAGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGA
CCTATACTTCTCCAACGTGATGCTGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015090 (NFASC)268658 - 925
NM_001160333 (NFASC)268658 - 925
NM_001005389 (NFASC)268676 - 943
NM_001005388 (NFASC)268676 - 943
NM_001160331 (NFASC)268420 - 687
NM_001160332 (NFASC)268658 - 925
Exon 6 To Exon 8 (Pair 22)
Forward (676,20)TCAGTGCTTCGCCCGCAACAAmplicon SizecDNA: 260 bpgenomic: 3,408
Reverse (935,22)TCACGTTGGAGAAGTATAGGTCNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops1.965 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.936 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceTCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGT
GTCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGC
TCCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGAT
GAGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGA
CCTATACTTCTCCAACGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160331 (NFASC)260420 - 679
NM_001160332 (NFASC)260658 - 917
NM_001005388 (NFASC)260676 - 935
NM_001005389 (NFASC)260676 - 935
NM_001160333 (NFASC)260658 - 917
NM_015090 (NFASC)260658 - 917
Exon 6 To Exon 8 (Pair 23)
Forward (691,21)CAACAAATTTGGCACGGCCCTAmplicon SizecDNA: 251 bpgenomic: 3,399
Reverse (941,21)GCAGCATCACGTTGGAGAAGTNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops0.395 kcal/mol in 3' area
Forward Dimers-2.774 kcal/mol
Reverse Loops1.88 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.084 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGTCTAAATCTCCTCT
GTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTCCTTTGACGCTCCA
GTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGAGCAGCTCCATGGA
GCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACCTATACTTCTCCAA
CGTGATGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160333 (NFASC)251673 - 923
NM_015090 (NFASC)251673 - 923
NM_001005388 (NFASC)251691 - 941
NM_001005389 (NFASC)251691 - 941
NM_001160331 (NFASC)251435 - 685
NM_001160332 (NFASC)251673 - 923
Exon 6 To Exon 8 (Pair 24)
Forward (692,21)AACAAATTTGGCACGGCCCTGAmplicon SizecDNA: 251 bpgenomic: 3,399
Reverse (942,21)TGCAGCATCACGTTGGAGAAGNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops0.395 kcal/mol in 3' area
Forward Dimers-2.774 kcal/mol
Reverse Loops1.88 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.084 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGTCTAAATCTCCTCTG
TGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTCCTTTGACGCTCCAG
TGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGAGCAGCTCCATGGAG
CCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACCTATACTTCTCCAAC
GTGATGCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160331 (NFASC)251436 - 686
NM_001160332 (NFASC)251674 - 924
NM_001005389 (NFASC)251692 - 942
NM_001005388 (NFASC)251692 - 942
NM_015090 (NFASC)251674 - 924
NM_001160333 (NFASC)251674 - 924
Exon 6 To Exon 8 (Pair 25)
Forward (677,20)CAGTGCTTCGCCCGCAACAAAmplicon SizecDNA: 264 bpgenomic: 3,412
Reverse (940,22)CAGCATCACGTTGGAGAAGTATNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol in 3' area
Forward Dimers-0.959 kcal/mol
Reverse Loops1.965 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceCAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTG
TCTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCT
CCTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATG
AGCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGAC
CTATACTTCTCCAACGTGATGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001005389 (NFASC)264677 - 940
NM_001005388 (NFASC)264677 - 940
NM_015090 (NFASC)264659 - 922
NM_001160333 (NFASC)264659 - 922
NM_001160331 (NFASC)264421 - 684
NM_001160332 (NFASC)264659 - 922
Exon 6 To Exon 8 (Pair 26)
Forward (678,21)AGTGCTTCGCCCGCAACAAATAmplicon SizecDNA: 257 bpgenomic: 3,405
Reverse (934,22)CACGTTGGAGAAGTATAGGTCTNr. of Isoforms 6 out of 6 (by amplicon BlastN)
Folding EnergiesForward Loops1.505 kcal/mol
Forward Dimers-0.348 kcal/mol
Reverse Loops1.965 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.936 kcal/mol
Amplicon Folding-1.814 kcal/mol outside primersite
Amplicon SequenceAGTGCTTCGCCCGCAACAAATTTGGCACGGCCCTGTCCAATAGGATCCGCCTGCAGGTGT
CTAAATCTCCTCTGTGGCCCAAGGAAAACCTAGACCCTGTCGTGGTCCAAGAGGGCGCTC
CTTTGACGCTCCAGTGCAACCCCCCGCCTGGACTTCCATCCCCGGTCATCTTCTGGATGA
GCAGCTCCATGGAGCCCATCACCCAAGACAAACGTGTCTCTCAGGGCCATAACGGAGACC
TATACTTCTCCAACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001160332 (NFASC)257660 - 916
NM_001160331 (NFASC)257422 - 678
NM_015090 (NFASC)257660 - 916
NM_001160333 (NFASC)257660 - 916
NM_001005389 (NFASC)257678 - 934
NM_001005388 (NFASC)257678 - 934
 

See below for some more details.

Program Output:

Loading ...