Design Results for NFKB1

(Canis Lupus Familiaris, Broad CanFam3.1/canFam3)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 4 (Pair 1)
Forward (14,23)AGAAGACGATACATATTTGGGAGAmplicon SizecDNA: 191 bpgenomic: 13,386
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTCA
TACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCC
ATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGA
AGGCCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19156 - 246
Exon 1 To Exon 4 (Pair 2)
Forward (5,22)CAGAATGGCAGAAGACGATACAAmplicon SizecDNA: 194 bpgenomic: 13,389
Reverse (198,22)GGCCTTCACATACATAACGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.605 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.001 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCC
TTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGC
AGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTA
TGTATGTGAAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19447 - 240
Exon 1 To Exon 4 (Pair 3)
Forward (8,24)AATGGCAGAAGACGATACATATTTAmplicon SizecDNA: 191 bpgenomic: 13,386
Reverse (198,22)GGCCTTCACATACATAACGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.001 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTT
GACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGA
TGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGT
ATGTGAAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19150 - 240
Exon 1 To Exon 4 (Pair 4)
Forward (8,24)AATGGCAGAAGACGATACATATTTAmplicon SizecDNA: 194 bpgenomic: 13,389
Reverse (201,22)ATGGGCCTTCACATACATAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTT
GACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGA
TGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGT
ATGTGAAGGCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19450 - 243
Exon 1 To Exon 4 (Pair 5)
Forward (14,23)AGAAGACGATACATATTTGGGAGAmplicon SizecDNA: 189 bpgenomic: 13,384
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTCA
TACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCC
ATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGA
AGGCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18956 - 244
Exon 1 To Exon 4 (Pair 6)
Forward (8,24)AATGGCAGAAGACGATACATATTTAmplicon SizecDNA: 226 bpgenomic: 13,421
Reverse (233,21)TTCACTAGATGCACCAGGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTT
GACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGA
TGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGT
ATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)22650 - 275
Exon 1 To Exon 4 (Pair 7)
Forward (14,23)AGAAGACGATACATATTTGGGAGAmplicon SizecDNA: 190 bpgenomic: 13,385
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTCA
TACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCC
ATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGA
AGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19056 - 245
Exon 1 To Exon 4 (Pair 8)
Forward (6,23)AGAATGGCAGAAGACGATACATAAmplicon SizecDNA: 199 bpgenomic: 13,394
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCT
TTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCA
GATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTAT
GTATGTGAAGGCCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19948 - 246
Exon 1 To Exon 4 (Pair 9)
Forward (5,22)CAGAATGGCAGAAGACGATACAAmplicon SizecDNA: 198 bpgenomic: 13,393
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.605 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCC
TTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGC
AGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTA
TGTATGTGAAGGCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19847 - 244
Exon 1 To Exon 4 (Pair 10)
Forward (6,23)AGAATGGCAGAAGACGATACATAAmplicon SizecDNA: 194 bpgenomic: 13,389
Reverse (199,21)GGGCCTTCACATACATAACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-2.65 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCT
TTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCA
GATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTAT
GTATGTGAAGGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19448 - 241
Exon 1 To Exon 4 (Pair 11)
Forward (13,23)CAGAAGACGATACATATTTGGGAAmplicon SizecDNA: 191 bpgenomic: 13,386
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTC
ATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTC
CATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTG
AAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19155 - 245
Exon 1 To Exon 4 (Pair 12)
Forward (10,23)TGGCAGAAGACGATACATATTTGAmplicon SizecDNA: 193 bpgenomic: 13,388
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.941 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGA
CTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATG
GTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTAT
GTGAAGGCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19352 - 244
Exon 1 To Exon 4 (Pair 13)
Forward (10,23)TGGCAGAAGACGATACATATTTGAmplicon SizecDNA: 224 bpgenomic: 13,419
Reverse (233,21)TTCACTAGATGCACCAGGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.941 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceTGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGA
CTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATG
GTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTAT
GTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)22452 - 275
Exon 1 To Exon 4 (Pair 14)
Forward (10,23)TGGCAGAAGACGATACATATTTGAmplicon SizecDNA: 223 bpgenomic: 13,418
Reverse (232,21)TCACTAGATGCACCAGGGAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.941 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceTGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGA
CTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATG
GTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTAT
GTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)22352 - 274
Exon 1 To Exon 4 (Pair 15)
Forward (14,23)AGAAGACGATACATATTTGGGAGAmplicon SizecDNA: 185 bpgenomic: 13,380
Reverse (198,22)GGCCTTCACATACATAACGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.001 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTCA
TACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCC
ATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGA
AGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18556 - 240
Exon 1 To Exon 4 (Pair 16)
Forward (7,23)GAATGGCAGAAGACGATACATATAmplicon SizecDNA: 226 bpgenomic: 13,421
Reverse (232,21)TCACTAGATGCACCAGGGAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTT
TGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAG
ATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATG
TATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)22649 - 274
Exon 1 To Exon 4 (Pair 17)
Forward (5,22)CAGAATGGCAGAAGACGATACAAmplicon SizecDNA: 200 bpgenomic: 13,395
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.605 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCC
TTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGC
AGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTA
TGTATGTGAAGGCCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)20047 - 246
Exon 1 To Exon 4 (Pair 18)
Forward (8,24)AATGGCAGAAGACGATACATATTTAmplicon SizecDNA: 192 bpgenomic: 13,387
Reverse (199,21)GGGCCTTCACATACATAACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-2.65 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTT
GACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGA
TGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGT
ATGTGAAGGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19250 - 241
Exon 1 To Exon 4 (Pair 19)
Forward (5,22)CAGAATGGCAGAAGACGATACAAmplicon SizecDNA: 197 bpgenomic: 13,392
Reverse (201,22)ATGGGCCTTCACATACATAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.605 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCC
TTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGC
AGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTA
TGTATGTGAAGGCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19747 - 243
Exon 1 To Exon 4 (Pair 20)
Forward (10,23)TGGCAGAAGACGATACATATTTGAmplicon SizecDNA: 189 bpgenomic: 13,384
Reverse (198,22)GGCCTTCACATACATAACGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.941 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.001 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGA
CTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATG
GTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTAT
GTGAAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18952 - 240
Exon 1 To Exon 4 (Pair 21)
Forward (13,23)CAGAAGACGATACATATTTGGGAAmplicon SizecDNA: 189 bpgenomic: 13,384
Reverse (201,22)ATGGGCCTTCACATACATAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTC
ATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTC
CATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTG
AAGGCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18955 - 243
Exon 1 To Exon 4 (Pair 22)
Forward (8,24)AATGGCAGAAGACGATACATATTTAmplicon SizecDNA: 195 bpgenomic: 13,390
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTT
GACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGA
TGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGT
ATGTGAAGGCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19550 - 244
Exon 1 To Exon 4 (Pair 23)
Forward (6,23)AGAATGGCAGAAGACGATACATAAmplicon SizecDNA: 228 bpgenomic: 13,423
Reverse (233,21)TTCACTAGATGCACCAGGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCT
TTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCA
GATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTAT
GTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)22848 - 275
Exon 1 To Exon 4 (Pair 24)
Forward (7,23)GAATGGCAGAAGACGATACATATAmplicon SizecDNA: 193 bpgenomic: 13,388
Reverse (199,21)GGGCCTTCACATACATAACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-2.65 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTT
TGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAG
ATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATG
TATGTGAAGGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19349 - 241
Exon 1 To Exon 4 (Pair 25)
Forward (5,22)CAGAATGGCAGAAGACGATACAAmplicon SizecDNA: 228 bpgenomic: 13,423
Reverse (232,21)TCACTAGATGCACCAGGGAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.605 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceCAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCC
TTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGC
AGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTA
TGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)22847 - 274
Exon 1 To Exon 4 (Pair 26)
Forward (5,22)CAGAATGGCAGAAGACGATACAAmplicon SizecDNA: 195 bpgenomic: 13,390
Reverse (199,21)GGGCCTTCACATACATAACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.605 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-2.65 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCC
TTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGC
AGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTA
TGTATGTGAAGGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19547 - 241
Exon 1 To Exon 4 (Pair 27)
Forward (8,24)AATGGCAGAAGACGATACATATTTAmplicon SizecDNA: 197 bpgenomic: 13,392
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTT
GACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGA
TGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGT
ATGTGAAGGCCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19750 - 246
Exon 1 To Exon 4 (Pair 28)
Forward (13,23)CAGAAGACGATACATATTTGGGAAmplicon SizecDNA: 186 bpgenomic: 13,381
Reverse (198,22)GGCCTTCACATACATAACGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.001 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTC
ATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTC
CATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTG
AAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18655 - 240
Exon 1 To Exon 4 (Pair 29)
Forward (10,23)TGGCAGAAGACGATACATATTTGAmplicon SizecDNA: 190 bpgenomic: 13,385
Reverse (199,21)GGGCCTTCACATACATAACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.941 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-2.65 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGA
CTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATG
GTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTAT
GTGAAGGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19052 - 241
Exon 1 To Exon 4 (Pair 30)
Forward (13,23)CAGAAGACGATACATATTTGGGAAmplicon SizecDNA: 190 bpgenomic: 13,385
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTC
ATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTC
CATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTG
AAGGCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19055 - 244
Exon 1 To Exon 4 (Pair 31)
Forward (6,23)AGAATGGCAGAAGACGATACATAAmplicon SizecDNA: 197 bpgenomic: 13,392
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCT
TTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCA
GATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTAT
GTATGTGAAGGCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19748 - 244
Exon 1 To Exon 4 (Pair 32)
Forward (6,23)AGAATGGCAGAAGACGATACATAAmplicon SizecDNA: 198 bpgenomic: 13,393
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCT
TTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCA
GATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTAT
GTATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19848 - 245
Exon 1 To Exon 4 (Pair 33)
Forward (17,22)AGACGATACATATTTGGGAGCGAmplicon SizecDNA: 187 bpgenomic: 13,382
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-0.979 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTCATAC
AATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCCATA
TCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGG
CCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18759 - 245
Exon 1 To Exon 4 (Pair 34)
Forward (13,23)CAGAAGACGATACATATTTGGGAAmplicon SizecDNA: 192 bpgenomic: 13,387
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTC
ATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTC
CATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTG
AAGGCCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19255 - 246
Exon 1 To Exon 4 (Pair 35)
Forward (10,23)TGGCAGAAGACGATACATATTTGAmplicon SizecDNA: 195 bpgenomic: 13,390
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.941 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGA
CTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATG
GTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTAT
GTGAAGGCCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19552 - 246
Exon 1 To Exon 4 (Pair 36)
Forward (7,23)GAATGGCAGAAGACGATACATATAmplicon SizecDNA: 198 bpgenomic: 13,393
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTT
TGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAG
ATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATG
TATGTGAAGGCCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19849 - 246
Exon 1 To Exon 4 (Pair 37)
Forward (6,23)AGAATGGCAGAAGACGATACATAAmplicon SizecDNA: 227 bpgenomic: 13,422
Reverse (232,21)TCACTAGATGCACCAGGGAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCT
TTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCA
GATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTAT
GTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)22748 - 274
Exon 1 To Exon 4 (Pair 38)
Forward (17,22)AGACGATACATATTTGGGAGCGAmplicon SizecDNA: 186 bpgenomic: 13,381
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-0.979 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTCATAC
AATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCCATA
TCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGG
CCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18659 - 244
Exon 1 To Exon 4 (Pair 39)
Forward (10,23)TGGCAGAAGACGATACATATTTGAmplicon SizecDNA: 194 bpgenomic: 13,389
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.941 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGA
CTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATG
GTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTAT
GTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19452 - 245
Exon 1 To Exon 4 (Pair 40)
Forward (7,23)GAATGGCAGAAGACGATACATATAmplicon SizecDNA: 195 bpgenomic: 13,390
Reverse (201,22)ATGGGCCTTCACATACATAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTT
TGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAG
ATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATG
TATGTGAAGGCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19549 - 243
Exon 1 To Exon 4 (Pair 41)
Forward (10,23)TGGCAGAAGACGATACATATTTGAmplicon SizecDNA: 192 bpgenomic: 13,387
Reverse (201,22)ATGGGCCTTCACATACATAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.941 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGA
CTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATG
GTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTAT
GTGAAGGCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19252 - 243
Exon 1 To Exon 4 (Pair 42)
Forward (6,23)AGAATGGCAGAAGACGATACATAAmplicon SizecDNA: 196 bpgenomic: 13,391
Reverse (201,22)ATGGGCCTTCACATACATAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCT
TTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCA
GATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTAT
GTATGTGAAGGCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19648 - 243
Exon 1 To Exon 4 (Pair 43)
Forward (5,22)CAGAATGGCAGAAGACGATACAAmplicon SizecDNA: 229 bpgenomic: 13,424
Reverse (233,21)TTCACTAGATGCACCAGGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.605 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceCAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCC
TTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGC
AGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTA
TGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)22947 - 275
Exon 1 To Exon 4 (Pair 44)
Forward (6,23)AGAATGGCAGAAGACGATACATAAmplicon SizecDNA: 193 bpgenomic: 13,388
Reverse (198,22)GGCCTTCACATACATAACGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.001 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCT
TTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCA
GATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTAT
GTATGTGAAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19348 - 240
Exon 1 To Exon 4 (Pair 45)
Forward (7,23)GAATGGCAGAAGACGATACATATAmplicon SizecDNA: 196 bpgenomic: 13,391
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTT
TGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAG
ATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATG
TATGTGAAGGCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19649 - 244
Exon 1 To Exon 4 (Pair 46)
Forward (8,24)AATGGCAGAAGACGATACATATTTAmplicon SizecDNA: 196 bpgenomic: 13,391
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTT
GACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGA
TGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGT
ATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19650 - 245
Exon 1 To Exon 4 (Pair 47)
Forward (7,23)GAATGGCAGAAGACGATACATATAmplicon SizecDNA: 192 bpgenomic: 13,387
Reverse (198,22)GGCCTTCACATACATAACGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.001 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTT
TGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAG
ATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATG
TATGTGAAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19249 - 240
Exon 1 To Exon 4 (Pair 48)
Forward (13,23)CAGAAGACGATACATATTTGGGAAmplicon SizecDNA: 187 bpgenomic: 13,382
Reverse (199,21)GGGCCTTCACATACATAACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-2.65 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTC
ATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTC
CATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTG
AAGGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18755 - 241
Exon 1 To Exon 4 (Pair 49)
Forward (7,23)GAATGGCAGAAGACGATACATATAmplicon SizecDNA: 227 bpgenomic: 13,422
Reverse (233,21)TTCACTAGATGCACCAGGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTT
TGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAG
ATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATG
TATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)22749 - 275
Exon 1 To Exon 4 (Pair 50)
Forward (7,23)GAATGGCAGAAGACGATACATATAmplicon SizecDNA: 197 bpgenomic: 13,392
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTT
TGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAG
ATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATG
TATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19749 - 245
Exon 1 To Exon 4 (Pair 51)
Forward (8,24)AATGGCAGAAGACGATACATATTTAmplicon SizecDNA: 225 bpgenomic: 13,420
Reverse (232,21)TCACTAGATGCACCAGGGAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.819 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.552 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTT
GACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGA
TGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGT
ATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)22550 - 274
Exon 1 To Exon 4 (Pair 52)
Forward (17,22)AGACGATACATATTTGGGAGCGAmplicon SizecDNA: 188 bpgenomic: 13,383
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-0.979 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTCATAC
AATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCCATA
TCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGG
CCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18859 - 246
Exon 1 To Exon 4 (Pair 53)
Forward (14,23)AGAAGACGATACATATTTGGGAGAmplicon SizecDNA: 188 bpgenomic: 13,383
Reverse (201,22)ATGGGCCTTCACATACATAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTCA
TACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCC
ATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGA
AGGCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18856 - 243
Exon 1 To Exon 4 (Pair 54)
Forward (5,22)CAGAATGGCAGAAGACGATACAAmplicon SizecDNA: 199 bpgenomic: 13,394
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.605 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCAGAATGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCC
TTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGC
AGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTA
TGTATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)19947 - 245
Exon 1 To Exon 4 (Pair 55)
Forward (10,23)TGGCAGAAGACGATACATATTTGAmplicon SizecDNA: 215 bpgenomic: 13,410
Reverse (224,20)TGCACCAGGGAGTCCACCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.941 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.086 kcal/mol
Reverse Dimers-2.75 kcal/mol
Forward-Reverse Dimers-1.251 kcal/mol
Amplicon Folding0.128 kcal/mol inside primersite
Amplicon SequenceTGGCAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGA
CTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATG
GTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTAT
GTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)21552 - 266
Exon 1 To Exon 4 (Pair 56)
Forward (14,23)AGAAGACGATACATATTTGGGAGAmplicon SizecDNA: 186 bpgenomic: 13,381
Reverse (199,21)GGGCCTTCACATACATAACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.92 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-2.65 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAGAAGACGATACATATTTGGGAGCGCATGAGCAAATGTTTCACTTGGATCCTTTGACTCA
TACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCC
ATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGA
AGGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18656 - 241
Exon 2 To Exon 4 (Pair 1)
Forward (56,23)CTTGGATCCTTTGACTCATACAAAmplicon SizecDNA: 148 bpgenomic: 8,444
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.582 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceCTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACT
ACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCG
TTTCCGTTATGTATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)14898 - 245
Exon 2 To Exon 4 (Pair 2)
Forward (52,23)TTCACTTGGATCCTTTGACTCATAmplicon SizecDNA: 150 bpgenomic: 8,446
Reverse (201,22)ATGGGCCTTCACATACATAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGC
CACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGAT
TTCGTTTCCGTTATGTATGTGAAGGCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15094 - 243
Exon 2 To Exon 5 (Pair 1)
Forward (58,24)TGGATCCTTTGACTCATACAATATAmplicon SizecDNA: 261 bpgenomic: 35,391
Reverse (318,22)TCCCATTTGTGACCAACTGAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.666 kcal/mol
Amplicon Folding-2.496 kcal/mol outside primersite
Amplicon SequenceTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTAC
CCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTT
TCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAAAAGA
ACAAGAAGTCCTACCCCCAGGTCAAAATCTGCAACTATGTGGGACCTGCAAAGGTTATTG
TTCAGTTGGTCACAAATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)261100 - 360
Exon 2 To Exon 5 (Pair 2)
Forward (52,23)TTCACTTGGATCCTTTGACTCATAmplicon SizecDNA: 269 bpgenomic: 35,399
Reverse (320,23)TTTCCCATTTGTGACCAACTGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.067 kcal/mol
Amplicon Folding-2.496 kcal/mol outside primersite
Amplicon SequenceTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGC
CACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGAT
TTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTG
AAAAGAACAAGAAGTCCTACCCCCAGGTCAAAATCTGCAACTATGTGGGACCTGCAAAGG
TTATTGTTCAGTTGGTCACAAATGGGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)26994 - 362
Exon 2 To Exon 5 (Pair 3)
Forward (57,24)TTGGATCCTTTGACTCATACAATAAmplicon SizecDNA: 264 bpgenomic: 35,394
Reverse (320,23)TTTCCCATTTGTGACCAACTGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.067 kcal/mol
Amplicon Folding-2.496 kcal/mol outside primersite
Amplicon SequenceTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTA
CCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGT
TTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAAAAG
AACAAGAAGTCCTACCCCCAGGTCAAAATCTGCAACTATGTGGGACCTGCAAAGGTTATT
GTTCAGTTGGTCACAAATGGGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)26499 - 362
Exon 2 To Exon 4 (Pair 3)
Forward (49,23)TGTTTCACTTGGATCCTTTGACTAmplicon SizecDNA: 153 bpgenomic: 8,449
Reverse (201,22)ATGGGCCTTCACATACATAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGA
TGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAG
GATTTCGTTTCCGTTATGTATGTGAAGGCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15391 - 243
Exon 2 To Exon 4 (Pair 4)
Forward (85,24)ATCCAGAATTATTTCAACCAGAGAAmplicon SizecDNA: 120 bpgenomic: 8,416
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.562 kcal/mol in 3' area
Forward Dimers-0.936 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.581 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCCATATCTTCAAA
TATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)120127 - 246
Exon 2 To Exon 4 (Pair 5)
Forward (58,24)TGGATCCTTTGACTCATACAATATAmplicon SizecDNA: 141 bpgenomic: 8,437
Reverse (198,22)GGCCTTCACATACATAACGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops2.001 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTAC
CCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTT
TCCGTTATGTATGTGAAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)141100 - 240
Exon 2 To Exon 4 (Pair 6)
Forward (84,24)AATCCAGAATTATTTCAACCAGAGAmplicon SizecDNA: 116 bpgenomic: 8,412
Reverse (199,21)GGGCCTTCACATACATAACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.562 kcal/mol in 3' area
Forward Dimers-0.936 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-2.65 kcal/mol
Forward-Reverse Dimers-0.773 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCCATATCTTCAA
ATATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)116126 - 241
Exon 2 To Exon 4 (Pair 7)
Forward (48,23)ATGTTTCACTTGGATCCTTTGACAmplicon SizecDNA: 177 bpgenomic: 8,473
Reverse (224,20)TGCACCAGGGAGTCCACCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.086 kcal/mol
Reverse Dimers-2.75 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding0.128 kcal/mol inside primersite
Amplicon SequenceATGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAG
ATGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGA
GGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)17790 - 266
Exon 2 To Exon 5 (Pair 4)
Forward (55,23)ACTTGGATCCTTTGACTCATACAAmplicon SizecDNA: 264 bpgenomic: 35,394
Reverse (318,22)TCCCATTTGTGACCAACTGAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.067 kcal/mol
Amplicon Folding-2.496 kcal/mol outside primersite
Amplicon SequenceACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCAC
TACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTC
GTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAAA
AGAACAAGAAGTCCTACCCCCAGGTCAAAATCTGCAACTATGTGGGACCTGCAAAGGTTA
TTGTTCAGTTGGTCACAAATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)26497 - 360
Exon 2 To Exon 4 (Pair 8)
Forward (59,24)GGATCCTTTGACTCATACAATATTAmplicon SizecDNA: 145 bpgenomic: 8,441
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.815 kcal/mol in 3' area
Forward Dimers-2.29 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.582 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACC
CACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTT
CCGTTATGTATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)145101 - 245
Exon 2 To Exon 5 (Pair 5)
Forward (58,24)TGGATCCTTTGACTCATACAATATAmplicon SizecDNA: 263 bpgenomic: 35,393
Reverse (320,23)TTTCCCATTTGTGACCAACTGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.666 kcal/mol
Amplicon Folding-2.496 kcal/mol outside primersite
Amplicon SequenceTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTAC
CCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTT
TCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAAAAGA
ACAAGAAGTCCTACCCCCAGGTCAAAATCTGCAACTATGTGGGACCTGCAAAGGTTATTG
TTCAGTTGGTCACAAATGGGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)263100 - 362
Exon 2 To Exon 4 (Pair 9)
Forward (48,23)ATGTTTCACTTGGATCCTTTGACAmplicon SizecDNA: 154 bpgenomic: 8,450
Reverse (201,22)ATGGGCCTTCACATACATAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.681 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceATGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAG
ATGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGA
GGATTTCGTTTCCGTTATGTATGTGAAGGCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15490 - 243
Exon 2 To Exon 4 (Pair 10)
Forward (57,24)TTGGATCCTTTGACTCATACAATAAmplicon SizecDNA: 147 bpgenomic: 8,443
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.582 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTA
CCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGT
TTCCGTTATGTATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)14799 - 245
Exon 2 To Exon 4 (Pair 11)
Forward (48,23)ATGTTTCACTTGGATCCTTTGACAmplicon SizecDNA: 186 bpgenomic: 8,482
Reverse (233,21)TTCACTAGATGCACCAGGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.667 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceATGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAG
ATGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGA
GGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCT
AGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18690 - 275
Exon 2 To Exon 4 (Pair 12)
Forward (85,24)ATCCAGAATTATTTCAACCAGAGAAmplicon SizecDNA: 119 bpgenomic: 8,415
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.562 kcal/mol in 3' area
Forward Dimers-0.936 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.29 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceATCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCCATATCTTCAAA
TATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)119127 - 245
Exon 2 To Exon 4 (Pair 13)
Forward (100,21)AACCAGAGATGCCACTACCCAAmplicon SizecDNA: 100 bpgenomic: 8,396
Reverse (199,21)GGGCCTTCACATACATAACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.91 kcal/mol
Forward Dimers-0.672 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-2.65 kcal/mol
Forward-Reverse Dimers-1.987 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceAACCAGAGATGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTA
AACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)100142 - 241
Exon 2 To Exon 4 (Pair 14)
Forward (59,24)GGATCCTTTGACTCATACAATATTAmplicon SizecDNA: 166 bpgenomic: 8,462
Reverse (224,20)TGCACCAGGGAGTCCACCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.815 kcal/mol in 3' area
Forward Dimers-2.29 kcal/mol
Reverse Loops1.086 kcal/mol
Reverse Dimers-2.75 kcal/mol
Forward-Reverse Dimers-2.183 kcal/mol
Amplicon Folding0.128 kcal/mol inside primersite
Amplicon SequenceGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACC
CACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTT
CCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)166101 - 266
Exon 2 To Exon 4 (Pair 15)
Forward (58,24)TGGATCCTTTGACTCATACAATATAmplicon SizecDNA: 146 bpgenomic: 8,442
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.582 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTAC
CCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTT
TCCGTTATGTATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)146100 - 245
Exon 2 To Exon 5 (Pair 6)
Forward (52,23)TTCACTTGGATCCTTTGACTCATAmplicon SizecDNA: 267 bpgenomic: 35,397
Reverse (318,22)TCCCATTTGTGACCAACTGAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.067 kcal/mol
Amplicon Folding-2.496 kcal/mol outside primersite
Amplicon SequenceTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGC
CACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGAT
TTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTG
AAAAGAACAAGAAGTCCTACCCCCAGGTCAAAATCTGCAACTATGTGGGACCTGCAAAGG
TTATTGTTCAGTTGGTCACAAATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)26794 - 360
Exon 2 To Exon 4 (Pair 16)
Forward (48,23)ATGTTTCACTTGGATCCTTTGACAmplicon SizecDNA: 151 bpgenomic: 8,447
Reverse (198,22)GGCCTTCACATACATAACGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops2.001 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-1.681 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceATGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAG
ATGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGA
GGATTTCGTTTCCGTTATGTATGTGAAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15190 - 240
Exon 2 To Exon 5 (Pair 7)
Forward (56,23)CTTGGATCCTTTGACTCATACAAAmplicon SizecDNA: 263 bpgenomic: 35,393
Reverse (318,22)TCCCATTTGTGACCAACTGAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.067 kcal/mol
Amplicon Folding-2.496 kcal/mol outside primersite
Amplicon SequenceCTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACT
ACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCG
TTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAAAA
GAACAAGAAGTCCTACCCCCAGGTCAAAATCTGCAACTATGTGGGACCTGCAAAGGTTAT
TGTTCAGTTGGTCACAAATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)26398 - 360
Exon 2 To Exon 4 (Pair 17)
Forward (53,23)TCACTTGGATCCTTTGACTCATAAmplicon SizecDNA: 152 bpgenomic: 8,448
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.873 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCC
ACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATT
TCGTTTCCGTTATGTATGTGAAGGCCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15295 - 246
Exon 2 To Exon 5 (Pair 8)
Forward (49,23)TGTTTCACTTGGATCCTTTGACTAmplicon SizecDNA: 272 bpgenomic: 35,402
Reverse (320,23)TTTCCCATTTGTGACCAACTGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.067 kcal/mol
Amplicon Folding-2.496 kcal/mol outside primersite
Amplicon SequenceTGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGA
TGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAG
GATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTA
GTGAAAAGAACAAGAAGTCCTACCCCCAGGTCAAAATCTGCAACTATGTGGGACCTGCAA
AGGTTATTGTTCAGTTGGTCACAAATGGGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)27291 - 362
Exon 2 To Exon 4 (Pair 18)
Forward (53,23)TCACTTGGATCCTTTGACTCATAAmplicon SizecDNA: 147 bpgenomic: 8,443
Reverse (199,21)GGGCCTTCACATACATAACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-2.65 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCC
ACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATT
TCGTTTCCGTTATGTATGTGAAGGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)14795 - 241
Exon 2 To Exon 4 (Pair 19)
Forward (59,24)GGATCCTTTGACTCATACAATATTAmplicon SizecDNA: 143 bpgenomic: 8,439
Reverse (201,22)ATGGGCCTTCACATACATAACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.815 kcal/mol in 3' area
Forward Dimers-2.29 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-0.674 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTACC
CACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTTT
CCGTTATGTATGTGAAGGCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)143101 - 243
Exon 2 To Exon 4 (Pair 20)
Forward (51,23)TTTCACTTGGATCCTTTGACTCAAmplicon SizecDNA: 152 bpgenomic: 8,448
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATG
CCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGA
TTTCGTTTCCGTTATGTATGTGAAGGCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15293 - 244
Exon 2 To Exon 4 (Pair 21)
Forward (58,24)TGGATCCTTTGACTCATACAATATAmplicon SizecDNA: 176 bpgenomic: 8,472
Reverse (233,21)TTCACTAGATGCACCAGGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.596 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTAC
CCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTT
TCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)176100 - 275
Exon 2 To Exon 4 (Pair 22)
Forward (52,23)TTCACTTGGATCCTTTGACTCATAmplicon SizecDNA: 152 bpgenomic: 8,448
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.582 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGC
CACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGAT
TTCGTTTCCGTTATGTATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15294 - 245
Exon 2 To Exon 4 (Pair 23)
Forward (48,23)ATGTTTCACTTGGATCCTTTGACAmplicon SizecDNA: 156 bpgenomic: 8,452
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.681 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceATGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAG
ATGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGA
GGATTTCGTTTCCGTTATGTATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15690 - 245
Exon 2 To Exon 4 (Pair 24)
Forward (57,24)TTGGATCCTTTGACTCATACAATAAmplicon SizecDNA: 142 bpgenomic: 8,438
Reverse (198,22)GGCCTTCACATACATAACGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops2.001 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-0.856 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTA
CCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGT
TTCCGTTATGTATGTGAAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)14299 - 240
Exon 2 To Exon 5 (Pair 9)
Forward (51,23)TTTCACTTGGATCCTTTGACTCAAmplicon SizecDNA: 268 bpgenomic: 35,398
Reverse (318,22)TCCCATTTGTGACCAACTGAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.067 kcal/mol
Amplicon Folding-2.496 kcal/mol outside primersite
Amplicon SequenceTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATG
CCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGA
TTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGT
GAAAAGAACAAGAAGTCCTACCCCCAGGTCAAAATCTGCAACTATGTGGGACCTGCAAAG
GTTATTGTTCAGTTGGTCACAAATGGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)26893 - 360
Exon 2 To Exon 4 (Pair 25)
Forward (52,23)TTCACTTGGATCCTTTGACTCATAmplicon SizecDNA: 153 bpgenomic: 8,449
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.873 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGC
CACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGAT
TTCGTTTCCGTTATGTATGTGAAGGCCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15394 - 246
Exon 2 To Exon 4 (Pair 26)
Forward (86,24)TCCAGAATTATTTCAACCAGAGATAmplicon SizecDNA: 117 bpgenomic: 8,413
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.562 kcal/mol in 3' area
Forward Dimers-0.936 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.247 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTCCAGAATTATTTCAACCAGAGATGCCACTACCCACAGCAGATGGTCCATATCTTCAAAT
ATTAGAGCAACCTAAACAGAGAGGATTTCGTTTCCGTTATGTATGTGAAGGCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)117128 - 244
Exon 2 To Exon 4 (Pair 27)
Forward (49,23)TGTTTCACTTGGATCCTTTGACTAmplicon SizecDNA: 154 bpgenomic: 8,450
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGA
TGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAG
GATTTCGTTTCCGTTATGTATGTGAAGGCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15491 - 244
Exon 2 To Exon 4 (Pair 28)
Forward (49,23)TGTTTCACTTGGATCCTTTGACTAmplicon SizecDNA: 184 bpgenomic: 8,480
Reverse (232,21)TCACTAGATGCACCAGGGAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.667 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceTGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGA
TGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAG
GATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTA
GTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18491 - 274
Exon 2 To Exon 4 (Pair 29)
Forward (53,23)TCACTTGGATCCTTTGACTCATAAmplicon SizecDNA: 151 bpgenomic: 8,447
Reverse (203,22)GGATGGGCCTTCACATACATAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.447 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.582 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCC
ACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATT
TCGTTTCCGTTATGTATGTGAAGGCCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15195 - 245
Exon 2 To Exon 4 (Pair 30)
Forward (49,23)TGTTTCACTTGGATCCTTTGACTAmplicon SizecDNA: 185 bpgenomic: 8,481
Reverse (233,21)TTCACTAGATGCACCAGGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.664 kcal/mol
Reverse Dimers-1.726 kcal/mol
Forward-Reverse Dimers-1.667 kcal/mol
Amplicon Folding0.128 kcal/mol outside primersite
Amplicon SequenceTGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGA
TGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAG
GATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTA
GTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)18591 - 275
Exon 2 To Exon 4 (Pair 31)
Forward (49,23)TGTTTCACTTGGATCCTTTGACTAmplicon SizecDNA: 176 bpgenomic: 8,472
Reverse (224,20)TGCACCAGGGAGTCCACCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.086 kcal/mol
Reverse Dimers-2.75 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding0.128 kcal/mol inside primersite
Amplicon SequenceTGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGA
TGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAG
GATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)17691 - 266
Exon 2 To Exon 4 (Pair 32)
Forward (48,23)ATGTTTCACTTGGATCCTTTGACAmplicon SizecDNA: 152 bpgenomic: 8,448
Reverse (199,21)GGGCCTTCACATACATAACGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops2.247 kcal/mol
Reverse Dimers-2.65 kcal/mol
Forward-Reverse Dimers-1.681 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceATGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAG
ATGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGA
GGATTTCGTTTCCGTTATGTATGTGAAGGCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15290 - 241
Exon 2 To Exon 4 (Pair 33)
Forward (58,24)TGGATCCTTTGACTCATACAATATAmplicon SizecDNA: 145 bpgenomic: 8,441
Reverse (202,22)GATGGGCCTTCACATACATAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.475 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.237 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCACTAC
CCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTCGTT
TCCGTTATGTATGTGAAGGCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)145100 - 244
Exon 2 To Exon 4 (Pair 34)
Forward (49,23)TGTTTCACTTGGATCCTTTGACTAmplicon SizecDNA: 156 bpgenomic: 8,452
Reverse (204,21)GGGATGGGCCTTCACATACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.685 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.156 kcal/mol
Reverse Dimers-2.684 kcal/mol
Forward-Reverse Dimers-1.873 kcal/mol
Amplicon Folding0.565 kcal/mol outside primersite
Amplicon SequenceTGTTTCACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGA
TGCCACTACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAG
GATTTCGTTTCCGTTATGTATGTGAAGGCCCATCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)15691 - 246
Exon 2 To Exon 5 (Pair 10)
Forward (55,23)ACTTGGATCCTTTGACTCATACAAmplicon SizecDNA: 266 bpgenomic: 35,396
Reverse (320,23)TTTCCCATTTGTGACCAACTGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.067 kcal/mol
Amplicon Folding-2.496 kcal/mol outside primersite
Amplicon SequenceACTTGGATCCTTTGACTCATACAATATTTAATCCAGAATTATTTCAACCAGAGATGCCAC
TACCCACAGCAGATGGTCCATATCTTCAAATATTAGAGCAACCTAAACAGAGAGGATTTC
GTTTCCGTTATGTATGTGAAGGCCCATCCCATGGTGGACTCCCTGGTGCATCTAGTGAAA
AGAACAAGAAGTCCTACCCCCAGGTCAAAATCTGCAACTATGTGGGACCTGCAAAGGTTA
TTGTTCAGTTGGTCACAAATGGGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001003344 (NFKB1)26697 - 362
 

See below for some more details.

Program Output:

Loading ...