Design Results for NR3C1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 5 (Pair 1)
Forward (2580,23)TGACATGAATACAGCATCCCTTTAmplicon SizecDNA: 211 bpgenomic: 85,698
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCAT
TCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAA
CTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTC
AAGCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204264 (NR3C1)2111494 - 1704
NM_001024094 (NR3C1)2111494 - 1704
NM_000176 (NR3C1)2111494 - 1704
NM_001204262 (NR3C1)2111494 - 1704
NM_001018076 (NR3C1)2111120 - 1330
NM_001018075 (NR3C1)2111227 - 1437
NM_001204261 (NR3C1)2111494 - 1704
NM_001018074 (NR3C1)2111324 - 1534
NM_001204259 (NR3C1)2111494 - 1704
NM_001204265 (NR3C1)2111494 - 1704
NM_001018077 (NR3C1)2111996 - 2206
NM_001204258 (NR3C1)2111494 - 1704
NM_001020825 (NR3C1)2111494 - 1704
NM_001204263 (NR3C1)2111494 - 1704
NM_001204260 (NR3C1)2111494 - 1704
Exon 4 To Exon 5 (Pair 2)
Forward (2578,23)TATGACATGAATACAGCATCCCTAmplicon SizecDNA: 222 bpgenomic: 85,709
Reverse (2799,21)GGATGGAGGAGAGCTTACATCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.668 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTC
ATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGAC
AACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTAT
TCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2221492 - 1713
NM_001204259 (NR3C1)2221492 - 1713
NM_001204258 (NR3C1)2221492 - 1713
NM_001020825 (NR3C1)2221492 - 1713
NM_001204263 (NR3C1)2221492 - 1713
NM_001018077 (NR3C1)2221994 - 2215
NM_001204265 (NR3C1)2221492 - 1713
NM_001018076 (NR3C1)2221118 - 1339
NM_001018074 (NR3C1)2221322 - 1543
NM_001018075 (NR3C1)2221225 - 1446
NM_001204261 (NR3C1)2221492 - 1713
NM_001204264 (NR3C1)2221492 - 1713
NM_001024094 (NR3C1)2221492 - 1713
NM_000176 (NR3C1)2221492 - 1713
NM_001204262 (NR3C1)2221492 - 1713
Exon 4 To Exon 5 (Pair 3)
Forward (2580,23)TGACATGAATACAGCATCCCTTTAmplicon SizecDNA: 212 bpgenomic: 85,699
Reverse (2791,22)GAGAGCTTACATCTGGTCTCATNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCAT
TCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAA
CTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTC
AAGCCCCAGCATGAGACCAGATGTAAGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204262 (NR3C1)2121494 - 1705
NM_000176 (NR3C1)2121494 - 1705
NM_001024094 (NR3C1)2121494 - 1705
NM_001204264 (NR3C1)2121494 - 1705
NM_001018074 (NR3C1)2121324 - 1535
NM_001204261 (NR3C1)2121494 - 1705
NM_001018075 (NR3C1)2121227 - 1438
NM_001018076 (NR3C1)2121120 - 1331
NM_001204263 (NR3C1)2121494 - 1705
NM_001204258 (NR3C1)2121494 - 1705
NM_001020825 (NR3C1)2121494 - 1705
NM_001204265 (NR3C1)2121494 - 1705
NM_001018077 (NR3C1)2121996 - 2207
NM_001204259 (NR3C1)2121494 - 1705
NM_001204260 (NR3C1)2121494 - 1705
Exon 4 To Exon 5 (Pair 4)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 99 bpgenomic: 85,586
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-1.696 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)991232 - 1330
NM_001204261 (NR3C1)991606 - 1704
NM_001018075 (NR3C1)991339 - 1437
NM_001018074 (NR3C1)991436 - 1534
NM_001024094 (NR3C1)991606 - 1704
NM_001204264 (NR3C1)991606 - 1704
NM_001204262 (NR3C1)991606 - 1704
NM_000176 (NR3C1)991606 - 1704
NM_001204260 (NR3C1)991606 - 1704
NM_001204259 (NR3C1)991606 - 1704
NM_001018077 (NR3C1)992108 - 2206
NM_001204265 (NR3C1)991606 - 1704
NM_001204263 (NR3C1)991606 - 1704
NM_001204258 (NR3C1)991606 - 1704
NM_001020825 (NR3C1)991606 - 1704
Exon 4 To Exon 5 (Pair 5)
Forward (2497,24)CCTGGAGCAAATATAATTGGTAATAmplicon SizecDNA: 299 bpgenomic: 85,786
Reverse (2795,21)GGAGGAGAGCTTACATCTGGTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.182 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTACC
TCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGAT
CAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGG
TGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGA
ACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001024094 (NR3C1)2991411 - 1709
NM_001204264 (NR3C1)2991411 - 1709
NM_001204262 (NR3C1)2991411 - 1709
NM_000176 (NR3C1)2991411 - 1709
NM_001018076 (NR3C1)2991037 - 1335
NM_001204261 (NR3C1)2991411 - 1709
NM_001018075 (NR3C1)2991144 - 1442
NM_001018074 (NR3C1)2991241 - 1539
NM_001204259 (NR3C1)2991411 - 1709
NM_001204265 (NR3C1)2991411 - 1709
NM_001018077 (NR3C1)2991913 - 2211
NM_001204263 (NR3C1)2991411 - 1709
NM_001204258 (NR3C1)2991411 - 1709
NM_001020825 (NR3C1)2991411 - 1709
NM_001204260 (NR3C1)2991411 - 1709
Exon 4 To Exon 5 (Pair 6)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 119 bpgenomic: 85,606
Reverse (2810,20)GTTGAGGAGCTGGATGGAGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)1191606 - 1724
NM_001018077 (NR3C1)1192108 - 2226
NM_001204265 (NR3C1)1191606 - 1724
NM_001204263 (NR3C1)1191606 - 1724
NM_001020825 (NR3C1)1191606 - 1724
NM_001204258 (NR3C1)1191606 - 1724
NM_001204260 (NR3C1)1191606 - 1724
NM_001024094 (NR3C1)1191606 - 1724
NM_001204264 (NR3C1)1191606 - 1724
NM_001204262 (NR3C1)1191606 - 1724
NM_000176 (NR3C1)1191606 - 1724
NM_001018076 (NR3C1)1191232 - 1350
NM_001204261 (NR3C1)1191606 - 1724
NM_001018075 (NR3C1)1191339 - 1457
NM_001018074 (NR3C1)1191436 - 1554
Exon 4 To Exon 5 (Pair 7)
Forward (2491,24)AGCTTTCCTGGAGCAAATATAATTAmplicon SizecDNA: 300 bpgenomic: 85,787
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.522 kcal/mol
Forward Dimers-1.822 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.844 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceAGCTTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTG
AGTACCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAG
CAGGATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGG
AATAGGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCT
GGTCGAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204264 (NR3C1)3001405 - 1704
NM_001024094 (NR3C1)3001405 - 1704
NM_000176 (NR3C1)3001405 - 1704
NM_001204262 (NR3C1)3001405 - 1704
NM_001018076 (NR3C1)3001031 - 1330
NM_001018074 (NR3C1)3001235 - 1534
NM_001018075 (NR3C1)3001138 - 1437
NM_001204261 (NR3C1)3001405 - 1704
NM_001204259 (NR3C1)3001405 - 1704
NM_001204258 (NR3C1)3001405 - 1704
NM_001020825 (NR3C1)3001405 - 1704
NM_001204263 (NR3C1)3001405 - 1704
NM_001018077 (NR3C1)3001907 - 2206
NM_001204265 (NR3C1)3001405 - 1704
NM_001204260 (NR3C1)3001405 - 1704
Exon 4 To Exon 5 (Pair 8)
Forward (2496,24)TCCTGGAGCAAATATAATTGGTAAAmplicon SizecDNA: 297 bpgenomic: 85,784
Reverse (2792,21)GGAGAGCTTACATCTGGTCTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.073 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTAC
CTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGA
TCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAG
GTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCG
AACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)2971410 - 1706
NM_001204263 (NR3C1)2971410 - 1706
NM_001020825 (NR3C1)2971410 - 1706
NM_001204258 (NR3C1)2971410 - 1706
NM_001204265 (NR3C1)2971410 - 1706
NM_001018077 (NR3C1)2971912 - 2208
NM_001204260 (NR3C1)2971410 - 1706
NM_001024094 (NR3C1)2971410 - 1706
NM_001204264 (NR3C1)2971410 - 1706
NM_001204262 (NR3C1)2971410 - 1706
NM_000176 (NR3C1)2971410 - 1706
NM_001018076 (NR3C1)2971036 - 1332
NM_001018074 (NR3C1)2971240 - 1536
NM_001204261 (NR3C1)2971410 - 1706
NM_001018075 (NR3C1)2971143 - 1439
Exon 4 To Exon 5 (Pair 9)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 192 bpgenomic: 85,679
Reverse (2884,23)AGACTCCATAATGACATCCTGAANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.398 kcal/mol
Forward-Reverse Dimers-1.133 kcal/mol
Amplicon Folding-2.359 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACAG
CAACAACAGGACCACCTCCCAAACTCTGCCTGGTGTGCTCTGATGAAGCTTCAGGATGTC
ATTATGGAGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204261 (NR3C1)1921607 - 1798
NM_001018075 (NR3C1)1921340 - 1531
NM_001018074 (NR3C1)1921437 - 1628
NM_001018076 (NR3C1)1921233 - 1424
NM_001204262 (NR3C1)1921607 - 1798
NM_000176 (NR3C1)1921607 - 1798
NM_001024094 (NR3C1)1921607 - 1798
NM_001204264 (NR3C1)1921607 - 1798
NM_001204260 (NR3C1)1921607 - 1798
NM_001018077 (NR3C1)1922109 - 2300
NM_001204265 (NR3C1)1921607 - 1798
NM_001204263 (NR3C1)1921607 - 1798
NM_001204258 (NR3C1)1921607 - 1798
NM_001020825 (NR3C1)1921607 - 1798
NM_001204259 (NR3C1)1921607 - 1798
Exon 4 To Exon 5 (Pair 10)
Forward (2578,23)TATGACATGAATACAGCATCCCTAmplicon SizecDNA: 215 bpgenomic: 85,702
Reverse (2792,21)GGAGAGCTTACATCTGGTCTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.668 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTC
ATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGAC
AACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTAT
TCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204261 (NR3C1)2151492 - 1706
NM_001018075 (NR3C1)2151225 - 1439
NM_001018074 (NR3C1)2151322 - 1536
NM_001018076 (NR3C1)2151118 - 1332
NM_001204262 (NR3C1)2151492 - 1706
NM_000176 (NR3C1)2151492 - 1706
NM_001024094 (NR3C1)2151492 - 1706
NM_001204264 (NR3C1)2151492 - 1706
NM_001204260 (NR3C1)2151492 - 1706
NM_001018077 (NR3C1)2151994 - 2208
NM_001204265 (NR3C1)2151492 - 1706
NM_001204263 (NR3C1)2151492 - 1706
NM_001204258 (NR3C1)2151492 - 1706
NM_001020825 (NR3C1)2151492 - 1706
NM_001204259 (NR3C1)2151492 - 1706
Exon 4 To Exon 5 (Pair 11)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 193 bpgenomic: 85,680
Reverse (2884,23)AGACTCCATAATGACATCCTGAANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.398 kcal/mol
Forward-Reverse Dimers-1.696 kcal/mol
Amplicon Folding-2.359 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACA
GCAACAACAGGACCACCTCCCAAACTCTGCCTGGTGTGCTCTGATGAAGCTTCAGGATGT
CATTATGGAGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018074 (NR3C1)1931436 - 1628
NM_001204261 (NR3C1)1931606 - 1798
NM_001018075 (NR3C1)1931339 - 1531
NM_001018076 (NR3C1)1931232 - 1424
NM_001204262 (NR3C1)1931606 - 1798
NM_000176 (NR3C1)1931606 - 1798
NM_001024094 (NR3C1)1931606 - 1798
NM_001204264 (NR3C1)1931606 - 1798
NM_001204260 (NR3C1)1931606 - 1798
NM_001204263 (NR3C1)1931606 - 1798
NM_001204258 (NR3C1)1931606 - 1798
NM_001020825 (NR3C1)1931606 - 1798
NM_001018077 (NR3C1)1932108 - 2300
NM_001204265 (NR3C1)1931606 - 1798
NM_001204259 (NR3C1)1931606 - 1798
Exon 4 To Exon 5 (Pair 12)
Forward (2494,24)TTTCCTGGAGCAAATATAATTGGTAmplicon SizecDNA: 298 bpgenomic: 85,785
Reverse (2791,22)GAGAGCTTACATCTGGTCTCATNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol in 3' area
Forward Dimers-1.792 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGT
ACCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAG
GATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAAT
AGGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGT
CGAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2981408 - 1705
NM_001020825 (NR3C1)2981408 - 1705
NM_001204258 (NR3C1)2981408 - 1705
NM_001204263 (NR3C1)2981408 - 1705
NM_001018077 (NR3C1)2981910 - 2207
NM_001204265 (NR3C1)2981408 - 1705
NM_001204259 (NR3C1)2981408 - 1705
NM_001018074 (NR3C1)2981238 - 1535
NM_001018075 (NR3C1)2981141 - 1438
NM_001204261 (NR3C1)2981408 - 1705
NM_001018076 (NR3C1)2981034 - 1331
NM_000176 (NR3C1)2981408 - 1705
NM_001204262 (NR3C1)2981408 - 1705
NM_001204264 (NR3C1)2981408 - 1705
NM_001024094 (NR3C1)2981408 - 1705
Exon 4 To Exon 5 (Pair 13)
Forward (2578,23)TATGACATGAATACAGCATCCCTAmplicon SizecDNA: 213 bpgenomic: 85,700
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.668 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTC
ATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGAC
AACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTAT
TCAAGCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2131492 - 1704
NM_001204265 (NR3C1)2131492 - 1704
NM_001018077 (NR3C1)2131994 - 2206
NM_001204263 (NR3C1)2131492 - 1704
NM_001020825 (NR3C1)2131492 - 1704
NM_001204258 (NR3C1)2131492 - 1704
NM_001204259 (NR3C1)2131492 - 1704
NM_001204261 (NR3C1)2131492 - 1704
NM_001018075 (NR3C1)2131225 - 1437
NM_001018074 (NR3C1)2131322 - 1534
NM_001018076 (NR3C1)2131118 - 1330
NM_001204262 (NR3C1)2131492 - 1704
NM_000176 (NR3C1)2131492 - 1704
NM_001024094 (NR3C1)2131492 - 1704
NM_001204264 (NR3C1)2131492 - 1704
Exon 4 To Exon 5 (Pair 14)
Forward (2578,23)TATGACATGAATACAGCATCCCTAmplicon SizecDNA: 217 bpgenomic: 85,704
Reverse (2794,21)GAGGAGAGCTTACATCTGGTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.668 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTC
ATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGAC
AACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTAT
TCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)2171492 - 1708
NM_001018077 (NR3C1)2171994 - 2210
NM_001204265 (NR3C1)2171492 - 1708
NM_001020825 (NR3C1)2171492 - 1708
NM_001204258 (NR3C1)2171492 - 1708
NM_001204263 (NR3C1)2171492 - 1708
NM_001204260 (NR3C1)2171492 - 1708
NM_001204264 (NR3C1)2171492 - 1708
NM_001024094 (NR3C1)2171492 - 1708
NM_000176 (NR3C1)2171492 - 1708
NM_001204262 (NR3C1)2171492 - 1708
NM_001018076 (NR3C1)2171118 - 1334
NM_001018075 (NR3C1)2171225 - 1441
NM_001204261 (NR3C1)2171492 - 1708
NM_001018074 (NR3C1)2171322 - 1538
Exon 4 To Exon 5 (Pair 15)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 189 bpgenomic: 85,676
Reverse (2881,22)CTCCATAATGACATCCTGAAGCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.398 kcal/mol
Forward-Reverse Dimers-1.133 kcal/mol
Amplicon Folding-2.359 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACAG
CAACAACAGGACCACCTCCCAAACTCTGCCTGGTGTGCTCTGATGAAGCTTCAGGATGTC
ATTATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)1891607 - 1795
NM_001204265 (NR3C1)1891607 - 1795
NM_001018077 (NR3C1)1892109 - 2297
NM_001204263 (NR3C1)1891607 - 1795
NM_001020825 (NR3C1)1891607 - 1795
NM_001204258 (NR3C1)1891607 - 1795
NM_001204260 (NR3C1)1891607 - 1795
NM_001024094 (NR3C1)1891607 - 1795
NM_001204264 (NR3C1)1891607 - 1795
NM_001204262 (NR3C1)1891607 - 1795
NM_000176 (NR3C1)1891607 - 1795
NM_001018076 (NR3C1)1891233 - 1421
NM_001204261 (NR3C1)1891607 - 1795
NM_001018075 (NR3C1)1891340 - 1528
NM_001018074 (NR3C1)1891437 - 1625
Exon 4 To Exon 5 (Pair 16)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 198 bpgenomic: 85,685
Reverse (2890,24)AAGTTAAGACTCCATAATGACATCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops0.596 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding-2.359 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACAG
CAACAACAGGACCACCTCCCAAACTCTGCCTGGTGTGCTCTGATGAAGCTTCAGGATGTC
ATTATGGAGTCTTAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)1981607 - 1804
NM_001204263 (NR3C1)1981607 - 1804
NM_001020825 (NR3C1)1981607 - 1804
NM_001204258 (NR3C1)1981607 - 1804
NM_001018077 (NR3C1)1982109 - 2306
NM_001204265 (NR3C1)1981607 - 1804
NM_001204260 (NR3C1)1981607 - 1804
NM_001024094 (NR3C1)1981607 - 1804
NM_001204264 (NR3C1)1981607 - 1804
NM_001204262 (NR3C1)1981607 - 1804
NM_000176 (NR3C1)1981607 - 1804
NM_001018076 (NR3C1)1981233 - 1430
NM_001018074 (NR3C1)1981437 - 1634
NM_001204261 (NR3C1)1981607 - 1804
NM_001018075 (NR3C1)1981340 - 1537
Exon 4 To Exon 5 (Pair 17)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 118 bpgenomic: 85,605
Reverse (2810,20)GTTGAGGAGCTGGATGGAGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204262 (NR3C1)1181607 - 1724
NM_000176 (NR3C1)1181607 - 1724
NM_001024094 (NR3C1)1181607 - 1724
NM_001204264 (NR3C1)1181607 - 1724
NM_001204261 (NR3C1)1181607 - 1724
NM_001018075 (NR3C1)1181340 - 1457
NM_001018074 (NR3C1)1181437 - 1554
NM_001018076 (NR3C1)1181233 - 1350
NM_001018077 (NR3C1)1182109 - 2226
NM_001204265 (NR3C1)1181607 - 1724
NM_001204263 (NR3C1)1181607 - 1724
NM_001204258 (NR3C1)1181607 - 1724
NM_001020825 (NR3C1)1181607 - 1724
NM_001204259 (NR3C1)1181607 - 1724
NM_001204260 (NR3C1)1181607 - 1724
Exon 4 To Exon 5 (Pair 18)
Forward (2495,24)TTCCTGGAGCAAATATAATTGGTAAmplicon SizecDNA: 301 bpgenomic: 85,788
Reverse (2795,21)GGAGGAGAGCTTACATCTGGTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol in 3' area
Forward Dimers-1.792 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTA
CCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGG
ATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATA
GGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTC
GAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTC
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)3011409 - 1709
NM_001204259 (NR3C1)3011409 - 1709
NM_001204263 (NR3C1)3011409 - 1709
NM_001204258 (NR3C1)3011409 - 1709
NM_001020825 (NR3C1)3011409 - 1709
NM_001204265 (NR3C1)3011409 - 1709
NM_001018077 (NR3C1)3011911 - 2211
NM_001018076 (NR3C1)3011035 - 1335
NM_001018074 (NR3C1)3011239 - 1539
NM_001204261 (NR3C1)3011409 - 1709
NM_001018075 (NR3C1)3011142 - 1442
NM_001024094 (NR3C1)3011409 - 1709
NM_001204264 (NR3C1)3011409 - 1709
NM_001204262 (NR3C1)3011409 - 1709
NM_000176 (NR3C1)3011409 - 1709
Exon 4 To Exon 5 (Pair 19)
Forward (2495,24)TTCCTGGAGCAAATATAATTGGTAAmplicon SizecDNA: 297 bpgenomic: 85,784
Reverse (2791,22)GAGAGCTTACATCTGGTCTCATNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol in 3' area
Forward Dimers-1.792 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTA
CCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGG
ATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATA
GGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTC
GAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204264 (NR3C1)2971409 - 1705
NM_001024094 (NR3C1)2971409 - 1705
NM_000176 (NR3C1)2971409 - 1705
NM_001204262 (NR3C1)2971409 - 1705
NM_001018076 (NR3C1)2971035 - 1331
NM_001018074 (NR3C1)2971239 - 1535
NM_001018075 (NR3C1)2971142 - 1438
NM_001204261 (NR3C1)2971409 - 1705
NM_001204259 (NR3C1)2971409 - 1705
NM_001204258 (NR3C1)2971409 - 1705
NM_001020825 (NR3C1)2971409 - 1705
NM_001204263 (NR3C1)2971409 - 1705
NM_001018077 (NR3C1)2971911 - 2207
NM_001204265 (NR3C1)2971409 - 1705
NM_001204260 (NR3C1)2971409 - 1705
Exon 4 To Exon 5 (Pair 20)
Forward (2497,24)CCTGGAGCAAATATAATTGGTAATAmplicon SizecDNA: 295 bpgenomic: 85,782
Reverse (2791,22)GAGAGCTTACATCTGGTCTCATNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.182 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTACC
TCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGAT
CAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGG
TGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGA
ACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204262 (NR3C1)2951411 - 1705
NM_000176 (NR3C1)2951411 - 1705
NM_001024094 (NR3C1)2951411 - 1705
NM_001204264 (NR3C1)2951411 - 1705
NM_001018074 (NR3C1)2951241 - 1535
NM_001204261 (NR3C1)2951411 - 1705
NM_001018075 (NR3C1)2951144 - 1438
NM_001018076 (NR3C1)2951037 - 1331
NM_001204263 (NR3C1)2951411 - 1705
NM_001020825 (NR3C1)2951411 - 1705
NM_001204258 (NR3C1)2951411 - 1705
NM_001204265 (NR3C1)2951411 - 1705
NM_001018077 (NR3C1)2951913 - 2207
NM_001204259 (NR3C1)2951411 - 1705
NM_001204260 (NR3C1)2951411 - 1705
Exon 4 To Exon 5 (Pair 21)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 121 bpgenomic: 85,608
Reverse (2813,20)GCTGTTGAGGAGCTGGATGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.73 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.895 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACAG
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018077 (NR3C1)1212109 - 2229
NM_001204265 (NR3C1)1211607 - 1727
NM_001204258 (NR3C1)1211607 - 1727
NM_001020825 (NR3C1)1211607 - 1727
NM_001204263 (NR3C1)1211607 - 1727
NM_001204259 (NR3C1)1211607 - 1727
NM_001204260 (NR3C1)1211607 - 1727
NM_000176 (NR3C1)1211607 - 1727
NM_001204262 (NR3C1)1211607 - 1727
NM_001204264 (NR3C1)1211607 - 1727
NM_001024094 (NR3C1)1211607 - 1727
NM_001018075 (NR3C1)1211340 - 1460
NM_001204261 (NR3C1)1211607 - 1727
NM_001018074 (NR3C1)1211437 - 1557
NM_001018076 (NR3C1)1211233 - 1353
Exon 4 To Exon 5 (Pair 22)
Forward (2496,24)TCCTGGAGCAAATATAATTGGTAAAmplicon SizecDNA: 299 bpgenomic: 85,786
Reverse (2794,21)GAGGAGAGCTTACATCTGGTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTAC
CTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGA
TCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAG
GTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCG
AACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204265 (NR3C1)2991410 - 1708
NM_001018077 (NR3C1)2991912 - 2210
NM_001204263 (NR3C1)2991410 - 1708
NM_001204258 (NR3C1)2991410 - 1708
NM_001020825 (NR3C1)2991410 - 1708
NM_001204259 (NR3C1)2991410 - 1708
NM_001204260 (NR3C1)2991410 - 1708
NM_001204262 (NR3C1)2991410 - 1708
NM_000176 (NR3C1)2991410 - 1708
NM_001024094 (NR3C1)2991410 - 1708
NM_001204264 (NR3C1)2991410 - 1708
NM_001204261 (NR3C1)2991410 - 1708
NM_001018075 (NR3C1)2991143 - 1441
NM_001018074 (NR3C1)2991240 - 1538
NM_001018076 (NR3C1)2991036 - 1334
Exon 4 To Exon 5 (Pair 23)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 116 bpgenomic: 85,603
Reverse (2808,20)TGAGGAGCTGGATGGAGGAGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-0.962 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)1161607 - 1722
NM_001204263 (NR3C1)1161607 - 1722
NM_001020825 (NR3C1)1161607 - 1722
NM_001204258 (NR3C1)1161607 - 1722
NM_001204265 (NR3C1)1161607 - 1722
NM_001018077 (NR3C1)1162109 - 2224
NM_001204260 (NR3C1)1161607 - 1722
NM_001024094 (NR3C1)1161607 - 1722
NM_001204264 (NR3C1)1161607 - 1722
NM_001204262 (NR3C1)1161607 - 1722
NM_000176 (NR3C1)1161607 - 1722
NM_001018076 (NR3C1)1161233 - 1348
NM_001018074 (NR3C1)1161437 - 1552
NM_001204261 (NR3C1)1161607 - 1722
NM_001018075 (NR3C1)1161340 - 1455
Exon 4 To Exon 5 (Pair 24)
Forward (2572,23)TACCACTATGACATGAATACAGCAmplicon SizecDNA: 228 bpgenomic: 85,715
Reverse (2799,21)GGATGGAGGAGAGCTTACATCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol
Forward Dimers-2.294 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-1.923 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTT
AATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGA
GATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)2281486 - 1713
NM_001204265 (NR3C1)2281486 - 1713
NM_001018077 (NR3C1)2281988 - 2215
NM_001204263 (NR3C1)2281486 - 1713
NM_001204258 (NR3C1)2281486 - 1713
NM_001020825 (NR3C1)2281486 - 1713
NM_001204260 (NR3C1)2281486 - 1713
NM_001024094 (NR3C1)2281486 - 1713
NM_001204264 (NR3C1)2281486 - 1713
NM_001204262 (NR3C1)2281486 - 1713
NM_000176 (NR3C1)2281486 - 1713
NM_001018076 (NR3C1)2281112 - 1339
NM_001204261 (NR3C1)2281486 - 1713
NM_001018075 (NR3C1)2281219 - 1446
NM_001018074 (NR3C1)2281316 - 1543
Exon 4 To Exon 5 (Pair 25)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 96 bpgenomic: 85,583
Reverse (2788,22)AGCTTACATCTGGTCTCATGCTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-1.133 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204263 (NR3C1)961607 - 1702
NM_001020825 (NR3C1)961607 - 1702
NM_001204258 (NR3C1)961607 - 1702
NM_001018077 (NR3C1)962109 - 2204
NM_001204265 (NR3C1)961607 - 1702
NM_001204259 (NR3C1)961607 - 1702
NM_001204260 (NR3C1)961607 - 1702
NM_001204262 (NR3C1)961607 - 1702
NM_000176 (NR3C1)961607 - 1702
NM_001024094 (NR3C1)961607 - 1702
NM_001204264 (NR3C1)961607 - 1702
NM_001018074 (NR3C1)961437 - 1532
NM_001204261 (NR3C1)961607 - 1702
NM_001018075 (NR3C1)961340 - 1435
NM_001018076 (NR3C1)961233 - 1328
Exon 4 To Exon 5 (Pair 26)
Forward (2495,24)TTCCTGGAGCAAATATAATTGGTAAmplicon SizecDNA: 300 bpgenomic: 85,787
Reverse (2794,21)GAGGAGAGCTTACATCTGGTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol in 3' area
Forward Dimers-1.792 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTA
CCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGG
ATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATA
GGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTC
GAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)3001409 - 1708
NM_001204259 (NR3C1)3001409 - 1708
NM_001018077 (NR3C1)3001911 - 2210
NM_001204265 (NR3C1)3001409 - 1708
NM_001204263 (NR3C1)3001409 - 1708
NM_001020825 (NR3C1)3001409 - 1708
NM_001204258 (NR3C1)3001409 - 1708
NM_001018076 (NR3C1)3001035 - 1334
NM_001204261 (NR3C1)3001409 - 1708
NM_001018075 (NR3C1)3001142 - 1441
NM_001018074 (NR3C1)3001239 - 1538
NM_001024094 (NR3C1)3001409 - 1708
NM_001204264 (NR3C1)3001409 - 1708
NM_001204262 (NR3C1)3001409 - 1708
NM_000176 (NR3C1)3001409 - 1708
Exon 4 To Exon 5 (Pair 27)
Forward (2582,23)ACATGAATACAGCATCCCTTTCTAmplicon SizecDNA: 209 bpgenomic: 85,696
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCATTC
CACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAACT
TGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTCAA
GCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018077 (NR3C1)2091998 - 2206
NM_001204265 (NR3C1)2091496 - 1704
NM_001204263 (NR3C1)2091496 - 1704
NM_001020825 (NR3C1)2091496 - 1704
NM_001204258 (NR3C1)2091496 - 1704
NM_001204259 (NR3C1)2091496 - 1704
NM_001204260 (NR3C1)2091496 - 1704
NM_001204262 (NR3C1)2091496 - 1704
NM_000176 (NR3C1)2091496 - 1704
NM_001024094 (NR3C1)2091496 - 1704
NM_001204264 (NR3C1)2091496 - 1704
NM_001204261 (NR3C1)2091496 - 1704
NM_001018075 (NR3C1)2091229 - 1437
NM_001018074 (NR3C1)2091326 - 1534
NM_001018076 (NR3C1)2091122 - 1330
Exon 4 To Exon 5 (Pair 28)
Forward (2578,23)TATGACATGAATACAGCATCCCTAmplicon SizecDNA: 214 bpgenomic: 85,701
Reverse (2791,22)GAGAGCTTACATCTGGTCTCATNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.668 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTC
ATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGAC
AACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTAT
TCAAGCCCCAGCATGAGACCAGATGTAAGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2141492 - 1705
NM_001018077 (NR3C1)2141994 - 2207
NM_001204265 (NR3C1)2141492 - 1705
NM_001020825 (NR3C1)2141492 - 1705
NM_001204258 (NR3C1)2141492 - 1705
NM_001204263 (NR3C1)2141492 - 1705
NM_001204259 (NR3C1)2141492 - 1705
NM_001018075 (NR3C1)2141225 - 1438
NM_001204261 (NR3C1)2141492 - 1705
NM_001018074 (NR3C1)2141322 - 1535
NM_001018076 (NR3C1)2141118 - 1331
NM_000176 (NR3C1)2141492 - 1705
NM_001204262 (NR3C1)2141492 - 1705
NM_001204264 (NR3C1)2141492 - 1705
NM_001024094 (NR3C1)2141492 - 1705
Exon 4 To Exon 5 (Pair 29)
Forward (2584,23)ATGAATACAGCATCCCTTTCTCAAmplicon SizecDNA: 212 bpgenomic: 85,699
Reverse (2795,21)GGAGGAGAGCTTACATCTGGTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCATTCCA
CCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAACTTG
ACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTCAAGC
CCCAGCATGAGACCAGATGTAAGCTCTCCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000176 (NR3C1)2121498 - 1709
NM_001204262 (NR3C1)2121498 - 1709
NM_001204264 (NR3C1)2121498 - 1709
NM_001024094 (NR3C1)2121498 - 1709
NM_001018075 (NR3C1)2121231 - 1442
NM_001204261 (NR3C1)2121498 - 1709
NM_001018074 (NR3C1)2121328 - 1539
NM_001018076 (NR3C1)2121124 - 1335
NM_001204265 (NR3C1)2121498 - 1709
NM_001018077 (NR3C1)2122000 - 2211
NM_001204258 (NR3C1)2121498 - 1709
NM_001020825 (NR3C1)2121498 - 1709
NM_001204263 (NR3C1)2121498 - 1709
NM_001204259 (NR3C1)2121498 - 1709
NM_001204260 (NR3C1)2121498 - 1709
Exon 4 To Exon 5 (Pair 30)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 122 bpgenomic: 85,609
Reverse (2813,20)GCTGTTGAGGAGCTGGATGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.73 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.895 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACA
GC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204264 (NR3C1)1221606 - 1727
NM_001024094 (NR3C1)1221606 - 1727
NM_000176 (NR3C1)1221606 - 1727
NM_001204262 (NR3C1)1221606 - 1727
NM_001018076 (NR3C1)1221232 - 1353
NM_001018074 (NR3C1)1221436 - 1557
NM_001018075 (NR3C1)1221339 - 1460
NM_001204261 (NR3C1)1221606 - 1727
NM_001204259 (NR3C1)1221606 - 1727
NM_001020825 (NR3C1)1221606 - 1727
NM_001204258 (NR3C1)1221606 - 1727
NM_001204263 (NR3C1)1221606 - 1727
NM_001018077 (NR3C1)1222108 - 2229
NM_001204265 (NR3C1)1221606 - 1727
NM_001204260 (NR3C1)1221606 - 1727
Exon 4 To Exon 5 (Pair 31)
Forward (2578,23)TATGACATGAATACAGCATCCCTAmplicon SizecDNA: 219 bpgenomic: 85,706
Reverse (2796,21)TGGAGGAGAGCTTACATCTGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.668 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTC
ATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGAC
AACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTAT
TCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2191492 - 1710
NM_001204259 (NR3C1)2191492 - 1710
NM_001018077 (NR3C1)2191994 - 2212
NM_001204265 (NR3C1)2191492 - 1710
NM_001204263 (NR3C1)2191492 - 1710
NM_001020825 (NR3C1)2191492 - 1710
NM_001204258 (NR3C1)2191492 - 1710
NM_001018076 (NR3C1)2191118 - 1336
NM_001204261 (NR3C1)2191492 - 1710
NM_001018075 (NR3C1)2191225 - 1443
NM_001018074 (NR3C1)2191322 - 1540
NM_001024094 (NR3C1)2191492 - 1710
NM_001204264 (NR3C1)2191492 - 1710
NM_001204262 (NR3C1)2191492 - 1710
NM_000176 (NR3C1)2191492 - 1710
Exon 4 To Exon 5 (Pair 32)
Forward (2495,24)TTCCTGGAGCAAATATAATTGGTAAmplicon SizecDNA: 298 bpgenomic: 85,785
Reverse (2792,21)GGAGAGCTTACATCTGGTCTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol in 3' area
Forward Dimers-1.792 kcal/mol
Reverse Loops1.073 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTA
CCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGG
ATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATA
GGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTC
GAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)2981035 - 1332
NM_001018074 (NR3C1)2981239 - 1536
NM_001018075 (NR3C1)2981142 - 1439
NM_001204261 (NR3C1)2981409 - 1706
NM_001204264 (NR3C1)2981409 - 1706
NM_001024094 (NR3C1)2981409 - 1706
NM_000176 (NR3C1)2981409 - 1706
NM_001204262 (NR3C1)2981409 - 1706
NM_001204260 (NR3C1)2981409 - 1706
NM_001204259 (NR3C1)2981409 - 1706
NM_001204258 (NR3C1)2981409 - 1706
NM_001020825 (NR3C1)2981409 - 1706
NM_001204263 (NR3C1)2981409 - 1706
NM_001204265 (NR3C1)2981409 - 1706
NM_001018077 (NR3C1)2981911 - 2208
Exon 4 To Exon 5 (Pair 33)
Forward (2490,24)AAGCTTTCCTGGAGCAAATATAATAmplicon SizecDNA: 299 bpgenomic: 85,786
Reverse (2788,22)AGCTTACATCTGGTCTCATGCTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.522 kcal/mol
Forward Dimers-2.904 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-2.822 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceAAGCTTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGT
GAGTACCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACA
GCAGGATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTG
GAATAGGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCC
TGGTCGAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2991404 - 1702
NM_001018077 (NR3C1)2991906 - 2204
NM_001204265 (NR3C1)2991404 - 1702
NM_001204263 (NR3C1)2991404 - 1702
NM_001204258 (NR3C1)2991404 - 1702
NM_001020825 (NR3C1)2991404 - 1702
NM_001204259 (NR3C1)2991404 - 1702
NM_001204261 (NR3C1)2991404 - 1702
NM_001018075 (NR3C1)2991137 - 1435
NM_001018074 (NR3C1)2991234 - 1532
NM_001018076 (NR3C1)2991030 - 1328
NM_001204262 (NR3C1)2991404 - 1702
NM_000176 (NR3C1)2991404 - 1702
NM_001024094 (NR3C1)2991404 - 1702
NM_001204264 (NR3C1)2991404 - 1702
Exon 4 To Exon 5 (Pair 34)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 193 bpgenomic: 85,680
Reverse (2885,23)AAGACTCCATAATGACATCCTGANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.398 kcal/mol
Forward-Reverse Dimers-1.172 kcal/mol
Amplicon Folding-2.359 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACAG
CAACAACAGGACCACCTCCCAAACTCTGCCTGGTGTGCTCTGATGAAGCTTCAGGATGTC
ATTATGGAGTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)1931607 - 1799
NM_001020825 (NR3C1)1931607 - 1799
NM_001204258 (NR3C1)1931607 - 1799
NM_001204263 (NR3C1)1931607 - 1799
NM_001018077 (NR3C1)1932109 - 2301
NM_001204265 (NR3C1)1931607 - 1799
NM_001204259 (NR3C1)1931607 - 1799
NM_001018074 (NR3C1)1931437 - 1629
NM_001018075 (NR3C1)1931340 - 1532
NM_001204261 (NR3C1)1931607 - 1799
NM_001018076 (NR3C1)1931233 - 1425
NM_000176 (NR3C1)1931607 - 1799
NM_001204262 (NR3C1)1931607 - 1799
NM_001204264 (NR3C1)1931607 - 1799
NM_001024094 (NR3C1)1931607 - 1799
Exon 4 To Exon 5 (Pair 35)
Forward (2584,23)ATGAATACAGCATCCCTTTCTCAAmplicon SizecDNA: 207 bpgenomic: 85,694
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCATTCCA
CCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAACTTG
ACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTCAAGC
CCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000176 (NR3C1)2071498 - 1704
NM_001204262 (NR3C1)2071498 - 1704
NM_001204264 (NR3C1)2071498 - 1704
NM_001024094 (NR3C1)2071498 - 1704
NM_001018075 (NR3C1)2071231 - 1437
NM_001204261 (NR3C1)2071498 - 1704
NM_001018074 (NR3C1)2071328 - 1534
NM_001018076 (NR3C1)2071124 - 1330
NM_001204265 (NR3C1)2071498 - 1704
NM_001018077 (NR3C1)2072000 - 2206
NM_001020825 (NR3C1)2071498 - 1704
NM_001204258 (NR3C1)2071498 - 1704
NM_001204263 (NR3C1)2071498 - 1704
NM_001204259 (NR3C1)2071498 - 1704
NM_001204260 (NR3C1)2071498 - 1704
Exon 4 To Exon 5 (Pair 36)
Forward (2494,24)TTTCCTGGAGCAAATATAATTGGTAmplicon SizecDNA: 299 bpgenomic: 85,786
Reverse (2792,21)GGAGAGCTTACATCTGGTCTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol in 3' area
Forward Dimers-1.792 kcal/mol
Reverse Loops1.073 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGT
ACCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAG
GATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAAT
AGGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGT
CGAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2991408 - 1706
NM_001204259 (NR3C1)2991408 - 1706
NM_001204258 (NR3C1)2991408 - 1706
NM_001020825 (NR3C1)2991408 - 1706
NM_001204263 (NR3C1)2991408 - 1706
NM_001018077 (NR3C1)2991910 - 2208
NM_001204265 (NR3C1)2991408 - 1706
NM_001018076 (NR3C1)2991034 - 1332
NM_001018074 (NR3C1)2991238 - 1536
NM_001018075 (NR3C1)2991141 - 1439
NM_001204261 (NR3C1)2991408 - 1706
NM_001204264 (NR3C1)2991408 - 1706
NM_001024094 (NR3C1)2991408 - 1706
NM_000176 (NR3C1)2991408 - 1706
NM_001204262 (NR3C1)2991408 - 1706
Exon 4 To Exon 5 (Pair 37)
Forward (2582,23)ACATGAATACAGCATCCCTTTCTAmplicon SizecDNA: 211 bpgenomic: 85,698
Reverse (2792,21)GGAGAGCTTACATCTGGTCTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCATTC
CACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAACT
TGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTCAA
GCCCCAGCATGAGACCAGATGTAAGCTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000176 (NR3C1)2111496 - 1706
NM_001204262 (NR3C1)2111496 - 1706
NM_001204264 (NR3C1)2111496 - 1706
NM_001024094 (NR3C1)2111496 - 1706
NM_001018075 (NR3C1)2111229 - 1439
NM_001204261 (NR3C1)2111496 - 1706
NM_001018074 (NR3C1)2111326 - 1536
NM_001018076 (NR3C1)2111122 - 1332
NM_001204265 (NR3C1)2111496 - 1706
NM_001018077 (NR3C1)2111998 - 2208
NM_001204258 (NR3C1)2111496 - 1706
NM_001020825 (NR3C1)2111496 - 1706
NM_001204263 (NR3C1)2111496 - 1706
NM_001204259 (NR3C1)2111496 - 1706
NM_001204260 (NR3C1)2111496 - 1706
Exon 4 To Exon 5 (Pair 38)
Forward (2584,23)ATGAATACAGCATCCCTTTCTCAAmplicon SizecDNA: 216 bpgenomic: 85,703
Reverse (2799,21)GGATGGAGGAGAGCTTACATCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCATTCCA
CCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAACTTG
ACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTCAAGC
CCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204263 (NR3C1)2161498 - 1713
NM_001020825 (NR3C1)2161498 - 1713
NM_001204258 (NR3C1)2161498 - 1713
NM_001018077 (NR3C1)2162000 - 2215
NM_001204265 (NR3C1)2161498 - 1713
NM_001204259 (NR3C1)2161498 - 1713
NM_001204260 (NR3C1)2161498 - 1713
NM_001204262 (NR3C1)2161498 - 1713
NM_000176 (NR3C1)2161498 - 1713
NM_001024094 (NR3C1)2161498 - 1713
NM_001204264 (NR3C1)2161498 - 1713
NM_001018074 (NR3C1)2161328 - 1543
NM_001204261 (NR3C1)2161498 - 1713
NM_001018075 (NR3C1)2161231 - 1446
NM_001018076 (NR3C1)2161124 - 1339
Exon 4 To Exon 5 (Pair 39)
Forward (2578,23)TATGACATGAATACAGCATCCCTAmplicon SizecDNA: 218 bpgenomic: 85,705
Reverse (2795,21)GGAGGAGAGCTTACATCTGGTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.668 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTC
ATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGAC
AACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTAT
TCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2181492 - 1709
NM_001204259 (NR3C1)2181492 - 1709
NM_001204258 (NR3C1)2181492 - 1709
NM_001020825 (NR3C1)2181492 - 1709
NM_001204263 (NR3C1)2181492 - 1709
NM_001018077 (NR3C1)2181994 - 2211
NM_001204265 (NR3C1)2181492 - 1709
NM_001018076 (NR3C1)2181118 - 1335
NM_001018074 (NR3C1)2181322 - 1539
NM_001018075 (NR3C1)2181225 - 1442
NM_001204261 (NR3C1)2181492 - 1709
NM_001204264 (NR3C1)2181492 - 1709
NM_001024094 (NR3C1)2181492 - 1709
NM_000176 (NR3C1)2181492 - 1709
NM_001204262 (NR3C1)2181492 - 1709
Exon 4 To Exon 5 (Pair 40)
Forward (2497,24)CCTGGAGCAAATATAATTGGTAATAmplicon SizecDNA: 296 bpgenomic: 85,783
Reverse (2792,21)GGAGAGCTTACATCTGGTCTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.182 kcal/mol
Reverse Loops1.073 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTACC
TCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGAT
CAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGG
TGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGA
ACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2961411 - 1706
NM_001204259 (NR3C1)2961411 - 1706
NM_001204263 (NR3C1)2961411 - 1706
NM_001204258 (NR3C1)2961411 - 1706
NM_001020825 (NR3C1)2961411 - 1706
NM_001018077 (NR3C1)2961913 - 2208
NM_001204265 (NR3C1)2961411 - 1706
NM_001018076 (NR3C1)2961037 - 1332
NM_001018074 (NR3C1)2961241 - 1536
NM_001204261 (NR3C1)2961411 - 1706
NM_001018075 (NR3C1)2961144 - 1439
NM_001024094 (NR3C1)2961411 - 1706
NM_001204264 (NR3C1)2961411 - 1706
NM_001204262 (NR3C1)2961411 - 1706
NM_000176 (NR3C1)2961411 - 1706
Exon 4 To Exon 5 (Pair 41)
Forward (2584,23)ATGAATACAGCATCCCTTTCTCAAmplicon SizecDNA: 209 bpgenomic: 85,696
Reverse (2792,21)GGAGAGCTTACATCTGGTCTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.073 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCATTCCA
CCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAACTTG
ACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTCAAGC
CCCAGCATGAGACCAGATGTAAGCTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001024094 (NR3C1)2091498 - 1706
NM_001204264 (NR3C1)2091498 - 1706
NM_001204262 (NR3C1)2091498 - 1706
NM_000176 (NR3C1)2091498 - 1706
NM_001018076 (NR3C1)2091124 - 1332
NM_001204261 (NR3C1)2091498 - 1706
NM_001018075 (NR3C1)2091231 - 1439
NM_001018074 (NR3C1)2091328 - 1536
NM_001204259 (NR3C1)2091498 - 1706
NM_001204265 (NR3C1)2091498 - 1706
NM_001018077 (NR3C1)2092000 - 2208
NM_001204263 (NR3C1)2091498 - 1706
NM_001204258 (NR3C1)2091498 - 1706
NM_001020825 (NR3C1)2091498 - 1706
NM_001204260 (NR3C1)2091498 - 1706
Exon 4 To Exon 5 (Pair 42)
Forward (2584,23)ATGAATACAGCATCCCTTTCTCAAmplicon SizecDNA: 213 bpgenomic: 85,700
Reverse (2796,21)TGGAGGAGAGCTTACATCTGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCATTCCA
CCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAACTTG
ACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTCAAGC
CCCAGCATGAGACCAGATGTAAGCTCTCCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)2131498 - 1710
NM_001018077 (NR3C1)2132000 - 2212
NM_001204265 (NR3C1)2131498 - 1710
NM_001204258 (NR3C1)2131498 - 1710
NM_001020825 (NR3C1)2131498 - 1710
NM_001204263 (NR3C1)2131498 - 1710
NM_001204260 (NR3C1)2131498 - 1710
NM_001204264 (NR3C1)2131498 - 1710
NM_001024094 (NR3C1)2131498 - 1710
NM_000176 (NR3C1)2131498 - 1710
NM_001204262 (NR3C1)2131498 - 1710
NM_001018076 (NR3C1)2131124 - 1336
NM_001018075 (NR3C1)2131231 - 1443
NM_001204261 (NR3C1)2131498 - 1710
NM_001018074 (NR3C1)2131328 - 1540
Exon 4 To Exon 5 (Pair 43)
Forward (2495,24)TTCCTGGAGCAAATATAATTGGTAAmplicon SizecDNA: 296 bpgenomic: 85,783
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol in 3' area
Forward Dimers-1.792 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTA
CCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGG
ATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATA
GGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTC
GAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204262 (NR3C1)2961409 - 1704
NM_000176 (NR3C1)2961409 - 1704
NM_001024094 (NR3C1)2961409 - 1704
NM_001204264 (NR3C1)2961409 - 1704
NM_001018074 (NR3C1)2961239 - 1534
NM_001204261 (NR3C1)2961409 - 1704
NM_001018075 (NR3C1)2961142 - 1437
NM_001018076 (NR3C1)2961035 - 1330
NM_001204263 (NR3C1)2961409 - 1704
NM_001204258 (NR3C1)2961409 - 1704
NM_001020825 (NR3C1)2961409 - 1704
NM_001018077 (NR3C1)2961911 - 2206
NM_001204265 (NR3C1)2961409 - 1704
NM_001204259 (NR3C1)2961409 - 1704
NM_001204260 (NR3C1)2961409 - 1704
Exon 4 To Exon 5 (Pair 44)
Forward (2572,23)TACCACTATGACATGAATACAGCAmplicon SizecDNA: 217 bpgenomic: 85,704
Reverse (2788,22)AGCTTACATCTGGTCTCATGCTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-1.996 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTT
AATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGA
GATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)2171112 - 1328
NM_001018075 (NR3C1)2171219 - 1435
NM_001204261 (NR3C1)2171486 - 1702
NM_001018074 (NR3C1)2171316 - 1532
NM_001204264 (NR3C1)2171486 - 1702
NM_001024094 (NR3C1)2171486 - 1702
NM_000176 (NR3C1)2171486 - 1702
NM_001204262 (NR3C1)2171486 - 1702
NM_001204260 (NR3C1)2171486 - 1702
NM_001204259 (NR3C1)2171486 - 1702
NM_001204265 (NR3C1)2171486 - 1702
NM_001018077 (NR3C1)2171988 - 2204
NM_001020825 (NR3C1)2171486 - 1702
NM_001204258 (NR3C1)2171486 - 1702
NM_001204263 (NR3C1)2171486 - 1702
Exon 4 To Exon 5 (Pair 45)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 190 bpgenomic: 85,677
Reverse (2881,22)CTCCATAATGACATCCTGAAGCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.398 kcal/mol
Forward-Reverse Dimers-1.696 kcal/mol
Amplicon Folding-2.359 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACA
GCAACAACAGGACCACCTCCCAAACTCTGCCTGGTGTGCTCTGATGAAGCTTCAGGATGT
CATTATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)1901232 - 1421
NM_001018074 (NR3C1)1901436 - 1625
NM_001018075 (NR3C1)1901339 - 1528
NM_001204261 (NR3C1)1901606 - 1795
NM_001204264 (NR3C1)1901606 - 1795
NM_001024094 (NR3C1)1901606 - 1795
NM_000176 (NR3C1)1901606 - 1795
NM_001204262 (NR3C1)1901606 - 1795
NM_001204260 (NR3C1)1901606 - 1795
NM_001204259 (NR3C1)1901606 - 1795
NM_001204258 (NR3C1)1901606 - 1795
NM_001020825 (NR3C1)1901606 - 1795
NM_001204263 (NR3C1)1901606 - 1795
NM_001204265 (NR3C1)1901606 - 1795
NM_001018077 (NR3C1)1902108 - 2297
Exon 4 To Exon 5 (Pair 46)
Forward (2496,24)TCCTGGAGCAAATATAATTGGTAAAmplicon SizecDNA: 296 bpgenomic: 85,783
Reverse (2791,22)GAGAGCTTACATCTGGTCTCATNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTAC
CTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGA
TCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAG
GTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCG
AACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2961410 - 1705
NM_001204259 (NR3C1)2961410 - 1705
NM_001018077 (NR3C1)2961912 - 2207
NM_001204265 (NR3C1)2961410 - 1705
NM_001020825 (NR3C1)2961410 - 1705
NM_001204258 (NR3C1)2961410 - 1705
NM_001204263 (NR3C1)2961410 - 1705
NM_001018076 (NR3C1)2961036 - 1331
NM_001018075 (NR3C1)2961143 - 1438
NM_001204261 (NR3C1)2961410 - 1705
NM_001018074 (NR3C1)2961240 - 1535
NM_001204264 (NR3C1)2961410 - 1705
NM_001024094 (NR3C1)2961410 - 1705
NM_000176 (NR3C1)2961410 - 1705
NM_001204262 (NR3C1)2961410 - 1705
Exon 4 To Exon 5 (Pair 47)
Forward (2579,23)ATGACATGAATACAGCATCCCTTAmplicon SizecDNA: 214 bpgenomic: 85,701
Reverse (2792,21)GGAGAGCTTACATCTGGTCTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCA
TTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACA
ACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATT
CAAGCCCCAGCATGAGACCAGATGTAAGCTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018075 (NR3C1)2141226 - 1439
NM_001204261 (NR3C1)2141493 - 1706
NM_001018074 (NR3C1)2141323 - 1536
NM_001018076 (NR3C1)2141119 - 1332
NM_000176 (NR3C1)2141493 - 1706
NM_001204262 (NR3C1)2141493 - 1706
NM_001204264 (NR3C1)2141493 - 1706
NM_001024094 (NR3C1)2141493 - 1706
NM_001204260 (NR3C1)2141493 - 1706
NM_001204265 (NR3C1)2141493 - 1706
NM_001018077 (NR3C1)2141995 - 2208
NM_001204258 (NR3C1)2141493 - 1706
NM_001020825 (NR3C1)2141493 - 1706
NM_001204263 (NR3C1)2141493 - 1706
NM_001204259 (NR3C1)2141493 - 1706
Exon 4 To Exon 5 (Pair 48)
Forward (2491,24)AGCTTTCCTGGAGCAAATATAATTAmplicon SizecDNA: 301 bpgenomic: 85,788
Reverse (2791,22)GAGAGCTTACATCTGGTCTCATNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.522 kcal/mol
Forward Dimers-1.822 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.844 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceAGCTTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTG
AGTACCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAG
CAGGATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGG
AATAGGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCT
GGTCGAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204264 (NR3C1)3011405 - 1705
NM_001024094 (NR3C1)3011405 - 1705
NM_000176 (NR3C1)3011405 - 1705
NM_001204262 (NR3C1)3011405 - 1705
NM_001018076 (NR3C1)3011031 - 1331
NM_001018074 (NR3C1)3011235 - 1535
NM_001018075 (NR3C1)3011138 - 1438
NM_001204261 (NR3C1)3011405 - 1705
NM_001204259 (NR3C1)3011405 - 1705
NM_001204258 (NR3C1)3011405 - 1705
NM_001020825 (NR3C1)3011405 - 1705
NM_001204263 (NR3C1)3011405 - 1705
NM_001204265 (NR3C1)3011405 - 1705
NM_001018077 (NR3C1)3011907 - 2207
NM_001204260 (NR3C1)3011405 - 1705
Exon 4 To Exon 5 (Pair 49)
Forward (2572,23)TACCACTATGACATGAATACAGCAmplicon SizecDNA: 220 bpgenomic: 85,707
Reverse (2791,22)GAGAGCTTACATCTGGTCTCATNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-1.996 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTT
AATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGA
GATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018075 (NR3C1)2201219 - 1438
NM_001204261 (NR3C1)2201486 - 1705
NM_001018074 (NR3C1)2201316 - 1535
NM_001018076 (NR3C1)2201112 - 1331
NM_000176 (NR3C1)2201486 - 1705
NM_001204262 (NR3C1)2201486 - 1705
NM_001204264 (NR3C1)2201486 - 1705
NM_001024094 (NR3C1)2201486 - 1705
NM_001204260 (NR3C1)2201486 - 1705
NM_001018077 (NR3C1)2201988 - 2207
NM_001204265 (NR3C1)2201486 - 1705
NM_001020825 (NR3C1)2201486 - 1705
NM_001204258 (NR3C1)2201486 - 1705
NM_001204263 (NR3C1)2201486 - 1705
NM_001204259 (NR3C1)2201486 - 1705
Exon 4 To Exon 5 (Pair 50)
Forward (2572,23)TACCACTATGACATGAATACAGCAmplicon SizecDNA: 219 bpgenomic: 85,706
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.745 kcal/mol
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-1.996 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTT
AATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGA
GATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001024094 (NR3C1)2191486 - 1704
NM_001204264 (NR3C1)2191486 - 1704
NM_001204262 (NR3C1)2191486 - 1704
NM_000176 (NR3C1)2191486 - 1704
NM_001018076 (NR3C1)2191112 - 1330
NM_001204261 (NR3C1)2191486 - 1704
NM_001018075 (NR3C1)2191219 - 1437
NM_001018074 (NR3C1)2191316 - 1534
NM_001204259 (NR3C1)2191486 - 1704
NM_001204265 (NR3C1)2191486 - 1704
NM_001018077 (NR3C1)2191988 - 2206
NM_001204263 (NR3C1)2191486 - 1704
NM_001204258 (NR3C1)2191486 - 1704
NM_001020825 (NR3C1)2191486 - 1704
NM_001204260 (NR3C1)2191486 - 1704
Exon 4 To Exon 5 (Pair 51)
Forward (2496,24)TCCTGGAGCAAATATAATTGGTAAAmplicon SizecDNA: 301 bpgenomic: 85,788
Reverse (2796,21)TGGAGGAGAGCTTACATCTGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTAC
CTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGA
TCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAG
GTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCG
AACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCC
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)3011410 - 1710
NM_001020825 (NR3C1)3011410 - 1710
NM_001204258 (NR3C1)3011410 - 1710
NM_001204263 (NR3C1)3011410 - 1710
NM_001018077 (NR3C1)3011912 - 2212
NM_001204265 (NR3C1)3011410 - 1710
NM_001204260 (NR3C1)3011410 - 1710
NM_001204264 (NR3C1)3011410 - 1710
NM_001024094 (NR3C1)3011410 - 1710
NM_000176 (NR3C1)3011410 - 1710
NM_001204262 (NR3C1)3011410 - 1710
NM_001018076 (NR3C1)3011036 - 1336
NM_001018074 (NR3C1)3011240 - 1540
NM_001018075 (NR3C1)3011143 - 1443
NM_001204261 (NR3C1)3011410 - 1710
Exon 4 To Exon 5 (Pair 52)
Forward (2494,24)TTTCCTGGAGCAAATATAATTGGTAmplicon SizecDNA: 301 bpgenomic: 85,788
Reverse (2794,21)GAGGAGAGCTTACATCTGGTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol in 3' area
Forward Dimers-1.792 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGT
ACCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAG
GATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAAT
AGGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGT
CGAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)3011408 - 1708
NM_001204265 (NR3C1)3011408 - 1708
NM_001018077 (NR3C1)3011910 - 2210
NM_001020825 (NR3C1)3011408 - 1708
NM_001204258 (NR3C1)3011408 - 1708
NM_001204263 (NR3C1)3011408 - 1708
NM_001204259 (NR3C1)3011408 - 1708
NM_001018075 (NR3C1)3011141 - 1441
NM_001204261 (NR3C1)3011408 - 1708
NM_001018074 (NR3C1)3011238 - 1538
NM_001018076 (NR3C1)3011034 - 1334
NM_000176 (NR3C1)3011408 - 1708
NM_001204262 (NR3C1)3011408 - 1708
NM_001204264 (NR3C1)3011408 - 1708
NM_001024094 (NR3C1)3011408 - 1708
Exon 4 To Exon 5 (Pair 53)
Forward (2497,24)CCTGGAGCAAATATAATTGGTAATAmplicon SizecDNA: 298 bpgenomic: 85,785
Reverse (2794,21)GAGGAGAGCTTACATCTGGTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.182 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTACC
TCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGAT
CAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGG
TGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGA
ACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)2981037 - 1334
NM_001018074 (NR3C1)2981241 - 1538
NM_001204261 (NR3C1)2981411 - 1708
NM_001018075 (NR3C1)2981144 - 1441
NM_001024094 (NR3C1)2981411 - 1708
NM_001204264 (NR3C1)2981411 - 1708
NM_001204262 (NR3C1)2981411 - 1708
NM_000176 (NR3C1)2981411 - 1708
NM_001204260 (NR3C1)2981411 - 1708
NM_001204259 (NR3C1)2981411 - 1708
NM_001204263 (NR3C1)2981411 - 1708
NM_001204258 (NR3C1)2981411 - 1708
NM_001020825 (NR3C1)2981411 - 1708
NM_001018077 (NR3C1)2981913 - 2210
NM_001204265 (NR3C1)2981411 - 1708
Exon 4 To Exon 5 (Pair 54)
Forward (2497,24)CCTGGAGCAAATATAATTGGTAATAmplicon SizecDNA: 294 bpgenomic: 85,781
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.182 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTACC
TCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGAT
CAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGG
TGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGA
ACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)2941411 - 1704
NM_001018077 (NR3C1)2941913 - 2206
NM_001204265 (NR3C1)2941411 - 1704
NM_001020825 (NR3C1)2941411 - 1704
NM_001204258 (NR3C1)2941411 - 1704
NM_001204263 (NR3C1)2941411 - 1704
NM_001204260 (NR3C1)2941411 - 1704
NM_001204264 (NR3C1)2941411 - 1704
NM_001024094 (NR3C1)2941411 - 1704
NM_000176 (NR3C1)2941411 - 1704
NM_001204262 (NR3C1)2941411 - 1704
NM_001018076 (NR3C1)2941037 - 1330
NM_001018075 (NR3C1)2941144 - 1437
NM_001204261 (NR3C1)2941411 - 1704
NM_001018074 (NR3C1)2941241 - 1534
Exon 4 To Exon 5 (Pair 55)
Forward (2579,23)ATGACATGAATACAGCATCCCTTAmplicon SizecDNA: 213 bpgenomic: 85,700
Reverse (2791,22)GAGAGCTTACATCTGGTCTCATNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCA
TTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACA
ACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATT
CAAGCCCCAGCATGAGACCAGATGTAAGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001024094 (NR3C1)2131493 - 1705
NM_001204264 (NR3C1)2131493 - 1705
NM_001204262 (NR3C1)2131493 - 1705
NM_000176 (NR3C1)2131493 - 1705
NM_001018076 (NR3C1)2131119 - 1331
NM_001018074 (NR3C1)2131323 - 1535
NM_001204261 (NR3C1)2131493 - 1705
NM_001018075 (NR3C1)2131226 - 1438
NM_001204259 (NR3C1)2131493 - 1705
NM_001204263 (NR3C1)2131493 - 1705
NM_001020825 (NR3C1)2131493 - 1705
NM_001204258 (NR3C1)2131493 - 1705
NM_001204265 (NR3C1)2131493 - 1705
NM_001018077 (NR3C1)2131995 - 2207
NM_001204260 (NR3C1)2131493 - 1705
Exon 4 To Exon 5 (Pair 56)
Forward (2579,23)ATGACATGAATACAGCATCCCTTAmplicon SizecDNA: 212 bpgenomic: 85,699
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceATGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCA
TTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACA
ACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATT
CAAGCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2121493 - 1704
NM_001018077 (NR3C1)2121995 - 2206
NM_001204265 (NR3C1)2121493 - 1704
NM_001204263 (NR3C1)2121493 - 1704
NM_001020825 (NR3C1)2121493 - 1704
NM_001204258 (NR3C1)2121493 - 1704
NM_001204259 (NR3C1)2121493 - 1704
NM_001204261 (NR3C1)2121493 - 1704
NM_001018075 (NR3C1)2121226 - 1437
NM_001018074 (NR3C1)2121323 - 1534
NM_001018076 (NR3C1)2121119 - 1330
NM_001204262 (NR3C1)2121493 - 1704
NM_000176 (NR3C1)2121493 - 1704
NM_001024094 (NR3C1)2121493 - 1704
NM_001204264 (NR3C1)2121493 - 1704
Exon 4 To Exon 5 (Pair 57)
Forward (2496,24)TCCTGGAGCAAATATAATTGGTAAAmplicon SizecDNA: 300 bpgenomic: 85,787
Reverse (2795,21)GGAGGAGAGCTTACATCTGGTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTAC
CTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGA
TCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAG
GTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCG
AACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018074 (NR3C1)3001240 - 1539
NM_001018075 (NR3C1)3001143 - 1442
NM_001204261 (NR3C1)3001410 - 1709
NM_001018076 (NR3C1)3001036 - 1335
NM_000176 (NR3C1)3001410 - 1709
NM_001204262 (NR3C1)3001410 - 1709
NM_001204264 (NR3C1)3001410 - 1709
NM_001024094 (NR3C1)3001410 - 1709
NM_001204260 (NR3C1)3001410 - 1709
NM_001020825 (NR3C1)3001410 - 1709
NM_001204258 (NR3C1)3001410 - 1709
NM_001204263 (NR3C1)3001410 - 1709
NM_001204265 (NR3C1)3001410 - 1709
NM_001018077 (NR3C1)3001912 - 2211
NM_001204259 (NR3C1)3001410 - 1709
Exon 4 To Exon 5 (Pair 58)
Forward (2582,23)ACATGAATACAGCATCCCTTTCTAmplicon SizecDNA: 210 bpgenomic: 85,697
Reverse (2791,22)GAGAGCTTACATCTGGTCTCATNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCATTC
CACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAACT
TGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTCAA
GCCCCAGCATGAGACCAGATGTAAGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018075 (NR3C1)2101229 - 1438
NM_001204261 (NR3C1)2101496 - 1705
NM_001018074 (NR3C1)2101326 - 1535
NM_001018076 (NR3C1)2101122 - 1331
NM_000176 (NR3C1)2101496 - 1705
NM_001204262 (NR3C1)2101496 - 1705
NM_001204264 (NR3C1)2101496 - 1705
NM_001024094 (NR3C1)2101496 - 1705
NM_001204260 (NR3C1)2101496 - 1705
NM_001204265 (NR3C1)2101496 - 1705
NM_001018077 (NR3C1)2101998 - 2207
NM_001204258 (NR3C1)2101496 - 1705
NM_001020825 (NR3C1)2101496 - 1705
NM_001204263 (NR3C1)2101496 - 1705
NM_001204259 (NR3C1)2101496 - 1705
Exon 4 To Exon 5 (Pair 59)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 194 bpgenomic: 85,681
Reverse (2885,23)AAGACTCCATAATGACATCCTGANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.413 kcal/mol in 3' area
Reverse Dimers-1.398 kcal/mol
Forward-Reverse Dimers-1.696 kcal/mol
Amplicon Folding-2.359 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACA
GCAACAACAGGACCACCTCCCAAACTCTGCCTGGTGTGCTCTGATGAAGCTTCAGGATGT
CATTATGGAGTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)1941232 - 1425
NM_001018074 (NR3C1)1941436 - 1629
NM_001204261 (NR3C1)1941606 - 1799
NM_001018075 (NR3C1)1941339 - 1532
NM_001024094 (NR3C1)1941606 - 1799
NM_001204264 (NR3C1)1941606 - 1799
NM_001204262 (NR3C1)1941606 - 1799
NM_000176 (NR3C1)1941606 - 1799
NM_001204260 (NR3C1)1941606 - 1799
NM_001204259 (NR3C1)1941606 - 1799
NM_001204263 (NR3C1)1941606 - 1799
NM_001204258 (NR3C1)1941606 - 1799
NM_001020825 (NR3C1)1941606 - 1799
NM_001018077 (NR3C1)1942108 - 2301
NM_001204265 (NR3C1)1941606 - 1799
Exon 4 To Exon 5 (Pair 60)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 97 bpgenomic: 85,584
Reverse (2788,22)AGCTTACATCTGGTCTCATGCTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-1.696 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)971606 - 1702
NM_001204259 (NR3C1)971606 - 1702
NM_001018077 (NR3C1)972108 - 2204
NM_001204265 (NR3C1)971606 - 1702
NM_001204258 (NR3C1)971606 - 1702
NM_001020825 (NR3C1)971606 - 1702
NM_001204263 (NR3C1)971606 - 1702
NM_001018076 (NR3C1)971232 - 1328
NM_001018075 (NR3C1)971339 - 1435
NM_001204261 (NR3C1)971606 - 1702
NM_001018074 (NR3C1)971436 - 1532
NM_001204264 (NR3C1)971606 - 1702
NM_001024094 (NR3C1)971606 - 1702
NM_000176 (NR3C1)971606 - 1702
NM_001204262 (NR3C1)971606 - 1702
Exon 4 To Exon 5 (Pair 61)
Forward (2494,24)TTTCCTGGAGCAAATATAATTGGTAmplicon SizecDNA: 297 bpgenomic: 85,784
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol in 3' area
Forward Dimers-1.792 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTTTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGT
ACCTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAG
GATCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAAT
AGGTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGT
CGAACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2971408 - 1704
NM_001204259 (NR3C1)2971408 - 1704
NM_001020825 (NR3C1)2971408 - 1704
NM_001204258 (NR3C1)2971408 - 1704
NM_001204263 (NR3C1)2971408 - 1704
NM_001204265 (NR3C1)2971408 - 1704
NM_001018077 (NR3C1)2971910 - 2206
NM_001018076 (NR3C1)2971034 - 1330
NM_001018074 (NR3C1)2971238 - 1534
NM_001018075 (NR3C1)2971141 - 1437
NM_001204261 (NR3C1)2971408 - 1704
NM_001204264 (NR3C1)2971408 - 1704
NM_001024094 (NR3C1)2971408 - 1704
NM_000176 (NR3C1)2971408 - 1704
NM_001204262 (NR3C1)2971408 - 1704
Exon 4 To Exon 5 (Pair 62)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 199 bpgenomic: 85,686
Reverse (2890,24)AAGTTAAGACTCCATAATGACATCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops0.596 kcal/mol
Reverse Dimers-1.421 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding-2.359 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACA
GCAACAACAGGACCACCTCCCAAACTCTGCCTGGTGTGCTCTGATGAAGCTTCAGGATGT
CATTATGGAGTCTTAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204264 (NR3C1)1991606 - 1804
NM_001024094 (NR3C1)1991606 - 1804
NM_000176 (NR3C1)1991606 - 1804
NM_001204262 (NR3C1)1991606 - 1804
NM_001018076 (NR3C1)1991232 - 1430
NM_001018074 (NR3C1)1991436 - 1634
NM_001018075 (NR3C1)1991339 - 1537
NM_001204261 (NR3C1)1991606 - 1804
NM_001204259 (NR3C1)1991606 - 1804
NM_001020825 (NR3C1)1991606 - 1804
NM_001204258 (NR3C1)1991606 - 1804
NM_001204263 (NR3C1)1991606 - 1804
NM_001204265 (NR3C1)1991606 - 1804
NM_001018077 (NR3C1)1992108 - 2306
NM_001204260 (NR3C1)1991606 - 1804
Exon 4 To Exon 5 (Pair 63)
Forward (2584,23)ATGAATACAGCATCCCTTTCTCAAmplicon SizecDNA: 208 bpgenomic: 85,695
Reverse (2791,22)GAGAGCTTACATCTGGTCTCATNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCATTCCA
CCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAACTTG
ACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTCAAGC
CCCAGCATGAGACCAGATGTAAGCTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001024094 (NR3C1)2081498 - 1705
NM_001204264 (NR3C1)2081498 - 1705
NM_001204262 (NR3C1)2081498 - 1705
NM_000176 (NR3C1)2081498 - 1705
NM_001018076 (NR3C1)2081124 - 1331
NM_001204261 (NR3C1)2081498 - 1705
NM_001018075 (NR3C1)2081231 - 1438
NM_001018074 (NR3C1)2081328 - 1535
NM_001204259 (NR3C1)2081498 - 1705
NM_001018077 (NR3C1)2082000 - 2207
NM_001204265 (NR3C1)2081498 - 1705
NM_001204263 (NR3C1)2081498 - 1705
NM_001204258 (NR3C1)2081498 - 1705
NM_001020825 (NR3C1)2081498 - 1705
NM_001204260 (NR3C1)2081498 - 1705
Exon 4 To Exon 5 (Pair 64)
Forward (2580,23)TGACATGAATACAGCATCCCTTTAmplicon SizecDNA: 213 bpgenomic: 85,700
Reverse (2792,21)GGAGAGCTTACATCTGGTCTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol in 3' area
Forward Dimers-2.294 kcal/mol
Reverse Loops1.073 kcal/mol in 3' area
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.136 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceTGACATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCAT
TCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAA
CTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTC
AAGCCCCAGCATGAGACCAGATGTAAGCTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204264 (NR3C1)2131494 - 1706
NM_001024094 (NR3C1)2131494 - 1706
NM_000176 (NR3C1)2131494 - 1706
NM_001204262 (NR3C1)2131494 - 1706
NM_001018076 (NR3C1)2131120 - 1332
NM_001018075 (NR3C1)2131227 - 1439
NM_001204261 (NR3C1)2131494 - 1706
NM_001018074 (NR3C1)2131324 - 1536
NM_001204259 (NR3C1)2131494 - 1706
NM_001204265 (NR3C1)2131494 - 1706
NM_001018077 (NR3C1)2131996 - 2208
NM_001020825 (NR3C1)2131494 - 1706
NM_001204258 (NR3C1)2131494 - 1706
NM_001204263 (NR3C1)2131494 - 1706
NM_001204260 (NR3C1)2131494 - 1706
Exon 4 To Exon 5 (Pair 65)
Forward (2497,24)CCTGGAGCAAATATAATTGGTAATAmplicon SizecDNA: 300 bpgenomic: 85,787
Reverse (2796,21)TGGAGGAGAGCTTACATCTGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.182 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTACC
TCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGAT
CAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAGG
TGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGA
ACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)3001411 - 1710
NM_001204263 (NR3C1)3001411 - 1710
NM_001020825 (NR3C1)3001411 - 1710
NM_001204258 (NR3C1)3001411 - 1710
NM_001204265 (NR3C1)3001411 - 1710
NM_001018077 (NR3C1)3001913 - 2212
NM_001204259 (NR3C1)3001411 - 1710
NM_001018074 (NR3C1)3001241 - 1540
NM_001204261 (NR3C1)3001411 - 1710
NM_001018075 (NR3C1)3001144 - 1443
NM_001018076 (NR3C1)3001037 - 1336
NM_001204262 (NR3C1)3001411 - 1710
NM_000176 (NR3C1)3001411 - 1710
NM_001024094 (NR3C1)3001411 - 1710
NM_001204264 (NR3C1)3001411 - 1710
Exon 4 To Exon 5 (Pair 66)
Forward (2496,24)TCCTGGAGCAAATATAATTGGTAAAmplicon SizecDNA: 295 bpgenomic: 85,782
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.586 kcal/mol
Forward Dimers-1.792 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.225 kcal/mol
Amplicon Folding-2.339 kcal/mol outside primersite
Amplicon SequenceTCCTGGAGCAAATATAATTGGTAATAAAATGTCTGCCATTTCTGTTCATGGTGTGAGTAC
CTCTGGAGGACAGATGTACCACTATGACATGAATACAGCATCCCTTTCTCAACAGCAGGA
TCAGAAGCCTATTTTTAATGTCATTCCACCAATTCCCGTTGGTTCCGAAAATTGGAATAG
GTGCCAAGGATCTGGAGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCG
AACAGTTTTTTCTAATGGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2951410 - 1704
NM_001204265 (NR3C1)2951410 - 1704
NM_001018077 (NR3C1)2951912 - 2206
NM_001204263 (NR3C1)2951410 - 1704
NM_001020825 (NR3C1)2951410 - 1704
NM_001204258 (NR3C1)2951410 - 1704
NM_001204259 (NR3C1)2951410 - 1704
NM_001204261 (NR3C1)2951410 - 1704
NM_001018075 (NR3C1)2951143 - 1437
NM_001018074 (NR3C1)2951240 - 1534
NM_001018076 (NR3C1)2951036 - 1330
NM_001204262 (NR3C1)2951410 - 1704
NM_000176 (NR3C1)2951410 - 1704
NM_001024094 (NR3C1)2951410 - 1704
NM_001204264 (NR3C1)2951410 - 1704
Exon 4 To Exon 5 (Pair 67)
Forward (2584,23)ATGAATACAGCATCCCTTTCTCAAmplicon SizecDNA: 211 bpgenomic: 85,698
Reverse (2794,21)GAGGAGAGCTTACATCTGGTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.933 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-1.807 kcal/mol outside primersite
Amplicon SequenceATGAATACAGCATCCCTTTCTCAACAGCAGGATCAGAAGCCTATTTTTAATGTCATTCCA
CCAATTCCCGTTGGTTCCGAAAATTGGAATAGGTGCCAAGGATCTGGAGATGACAACTTG
ACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATGGCTATTCAAGC
CCCAGCATGAGACCAGATGTAAGCTCTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000176 (NR3C1)2111498 - 1708
NM_001204262 (NR3C1)2111498 - 1708
NM_001204264 (NR3C1)2111498 - 1708
NM_001024094 (NR3C1)2111498 - 1708
NM_001018074 (NR3C1)2111328 - 1538
NM_001018075 (NR3C1)2111231 - 1441
NM_001204261 (NR3C1)2111498 - 1708
NM_001018076 (NR3C1)2111124 - 1334
NM_001204258 (NR3C1)2111498 - 1708
NM_001020825 (NR3C1)2111498 - 1708
NM_001204263 (NR3C1)2111498 - 1708
NM_001204265 (NR3C1)2111498 - 1708
NM_001018077 (NR3C1)2112000 - 2210
NM_001204259 (NR3C1)2111498 - 1708
NM_001204260 (NR3C1)2111498 - 1708
Exon 6 To Exon 7 (Pair 1)
Forward (3028,21)CAGGCTGGAATGAACCTGGAAAmplicon SizecDNA: 176 bpgenomic: 9,509
Reverse (3203,22)GGTTCAATAACCTCCAACAGTGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.612 kcal/mol in 3' area
Forward Dimers-2.407 kcal/mol
Reverse Loops0.606 kcal/mol
Reverse Dimers-1.114 kcal/mol
Forward-Reverse Dimers-2.835 kcal/mol
Amplicon Folding0.155 kcal/mol outside primersite
Amplicon SequenceCAGGCTGGAATGAACCTGGAAGCTCGAAAAACAAAGAAAAAAATAAAAGGAATTCAGCAG
GCCACTACAGGAGTCTCACAAGAAACCTCTGAAAATCCTGGTAACAAAACAATAGTTCCT
GCAACGTTACCACAACTCACCCCTACCCTGGTGTCACTGTTGGAGGTTATTGAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)1761565 - 1740
NM_001018075 (NR3C1)1761672 - 1847
NM_001204261 (NR3C1)1761939 - 2114
NM_001018074 (NR3C1)1761769 - 1944
NM_001204264 (NR3C1)1761939 - 2114
NM_001024094 (NR3C1)1761942 - 2117
NM_000176 (NR3C1)1761939 - 2114
NM_001204262 (NR3C1)1761939 - 2114
NM_001204260 (NR3C1)1761939 - 2114
NM_001204259 (NR3C1)1761939 - 2114
NM_001204265 (NR3C1)1761939 - 2114
NM_001018077 (NR3C1)1762441 - 2616
NM_001204258 (NR3C1)1761939 - 2114
NM_001020825 (NR3C1)1761939 - 2114
NM_001204263 (NR3C1)1761939 - 2114
Exon 6 To Exon 7 (Pair 2)
Forward (3028,21)CAGGCTGGAATGAACCTGGAAAmplicon SizecDNA: 205 bpgenomic: 9,538
Reverse (3232,24)AGCTATCATATCCTGCATATAACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.612 kcal/mol in 3' area
Forward Dimers-2.407 kcal/mol
Reverse Loops1.56 kcal/mol in 3' area
Reverse Dimers-1.696 kcal/mol
Forward-Reverse Dimers-2.253 kcal/mol
Amplicon Folding-1.088 kcal/mol outside primersite
Amplicon SequenceCAGGCTGGAATGAACCTGGAAGCTCGAAAAACAAAGAAAAAAATAAAAGGAATTCAGCAG
GCCACTACAGGAGTCTCACAAGAAACCTCTGAAAATCCTGGTAACAAAACAATAGTTCCT
GCAACGTTACCACAACTCACCCCTACCCTGGTGTCACTGTTGGAGGTTATTGAACCTGAA
GTGTTATATGCAGGATATGATAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204262 (NR3C1)2051939 - 2143
NM_000176 (NR3C1)2051939 - 2143
NM_001024094 (NR3C1)2051942 - 2146
NM_001204264 (NR3C1)2051939 - 2143
NM_001018074 (NR3C1)2051769 - 1973
NM_001204261 (NR3C1)2051939 - 2143
NM_001018075 (NR3C1)2051672 - 1876
NM_001018076 (NR3C1)2051565 - 1769
NM_001204263 (NR3C1)2051939 - 2143
NM_001020825 (NR3C1)2051939 - 2143
NM_001204258 (NR3C1)2051939 - 2143
NM_001204265 (NR3C1)2051939 - 2143
NM_001018077 (NR3C1)2052441 - 2645
NM_001204259 (NR3C1)2051939 - 2143
NM_001204260 (NR3C1)2051939 - 2143
Exon 6 To Exon 7 (Pair 3)
Forward (3028,21)CAGGCTGGAATGAACCTGGAAAmplicon SizecDNA: 212 bpgenomic: 9,545
Reverse (3239,22)GGAACAGAGCTATCATATCCTGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.612 kcal/mol in 3' area
Forward Dimers-2.407 kcal/mol
Reverse Loops1.822 kcal/mol
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-1.827 kcal/mol
Amplicon Folding-1.088 kcal/mol outside primersite
Amplicon SequenceCAGGCTGGAATGAACCTGGAAGCTCGAAAAACAAAGAAAAAAATAAAAGGAATTCAGCAG
GCCACTACAGGAGTCTCACAAGAAACCTCTGAAAATCCTGGTAACAAAACAATAGTTCCT
GCAACGTTACCACAACTCACCCCTACCCTGGTGTCACTGTTGGAGGTTATTGAACCTGAA
GTGTTATATGCAGGATATGATAGCTCTGTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204264 (NR3C1)2121939 - 2150
NM_001024094 (NR3C1)2121942 - 2153
NM_000176 (NR3C1)2121939 - 2150
NM_001204262 (NR3C1)2121939 - 2150
NM_001018076 (NR3C1)2121565 - 1776
NM_001018075 (NR3C1)2121672 - 1883
NM_001204261 (NR3C1)2121939 - 2150
NM_001018074 (NR3C1)2121769 - 1980
NM_001204259 (NR3C1)2121939 - 2150
NM_001204265 (NR3C1)2121939 - 2150
NM_001018077 (NR3C1)2122441 - 2652
NM_001204258 (NR3C1)2121939 - 2150
NM_001020825 (NR3C1)2121939 - 2150
NM_001204263 (NR3C1)2121939 - 2150
NM_001204260 (NR3C1)2121939 - 2150
Exon 6 To Exon 7 (Pair 4)
Forward (3028,21)CAGGCTGGAATGAACCTGGAAAmplicon SizecDNA: 203 bpgenomic: 9,536
Reverse (3230,24)CTATCATATCCTGCATATAACACTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.612 kcal/mol in 3' area
Forward Dimers-2.407 kcal/mol
Reverse Loops1.56 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-2.253 kcal/mol
Amplicon Folding-1.088 kcal/mol outside primersite
Amplicon SequenceCAGGCTGGAATGAACCTGGAAGCTCGAAAAACAAAGAAAAAAATAAAAGGAATTCAGCAG
GCCACTACAGGAGTCTCACAAGAAACCTCTGAAAATCCTGGTAACAAAACAATAGTTCCT
GCAACGTTACCACAACTCACCCCTACCCTGGTGTCACTGTTGGAGGTTATTGAACCTGAA
GTGTTATATGCAGGATATGATAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204261 (NR3C1)2031939 - 2141
NM_001018075 (NR3C1)2031672 - 1874
NM_001018074 (NR3C1)2031769 - 1971
NM_001018076 (NR3C1)2031565 - 1767
NM_001204262 (NR3C1)2031939 - 2141
NM_000176 (NR3C1)2031939 - 2141
NM_001024094 (NR3C1)2031942 - 2144
NM_001204264 (NR3C1)2031939 - 2141
NM_001204260 (NR3C1)2031939 - 2141
NM_001204265 (NR3C1)2031939 - 2141
NM_001018077 (NR3C1)2032441 - 2643
NM_001204263 (NR3C1)2031939 - 2141
NM_001204258 (NR3C1)2031939 - 2141
NM_001020825 (NR3C1)2031939 - 2141
NM_001204259 (NR3C1)2031939 - 2141
Exon 6 To Exon 7 (Pair 5)
Forward (3028,21)CAGGCTGGAATGAACCTGGAAAmplicon SizecDNA: 207 bpgenomic: 9,540
Reverse (3234,24)AGAGCTATCATATCCTGCATATAANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.612 kcal/mol in 3' area
Forward Dimers-2.407 kcal/mol
Reverse Loops1.56 kcal/mol in 3' area
Reverse Dimers-2.822 kcal/mol
Forward-Reverse Dimers-2.253 kcal/mol
Amplicon Folding-1.088 kcal/mol outside primersite
Amplicon SequenceCAGGCTGGAATGAACCTGGAAGCTCGAAAAACAAAGAAAAAAATAAAAGGAATTCAGCAG
GCCACTACAGGAGTCTCACAAGAAACCTCTGAAAATCCTGGTAACAAAACAATAGTTCCT
GCAACGTTACCACAACTCACCCCTACCCTGGTGTCACTGTTGGAGGTTATTGAACCTGAA
GTGTTATATGCAGGATATGATAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2071939 - 2145
NM_001204259 (NR3C1)2071939 - 2145
NM_001204265 (NR3C1)2071939 - 2145
NM_001018077 (NR3C1)2072441 - 2647
NM_001020825 (NR3C1)2071939 - 2145
NM_001204258 (NR3C1)2071939 - 2145
NM_001204263 (NR3C1)2071939 - 2145
NM_001018076 (NR3C1)2071565 - 1771
NM_001018075 (NR3C1)2071672 - 1878
NM_001204261 (NR3C1)2071939 - 2145
NM_001018074 (NR3C1)2071769 - 1975
NM_001204264 (NR3C1)2071939 - 2145
NM_001024094 (NR3C1)2071942 - 2148
NM_000176 (NR3C1)2071939 - 2145
NM_001204262 (NR3C1)2071939 - 2145
Exon 6 To Exon 7 (Pair 6)
Forward (3028,21)CAGGCTGGAATGAACCTGGAAAmplicon SizecDNA: 201 bpgenomic: 9,534
Reverse (3228,24)ATCATATCCTGCATATAACACTTCNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.612 kcal/mol in 3' area
Forward Dimers-2.407 kcal/mol
Reverse Loops1.56 kcal/mol
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-2.253 kcal/mol
Amplicon Folding-1.088 kcal/mol outside primersite
Amplicon SequenceCAGGCTGGAATGAACCTGGAAGCTCGAAAAACAAAGAAAAAAATAAAAGGAATTCAGCAG
GCCACTACAGGAGTCTCACAAGAAACCTCTGAAAATCCTGGTAACAAAACAATAGTTCCT
GCAACGTTACCACAACTCACCCCTACCCTGGTGTCACTGTTGGAGGTTATTGAACCTGAA
GTGTTATATGCAGGATATGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000176 (NR3C1)2011939 - 2139
NM_001204262 (NR3C1)2011939 - 2139
NM_001204264 (NR3C1)2011939 - 2139
NM_001024094 (NR3C1)2011942 - 2142
NM_001018075 (NR3C1)2011672 - 1872
NM_001204261 (NR3C1)2011939 - 2139
NM_001018074 (NR3C1)2011769 - 1969
NM_001018076 (NR3C1)2011565 - 1765
NM_001204265 (NR3C1)2011939 - 2139
NM_001018077 (NR3C1)2012441 - 2641
NM_001204258 (NR3C1)2011939 - 2139
NM_001020825 (NR3C1)2011939 - 2139
NM_001204263 (NR3C1)2011939 - 2139
NM_001204259 (NR3C1)2011939 - 2139
NM_001204260 (NR3C1)2011939 - 2139
Exon 7 To Exon 9 (Pair 1)
Forward (3294,21)GATTGCAGCAGTGAAATGGGCAmplicon SizecDNA: 252 bpgenomic: 5,001
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.088 kcal/mol in 3' area
Forward Dimers-1.714 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceGATTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGA
CCAAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAG
ATCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGA
GCAGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTC
TGAGTTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000176 (NR3C1)2522205 - 2456
NM_001204262 (NR3C1)2522205 - 2456
NM_001204264 (NR3C1)2522205 - 2456
NM_001024094 (NR3C1)2522208 - 2459
NM_001018075 (NR3C1)2521938 - 2189
NM_001204261 (NR3C1)2522205 - 2456
NM_001018074 (NR3C1)2522035 - 2286
NM_001018076 (NR3C1)2521831 - 2082
NM_001204265 (NR3C1)2522205 - 2456
NM_001018077 (NR3C1)2522707 - 2958
NM_001020825 (NR3C1)2522205 - 2456
NM_001204258 (NR3C1)2522205 - 2456
NM_001204263 (NR3C1)2522205 - 2456
NM_001204259 (NR3C1)2522205 - 2456
NM_001204260 (NR3C1)2522205 - 2456
Exon 7 To Exon 9 (Pair 2)
Forward (3299,21)CAGCAGTGAAATGGGCAAAGGAmplicon SizecDNA: 246 bpgenomic: 4,995
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.49 kcal/mol
Forward Dimers-1.292 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAA
TGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCAT
ATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGA
GAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGT
TACACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)2461836 - 2081
NM_001018074 (NR3C1)2462040 - 2285
NM_001204261 (NR3C1)2462210 - 2455
NM_001018075 (NR3C1)2461943 - 2188
NM_001024094 (NR3C1)2462213 - 2458
NM_001204264 (NR3C1)2462210 - 2455
NM_001204262 (NR3C1)2462210 - 2455
NM_000176 (NR3C1)2462210 - 2455
NM_001204260 (NR3C1)2462210 - 2455
NM_001204259 (NR3C1)2462210 - 2455
NM_001204263 (NR3C1)2462210 - 2455
NM_001020825 (NR3C1)2462210 - 2455
NM_001204258 (NR3C1)2462210 - 2455
NM_001018077 (NR3C1)2462712 - 2957
NM_001204265 (NR3C1)2462210 - 2455
Exon 7 To Exon 9 (Pair 3)
Forward (3298,21)GCAGCAGTGAAATGGGCAAAGAmplicon SizecDNA: 247 bpgenomic: 4,996
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.358 kcal/mol
Forward Dimers-1.292 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAA
ATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCA
TATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAG
AGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAG
TTACACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)2472209 - 2455
NM_001204263 (NR3C1)2472209 - 2455
NM_001020825 (NR3C1)2472209 - 2455
NM_001204258 (NR3C1)2472209 - 2455
NM_001204265 (NR3C1)2472209 - 2455
NM_001018077 (NR3C1)2472711 - 2957
NM_001204260 (NR3C1)2472209 - 2455
NM_001024094 (NR3C1)2472212 - 2458
NM_001204264 (NR3C1)2472209 - 2455
NM_001204262 (NR3C1)2472209 - 2455
NM_000176 (NR3C1)2472209 - 2455
NM_001018076 (NR3C1)2471835 - 2081
NM_001018074 (NR3C1)2472039 - 2285
NM_001204261 (NR3C1)2472209 - 2455
NM_001018075 (NR3C1)2471942 - 2188
Exon 7 To Exon 9 (Pair 4)
Forward (3301,21)GCAGTGAAATGGGCAAAGGCAAmplicon SizecDNA: 244 bpgenomic: 4,993
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-1.292 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAATG
ACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATAT
AGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGA
ATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTA
CACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204263 (NR3C1)2442212 - 2455
NM_001204258 (NR3C1)2442212 - 2455
NM_001020825 (NR3C1)2442212 - 2455
NM_001204265 (NR3C1)2442212 - 2455
NM_001018077 (NR3C1)2442714 - 2957
NM_001204259 (NR3C1)2442212 - 2455
NM_001204260 (NR3C1)2442212 - 2455
NM_001204262 (NR3C1)2442212 - 2455
NM_000176 (NR3C1)2442212 - 2455
NM_001024094 (NR3C1)2442215 - 2458
NM_001204264 (NR3C1)2442212 - 2455
NM_001018074 (NR3C1)2442042 - 2285
NM_001204261 (NR3C1)2442212 - 2455
NM_001018075 (NR3C1)2441945 - 2188
NM_001018076 (NR3C1)2441838 - 2081
Exon 7 To Exon 9 (Pair 5)
Forward (3300,21)AGCAGTGAAATGGGCAAAGGCAmplicon SizecDNA: 245 bpgenomic: 4,994
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.089 kcal/mol in 3' area
Forward Dimers-1.292 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAAT
GACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATA
TAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAG
AATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTT
ACACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204262 (NR3C1)2452211 - 2455
NM_000176 (NR3C1)2452211 - 2455
NM_001024094 (NR3C1)2452214 - 2458
NM_001204264 (NR3C1)2452211 - 2455
NM_001018074 (NR3C1)2452041 - 2285
NM_001204261 (NR3C1)2452211 - 2455
NM_001018075 (NR3C1)2451944 - 2188
NM_001018076 (NR3C1)2451837 - 2081
NM_001204263 (NR3C1)2452211 - 2455
NM_001020825 (NR3C1)2452211 - 2455
NM_001204258 (NR3C1)2452211 - 2455
NM_001018077 (NR3C1)2452713 - 2957
NM_001204265 (NR3C1)2452211 - 2455
NM_001204259 (NR3C1)2452211 - 2455
NM_001204260 (NR3C1)2452211 - 2455
Exon 7 To Exon 9 (Pair 6)
Forward (3300,21)AGCAGTGAAATGGGCAAAGGCAmplicon SizecDNA: 244 bpgenomic: 4,993
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.089 kcal/mol in 3' area
Forward Dimers-1.292 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAAT
GACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATA
TAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAG
AATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTT
ACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2442211 - 2454
NM_001018077 (NR3C1)2442713 - 2956
NM_001204265 (NR3C1)2442211 - 2454
NM_001204258 (NR3C1)2442211 - 2454
NM_001020825 (NR3C1)2442211 - 2454
NM_001204263 (NR3C1)2442211 - 2454
NM_001204259 (NR3C1)2442211 - 2454
NM_001018075 (NR3C1)2441944 - 2187
NM_001204261 (NR3C1)2442211 - 2454
NM_001018074 (NR3C1)2442041 - 2284
NM_001018076 (NR3C1)2441837 - 2080
NM_000176 (NR3C1)2442211 - 2454
NM_001204262 (NR3C1)2442211 - 2454
NM_001204264 (NR3C1)2442211 - 2454
NM_001024094 (NR3C1)2442214 - 2457
Exon 7 To Exon 9 (Pair 7)
Forward (3295,22)ATTGCAGCAGTGAAATGGGCAAAmplicon SizecDNA: 249 bpgenomic: 4,998
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.822 kcal/mol in 3' area
Forward Dimers-1.714 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceATTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGAC
CAAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGA
TCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAG
CAGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCT
GAGTTACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204262 (NR3C1)2492206 - 2454
NM_000176 (NR3C1)2492206 - 2454
NM_001024094 (NR3C1)2492209 - 2457
NM_001204264 (NR3C1)2492206 - 2454
NM_001018074 (NR3C1)2492036 - 2284
NM_001204261 (NR3C1)2492206 - 2454
NM_001018075 (NR3C1)2491939 - 2187
NM_001018076 (NR3C1)2491832 - 2080
NM_001204263 (NR3C1)2492206 - 2454
NM_001204258 (NR3C1)2492206 - 2454
NM_001020825 (NR3C1)2492206 - 2454
NM_001018077 (NR3C1)2492708 - 2956
NM_001204265 (NR3C1)2492206 - 2454
NM_001204259 (NR3C1)2492206 - 2454
NM_001204260 (NR3C1)2492206 - 2454
Exon 7 To Exon 9 (Pair 8)
Forward (3302,22)CAGTGAAATGGGCAAAGGCAATAmplicon SizecDNA: 242 bpgenomic: 4,991
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-0.544 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAATGA
CCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATATA
GACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAA
TGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTAC
AC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)2422213 - 2454
NM_001204258 (NR3C1)2422213 - 2454
NM_001020825 (NR3C1)2422213 - 2454
NM_001204263 (NR3C1)2422213 - 2454
NM_001018077 (NR3C1)2422715 - 2956
NM_001204265 (NR3C1)2422213 - 2454
NM_001204260 (NR3C1)2422213 - 2454
NM_001204264 (NR3C1)2422213 - 2454
NM_001024094 (NR3C1)2422216 - 2457
NM_000176 (NR3C1)2422213 - 2454
NM_001204262 (NR3C1)2422213 - 2454
NM_001018076 (NR3C1)2421839 - 2080
NM_001018074 (NR3C1)2422043 - 2284
NM_001018075 (NR3C1)2421946 - 2187
NM_001204261 (NR3C1)2422213 - 2454
Exon 7 To Exon 9 (Pair 9)
Forward (3300,21)AGCAGTGAAATGGGCAAAGGCAmplicon SizecDNA: 246 bpgenomic: 4,995
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.089 kcal/mol in 3' area
Forward Dimers-1.292 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAAT
GACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATA
TAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAG
AATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTT
ACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2462211 - 2456
NM_001204259 (NR3C1)2462211 - 2456
NM_001204258 (NR3C1)2462211 - 2456
NM_001020825 (NR3C1)2462211 - 2456
NM_001204263 (NR3C1)2462211 - 2456
NM_001018077 (NR3C1)2462713 - 2958
NM_001204265 (NR3C1)2462211 - 2456
NM_001018076 (NR3C1)2461837 - 2082
NM_001018074 (NR3C1)2462041 - 2286
NM_001018075 (NR3C1)2461944 - 2189
NM_001204261 (NR3C1)2462211 - 2456
NM_001204264 (NR3C1)2462211 - 2456
NM_001024094 (NR3C1)2462214 - 2459
NM_000176 (NR3C1)2462211 - 2456
NM_001204262 (NR3C1)2462211 - 2456
Exon 7 To Exon 9 (Pair 10)
Forward (3298,21)GCAGCAGTGAAATGGGCAAAGAmplicon SizecDNA: 246 bpgenomic: 4,995
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.358 kcal/mol
Forward Dimers-1.292 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAA
ATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCA
TATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAG
AGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAG
TTACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2462209 - 2454
NM_001204259 (NR3C1)2462209 - 2454
NM_001204263 (NR3C1)2462209 - 2454
NM_001020825 (NR3C1)2462209 - 2454
NM_001204258 (NR3C1)2462209 - 2454
NM_001204265 (NR3C1)2462209 - 2454
NM_001018077 (NR3C1)2462711 - 2956
NM_001018076 (NR3C1)2461835 - 2080
NM_001018074 (NR3C1)2462039 - 2284
NM_001204261 (NR3C1)2462209 - 2454
NM_001018075 (NR3C1)2461942 - 2187
NM_001024094 (NR3C1)2462212 - 2457
NM_001204264 (NR3C1)2462209 - 2454
NM_001204262 (NR3C1)2462209 - 2454
NM_000176 (NR3C1)2462209 - 2454
Exon 7 To Exon 9 (Pair 11)
Forward (3296,22)TTGCAGCAGTGAAATGGGCAAAAmplicon SizecDNA: 249 bpgenomic: 4,998
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol in 3' area
Forward Dimers-1.714 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceTTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACC
AAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGAT
CATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGC
AGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTG
AGTTACACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2492207 - 2455
NM_001204259 (NR3C1)2492207 - 2455
NM_001204263 (NR3C1)2492207 - 2455
NM_001020825 (NR3C1)2492207 - 2455
NM_001204258 (NR3C1)2492207 - 2455
NM_001018077 (NR3C1)2492709 - 2957
NM_001204265 (NR3C1)2492207 - 2455
NM_001018076 (NR3C1)2491833 - 2081
NM_001018074 (NR3C1)2492037 - 2285
NM_001204261 (NR3C1)2492207 - 2455
NM_001018075 (NR3C1)2491940 - 2188
NM_001024094 (NR3C1)2492210 - 2458
NM_001204264 (NR3C1)2492207 - 2455
NM_001204262 (NR3C1)2492207 - 2455
NM_000176 (NR3C1)2492207 - 2455
Exon 7 To Exon 9 (Pair 12)
Forward (3302,22)CAGTGAAATGGGCAAAGGCAATAmplicon SizecDNA: 243 bpgenomic: 4,992
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-0.544 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAATGA
CCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATATA
GACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAA
TGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTAC
ACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001024094 (NR3C1)2432216 - 2458
NM_001204264 (NR3C1)2432213 - 2455
NM_001204262 (NR3C1)2432213 - 2455
NM_000176 (NR3C1)2432213 - 2455
NM_001018076 (NR3C1)2431839 - 2081
NM_001018074 (NR3C1)2432043 - 2285
NM_001204261 (NR3C1)2432213 - 2455
NM_001018075 (NR3C1)2431946 - 2188
NM_001204259 (NR3C1)2432213 - 2455
NM_001204263 (NR3C1)2432213 - 2455
NM_001204258 (NR3C1)2432213 - 2455
NM_001020825 (NR3C1)2432213 - 2455
NM_001204265 (NR3C1)2432213 - 2455
NM_001018077 (NR3C1)2432715 - 2957
NM_001204260 (NR3C1)2432213 - 2455
Exon 7 To Exon 9 (Pair 13)
Forward (3299,21)CAGCAGTGAAATGGGCAAAGGAmplicon SizecDNA: 245 bpgenomic: 4,994
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.49 kcal/mol
Forward Dimers-1.292 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAA
TGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCAT
ATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGA
GAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGT
TACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2452210 - 2454
NM_001018077 (NR3C1)2452712 - 2956
NM_001204265 (NR3C1)2452210 - 2454
NM_001020825 (NR3C1)2452210 - 2454
NM_001204258 (NR3C1)2452210 - 2454
NM_001204263 (NR3C1)2452210 - 2454
NM_001204259 (NR3C1)2452210 - 2454
NM_001018075 (NR3C1)2451943 - 2187
NM_001204261 (NR3C1)2452210 - 2454
NM_001018074 (NR3C1)2452040 - 2284
NM_001018076 (NR3C1)2451836 - 2080
NM_000176 (NR3C1)2452210 - 2454
NM_001204262 (NR3C1)2452210 - 2454
NM_001204264 (NR3C1)2452210 - 2454
NM_001024094 (NR3C1)2452213 - 2457
Exon 7 To Exon 9 (Pair 14)
Forward (3298,21)GCAGCAGTGAAATGGGCAAAGAmplicon SizecDNA: 248 bpgenomic: 4,997
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.358 kcal/mol
Forward Dimers-1.292 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAA
ATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCA
TATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAG
AGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAG
TTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2482209 - 2456
NM_001204259 (NR3C1)2482209 - 2456
NM_001204258 (NR3C1)2482209 - 2456
NM_001020825 (NR3C1)2482209 - 2456
NM_001204263 (NR3C1)2482209 - 2456
NM_001204265 (NR3C1)2482209 - 2456
NM_001018077 (NR3C1)2482711 - 2958
NM_001018076 (NR3C1)2481835 - 2082
NM_001018074 (NR3C1)2482039 - 2286
NM_001018075 (NR3C1)2481942 - 2189
NM_001204261 (NR3C1)2482209 - 2456
NM_001204264 (NR3C1)2482209 - 2456
NM_001024094 (NR3C1)2482212 - 2459
NM_000176 (NR3C1)2482209 - 2456
NM_001204262 (NR3C1)2482209 - 2456
Exon 7 To Exon 9 (Pair 15)
Forward (3294,21)GATTGCAGCAGTGAAATGGGCAmplicon SizecDNA: 250 bpgenomic: 4,999
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.088 kcal/mol in 3' area
Forward Dimers-1.714 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceGATTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGA
CCAAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAG
ATCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGA
GCAGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTC
TGAGTTACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018074 (NR3C1)2502035 - 2284
NM_001204261 (NR3C1)2502205 - 2454
NM_001018075 (NR3C1)2501938 - 2187
NM_001018076 (NR3C1)2501831 - 2080
NM_001204262 (NR3C1)2502205 - 2454
NM_000176 (NR3C1)2502205 - 2454
NM_001024094 (NR3C1)2502208 - 2457
NM_001204264 (NR3C1)2502205 - 2454
NM_001204260 (NR3C1)2502205 - 2454
NM_001204263 (NR3C1)2502205 - 2454
NM_001204258 (NR3C1)2502205 - 2454
NM_001020825 (NR3C1)2502205 - 2454
NM_001018077 (NR3C1)2502707 - 2956
NM_001204265 (NR3C1)2502205 - 2454
NM_001204259 (NR3C1)2502205 - 2454
Exon 7 To Exon 9 (Pair 16)
Forward (3295,22)ATTGCAGCAGTGAAATGGGCAAAmplicon SizecDNA: 251 bpgenomic: 5,000
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.822 kcal/mol in 3' area
Forward Dimers-1.714 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceATTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGAC
CAAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGA
TCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAG
CAGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCT
GAGTTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)2511832 - 2082
NM_001018074 (NR3C1)2512036 - 2286
NM_001204261 (NR3C1)2512206 - 2456
NM_001018075 (NR3C1)2511939 - 2189
NM_001024094 (NR3C1)2512209 - 2459
NM_001204264 (NR3C1)2512206 - 2456
NM_001204262 (NR3C1)2512206 - 2456
NM_000176 (NR3C1)2512206 - 2456
NM_001204260 (NR3C1)2512206 - 2456
NM_001204259 (NR3C1)2512206 - 2456
NM_001204263 (NR3C1)2512206 - 2456
NM_001204258 (NR3C1)2512206 - 2456
NM_001020825 (NR3C1)2512206 - 2456
NM_001204265 (NR3C1)2512206 - 2456
NM_001018077 (NR3C1)2512708 - 2958
Exon 7 To Exon 9 (Pair 17)
Forward (3296,22)TTGCAGCAGTGAAATGGGCAAAAmplicon SizecDNA: 250 bpgenomic: 4,999
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol in 3' area
Forward Dimers-1.714 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceTTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACC
AAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGAT
CATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGC
AGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTG
AGTTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2502207 - 2456
NM_001204259 (NR3C1)2502207 - 2456
NM_001204263 (NR3C1)2502207 - 2456
NM_001204258 (NR3C1)2502207 - 2456
NM_001020825 (NR3C1)2502207 - 2456
NM_001204265 (NR3C1)2502207 - 2456
NM_001018077 (NR3C1)2502709 - 2958
NM_001018076 (NR3C1)2501833 - 2082
NM_001018074 (NR3C1)2502037 - 2286
NM_001204261 (NR3C1)2502207 - 2456
NM_001018075 (NR3C1)2501940 - 2189
NM_001024094 (NR3C1)2502210 - 2459
NM_001204264 (NR3C1)2502207 - 2456
NM_001204262 (NR3C1)2502207 - 2456
NM_000176 (NR3C1)2502207 - 2456
Exon 7 To Exon 9 (Pair 18)
Forward (3299,21)CAGCAGTGAAATGGGCAAAGGAmplicon SizecDNA: 247 bpgenomic: 4,996
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.49 kcal/mol
Forward Dimers-1.292 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAA
TGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCAT
ATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGA
GAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGT
TACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)2472210 - 2456
NM_001204259 (NR3C1)2472210 - 2456
NM_001204258 (NR3C1)2472210 - 2456
NM_001020825 (NR3C1)2472210 - 2456
NM_001204263 (NR3C1)2472210 - 2456
NM_001204265 (NR3C1)2472210 - 2456
NM_001018077 (NR3C1)2472712 - 2958
NM_001018076 (NR3C1)2471836 - 2082
NM_001018074 (NR3C1)2472040 - 2286
NM_001018075 (NR3C1)2471943 - 2189
NM_001204261 (NR3C1)2472210 - 2456
NM_001204264 (NR3C1)2472210 - 2456
NM_001024094 (NR3C1)2472213 - 2459
NM_000176 (NR3C1)2472210 - 2456
NM_001204262 (NR3C1)2472210 - 2456
Exon 7 To Exon 9 (Pair 19)
Forward (3301,21)GCAGTGAAATGGGCAAAGGCAAmplicon SizecDNA: 245 bpgenomic: 4,994
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-1.292 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAATG
ACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATAT
AGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGA
ATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTA
CACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001024094 (NR3C1)2452215 - 2459
NM_001204264 (NR3C1)2452212 - 2456
NM_001204262 (NR3C1)2452212 - 2456
NM_000176 (NR3C1)2452212 - 2456
NM_001018076 (NR3C1)2451838 - 2082
NM_001204261 (NR3C1)2452212 - 2456
NM_001018075 (NR3C1)2451945 - 2189
NM_001018074 (NR3C1)2452042 - 2286
NM_001204259 (NR3C1)2452212 - 2456
NM_001018077 (NR3C1)2452714 - 2958
NM_001204265 (NR3C1)2452212 - 2456
NM_001204263 (NR3C1)2452212 - 2456
NM_001020825 (NR3C1)2452212 - 2456
NM_001204258 (NR3C1)2452212 - 2456
NM_001204260 (NR3C1)2452212 - 2456
Exon 7 To Exon 9 (Pair 20)
Forward (3301,21)GCAGTGAAATGGGCAAAGGCAAmplicon SizecDNA: 243 bpgenomic: 4,992
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-1.292 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAATG
ACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATAT
AGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGA
ATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTA
CAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204263 (NR3C1)2432212 - 2454
NM_001020825 (NR3C1)2432212 - 2454
NM_001204258 (NR3C1)2432212 - 2454
NM_001204265 (NR3C1)2432212 - 2454
NM_001018077 (NR3C1)2432714 - 2956
NM_001204259 (NR3C1)2432212 - 2454
NM_001204260 (NR3C1)2432212 - 2454
NM_001204262 (NR3C1)2432212 - 2454
NM_000176 (NR3C1)2432212 - 2454
NM_001024094 (NR3C1)2432215 - 2457
NM_001204264 (NR3C1)2432212 - 2454
NM_001018074 (NR3C1)2432042 - 2284
NM_001204261 (NR3C1)2432212 - 2454
NM_001018075 (NR3C1)2431945 - 2187
NM_001018076 (NR3C1)2431838 - 2080
Exon 7 To Exon 9 (Pair 21)
Forward (3294,21)GATTGCAGCAGTGAAATGGGCAmplicon SizecDNA: 251 bpgenomic: 5,000
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.088 kcal/mol in 3' area
Forward Dimers-1.714 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceGATTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGA
CCAAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAG
ATCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGA
GCAGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTC
TGAGTTACACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000176 (NR3C1)2512205 - 2455
NM_001204262 (NR3C1)2512205 - 2455
NM_001204264 (NR3C1)2512205 - 2455
NM_001024094 (NR3C1)2512208 - 2458
NM_001018074 (NR3C1)2512035 - 2285
NM_001018075 (NR3C1)2511938 - 2188
NM_001204261 (NR3C1)2512205 - 2455
NM_001018076 (NR3C1)2511831 - 2081
NM_001020825 (NR3C1)2512205 - 2455
NM_001204258 (NR3C1)2512205 - 2455
NM_001204263 (NR3C1)2512205 - 2455
NM_001204265 (NR3C1)2512205 - 2455
NM_001018077 (NR3C1)2512707 - 2957
NM_001204259 (NR3C1)2512205 - 2455
NM_001204260 (NR3C1)2512205 - 2455
Exon 7 To Exon 9 (Pair 22)
Forward (3302,22)CAGTGAAATGGGCAAAGGCAATAmplicon SizecDNA: 244 bpgenomic: 4,993
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-0.544 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAATGA
CCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATATA
GACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAA
TGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTAC
ACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000176 (NR3C1)2442213 - 2456
NM_001204262 (NR3C1)2442213 - 2456
NM_001204264 (NR3C1)2442213 - 2456
NM_001024094 (NR3C1)2442216 - 2459
NM_001018074 (NR3C1)2442043 - 2286
NM_001018075 (NR3C1)2441946 - 2189
NM_001204261 (NR3C1)2442213 - 2456
NM_001018076 (NR3C1)2441839 - 2082
NM_001020825 (NR3C1)2442213 - 2456
NM_001204258 (NR3C1)2442213 - 2456
NM_001204263 (NR3C1)2442213 - 2456
NM_001204265 (NR3C1)2442213 - 2456
NM_001018077 (NR3C1)2442715 - 2958
NM_001204259 (NR3C1)2442213 - 2456
NM_001204260 (NR3C1)2442213 - 2456
Exon 7 To Exon 9 (Pair 23)
Forward (3295,22)ATTGCAGCAGTGAAATGGGCAAAmplicon SizecDNA: 250 bpgenomic: 4,999
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.822 kcal/mol in 3' area
Forward Dimers-1.714 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceATTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGAC
CAAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGA
TCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAG
CAGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCT
GAGTTACACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204262 (NR3C1)2502206 - 2455
NM_000176 (NR3C1)2502206 - 2455
NM_001024094 (NR3C1)2502209 - 2458
NM_001204264 (NR3C1)2502206 - 2455
NM_001204261 (NR3C1)2502206 - 2455
NM_001018075 (NR3C1)2501939 - 2188
NM_001018074 (NR3C1)2502036 - 2285
NM_001018076 (NR3C1)2501832 - 2081
NM_001204265 (NR3C1)2502206 - 2455
NM_001018077 (NR3C1)2502708 - 2957
NM_001204263 (NR3C1)2502206 - 2455
NM_001204258 (NR3C1)2502206 - 2455
NM_001020825 (NR3C1)2502206 - 2455
NM_001204259 (NR3C1)2502206 - 2455
NM_001204260 (NR3C1)2502206 - 2455
Exon 7 To Exon 9 (Pair 24)
Forward (3296,22)TTGCAGCAGTGAAATGGGCAAAAmplicon SizecDNA: 248 bpgenomic: 4,997
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol in 3' area
Forward Dimers-1.714 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-2.455 kcal/mol outside primersite
Amplicon SequenceTTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACC
AAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGAT
CATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGC
AGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTG
AGTTACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)2481833 - 2080
NM_001204261 (NR3C1)2482207 - 2454
NM_001018075 (NR3C1)2481940 - 2187
NM_001018074 (NR3C1)2482037 - 2284
NM_001024094 (NR3C1)2482210 - 2457
NM_001204264 (NR3C1)2482207 - 2454
NM_001204262 (NR3C1)2482207 - 2454
NM_000176 (NR3C1)2482207 - 2454
NM_001204260 (NR3C1)2482207 - 2454
NM_001204259 (NR3C1)2482207 - 2454
NM_001204265 (NR3C1)2482207 - 2454
NM_001018077 (NR3C1)2482709 - 2956
NM_001204263 (NR3C1)2482207 - 2454
NM_001020825 (NR3C1)2482207 - 2454
NM_001204258 (NR3C1)2482207 - 2454
Exon 8 To Exon 9 (Pair 1)
Forward (3449,24)TTGCTCCTGATCTGATTATTAATGAmplicon SizecDNA: 97 bpgenomic: 3,174
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-2.188 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAAT
GTAAACACATGCTGTATGTTTCCTCTGAGTTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000176 (NR3C1)972360 - 2456
NM_001204262 (NR3C1)972360 - 2456
NM_001204264 (NR3C1)972360 - 2456
NM_001024094 (NR3C1)972363 - 2459
NM_001018074 (NR3C1)972190 - 2286
NM_001018075 (NR3C1)972093 - 2189
NM_001204261 (NR3C1)972360 - 2456
NM_001018076 (NR3C1)971986 - 2082
NM_001020825 (NR3C1)972360 - 2456
NM_001204258 (NR3C1)972360 - 2456
NM_001204263 (NR3C1)972360 - 2456
NM_001018077 (NR3C1)972862 - 2958
NM_001204265 (NR3C1)972360 - 2456
NM_001204259 (NR3C1)972360 - 2456
NM_001204260 (NR3C1)972360 - 2456
Exon 8 To Exon 9 (Pair 2)
Forward (3449,24)TTGCTCCTGATCTGATTATTAATGAmplicon SizecDNA: 155 bpgenomic: 3,232
Reverse (3603,23)TGAAGAGAGAAGCAGTAAGGTTTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops2.496 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-0.632 kcal/mol outside primersite
Amplicon SequenceTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAAT
GTAAACACATGCTGTATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGT
ATCTCTGTATGAAAACCTTACTGCTTCTCTCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001024094 (NR3C1)1552363 - 2517
NM_001204264 (NR3C1)1552360 - 2514
NM_001204262 (NR3C1)1552360 - 2514
NM_000176 (NR3C1)1552360 - 2514
NM_001018076 (NR3C1)1551986 - 2140
NM_001204261 (NR3C1)1552360 - 2514
NM_001018075 (NR3C1)1552093 - 2247
NM_001018074 (NR3C1)1552190 - 2344
NM_001204259 (NR3C1)1552360 - 2514
NM_001018077 (NR3C1)1552862 - 3016
NM_001204265 (NR3C1)1552360 - 2514
NM_001204263 (NR3C1)1552360 - 2514
NM_001020825 (NR3C1)1552360 - 2514
NM_001204258 (NR3C1)1552360 - 2514
NM_001204260 (NR3C1)1552360 - 2514
Exon 8 To Exon 9 (Pair 3)
Forward (3450,24)TGCTCCTGATCTGATTATTAATGAAmplicon SizecDNA: 96 bpgenomic: 3,173
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-2.188 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATG
TAAACACATGCTGTATGTTTCCTCTGAGTTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)962361 - 2456
NM_001204259 (NR3C1)962361 - 2456
NM_001204258 (NR3C1)962361 - 2456
NM_001020825 (NR3C1)962361 - 2456
NM_001204263 (NR3C1)962361 - 2456
NM_001018077 (NR3C1)962863 - 2958
NM_001204265 (NR3C1)962361 - 2456
NM_001018076 (NR3C1)961987 - 2082
NM_001018074 (NR3C1)962191 - 2286
NM_001018075 (NR3C1)962094 - 2189
NM_001204261 (NR3C1)962361 - 2456
NM_001204264 (NR3C1)962361 - 2456
NM_001024094 (NR3C1)962364 - 2459
NM_000176 (NR3C1)962361 - 2456
NM_001204262 (NR3C1)962361 - 2456
 

See below for some more details.

Program Output:

Loading ...