Design Results for NR3C1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size80Maximal Amplicon Size160
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 5 (Pair 8)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 119 bpgenomic: 85,606
Reverse (2810,20)GTTGAGGAGCTGGATGGAGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001020825 (NR3C1)1191606 - 1724
NM_001018077 (NR3C1)1192108 - 2226
NM_001018074 (NR3C1)1191436 - 1554
NM_001204258 (NR3C1)1191606 - 1724
NM_001204261 (NR3C1)1191606 - 1724
NM_001018075 (NR3C1)1191339 - 1457
NM_001018076 (NR3C1)1191232 - 1350
NM_001204264 (NR3C1)1191606 - 1724
NM_000176 (NR3C1)1191606 - 1724
NM_001204259 (NR3C1)1191606 - 1724
NM_001024094 (NR3C1)1191606 - 1724
NM_001204263 (NR3C1)1191606 - 1724
NM_001204262 (NR3C1)1191606 - 1724
NM_001204260 (NR3C1)1191606 - 1724
NM_001204265 (NR3C1)1191606 - 1724
Exon 4 To Exon 5 (Pair 7)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 96 bpgenomic: 85,583
Reverse (2788,22)AGCTTACATCTGGTCTCATGCTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-1.133 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001020825 (NR3C1)961607 - 1702
NM_001018074 (NR3C1)961437 - 1532
NM_001018077 (NR3C1)962109 - 2204
NM_001204258 (NR3C1)961607 - 1702
NM_001204261 (NR3C1)961607 - 1702
NM_001018075 (NR3C1)961340 - 1435
NM_001204264 (NR3C1)961607 - 1702
NM_000176 (NR3C1)961607 - 1702
NM_001018076 (NR3C1)961233 - 1328
NM_001204259 (NR3C1)961607 - 1702
NM_001204262 (NR3C1)961607 - 1702
NM_001204263 (NR3C1)961607 - 1702
NM_001024094 (NR3C1)961607 - 1702
NM_001204265 (NR3C1)961607 - 1702
NM_001204260 (NR3C1)961607 - 1702
Exon 4 To Exon 5 (Pair 6)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 121 bpgenomic: 85,608
Reverse (2813,20)GCTGTTGAGGAGCTGGATGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.73 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.895 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACAG
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)1211607 - 1727
NM_001204265 (NR3C1)1211607 - 1727
NM_001024094 (NR3C1)1211607 - 1727
NM_001204262 (NR3C1)1211607 - 1727
NM_001204263 (NR3C1)1211607 - 1727
NM_001204259 (NR3C1)1211607 - 1727
NM_000176 (NR3C1)1211607 - 1727
NM_001204264 (NR3C1)1211607 - 1727
NM_001018076 (NR3C1)1211233 - 1353
NM_001018075 (NR3C1)1211340 - 1460
NM_001204261 (NR3C1)1211607 - 1727
NM_001204258 (NR3C1)1211607 - 1727
NM_001018077 (NR3C1)1212109 - 2229
NM_001018074 (NR3C1)1211437 - 1557
NM_001020825 (NR3C1)1211607 - 1727
Exon 4 To Exon 5 (Pair 5)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 118 bpgenomic: 85,605
Reverse (2810,20)GTTGAGGAGCTGGATGGAGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.624 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018077 (NR3C1)1182109 - 2226
NM_001018074 (NR3C1)1181437 - 1554
NM_001020825 (NR3C1)1181607 - 1724
NM_001018075 (NR3C1)1181340 - 1457
NM_001204258 (NR3C1)1181607 - 1724
NM_001204261 (NR3C1)1181607 - 1724
NM_001204259 (NR3C1)1181607 - 1724
NM_000176 (NR3C1)1181607 - 1724
NM_001204264 (NR3C1)1181607 - 1724
NM_001018076 (NR3C1)1181233 - 1350
NM_001204260 (NR3C1)1181607 - 1724
NM_001204265 (NR3C1)1181607 - 1724
NM_001024094 (NR3C1)1181607 - 1724
NM_001204262 (NR3C1)1181607 - 1724
NM_001204263 (NR3C1)1181607 - 1724
Exon 4 To Exon 5 (Pair 4)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 99 bpgenomic: 85,586
Reverse (2790,22)AGAGCTTACATCTGGTCTCATGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-1.696 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001024094 (NR3C1)991606 - 1704
NM_001204263 (NR3C1)991606 - 1704
NM_001204262 (NR3C1)991606 - 1704
NM_001204260 (NR3C1)991606 - 1704
NM_001204265 (NR3C1)991606 - 1704
NM_001018076 (NR3C1)991232 - 1330
NM_000176 (NR3C1)991606 - 1704
NM_001204264 (NR3C1)991606 - 1704
NM_001204259 (NR3C1)991606 - 1704
NM_001204261 (NR3C1)991606 - 1704
NM_001204258 (NR3C1)991606 - 1704
NM_001018075 (NR3C1)991339 - 1437
NM_001020825 (NR3C1)991606 - 1704
NM_001018077 (NR3C1)992108 - 2206
NM_001018074 (NR3C1)991436 - 1534
Exon 4 To Exon 5 (Pair 3)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 97 bpgenomic: 85,584
Reverse (2788,22)AGCTTACATCTGGTCTCATGCTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.073 kcal/mol
Reverse Dimers-1.822 kcal/mol
Forward-Reverse Dimers-1.696 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)971606 - 1702
NM_001204265 (NR3C1)971606 - 1702
NM_001024094 (NR3C1)971606 - 1702
NM_001204263 (NR3C1)971606 - 1702
NM_001204262 (NR3C1)971606 - 1702
NM_001204259 (NR3C1)971606 - 1702
NM_001018076 (NR3C1)971232 - 1328
NM_000176 (NR3C1)971606 - 1702
NM_001204264 (NR3C1)971606 - 1702
NM_001018075 (NR3C1)971339 - 1435
NM_001204261 (NR3C1)971606 - 1702
NM_001204258 (NR3C1)971606 - 1702
NM_001018077 (NR3C1)972108 - 2204
NM_001018074 (NR3C1)971436 - 1532
NM_001020825 (NR3C1)971606 - 1702
Exon 4 To Exon 5 (Pair 2)
Forward (2693,22)ATGACAACTTGACTTCTCTGGGAmplicon SizecDNA: 116 bpgenomic: 85,603
Reverse (2808,20)TGAGGAGCTGGATGGAGGAGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-0.962 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAATG
GCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018074 (NR3C1)1161437 - 1552
NM_001018077 (NR3C1)1162109 - 2224
NM_001020825 (NR3C1)1161607 - 1722
NM_001018075 (NR3C1)1161340 - 1455
NM_001204258 (NR3C1)1161607 - 1722
NM_001204261 (NR3C1)1161607 - 1722
NM_001204259 (NR3C1)1161607 - 1722
NM_001018076 (NR3C1)1161233 - 1348
NM_001204264 (NR3C1)1161607 - 1722
NM_000176 (NR3C1)1161607 - 1722
NM_001204265 (NR3C1)1161607 - 1722
NM_001204260 (NR3C1)1161607 - 1722
NM_001204263 (NR3C1)1161607 - 1722
NM_001204262 (NR3C1)1161607 - 1722
NM_001024094 (NR3C1)1161607 - 1722
Exon 4 To Exon 5 (Pair 1)
Forward (2692,22)GATGACAACTTGACTTCTCTGGAmplicon SizecDNA: 122 bpgenomic: 85,609
Reverse (2813,20)GCTGTTGAGGAGCTGGATGGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-0.268 kcal/mol
Reverse Loops1.73 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.895 kcal/mol
Amplicon Folding-1.018 kcal/mol outside primersite
Amplicon SequenceGATGACAACTTGACTTCTCTGGGGACTCTGAACTTCCCTGGTCGAACAGTTTTTTCTAAT
GGCTATTCAAGCCCCAGCATGAGACCAGATGTAAGCTCTCCTCCATCCAGCTCCTCAACA
GC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)1221232 - 1353
NM_000176 (NR3C1)1221606 - 1727
NM_001204264 (NR3C1)1221606 - 1727
NM_001204259 (NR3C1)1221606 - 1727
NM_001024094 (NR3C1)1221606 - 1727
NM_001204263 (NR3C1)1221606 - 1727
NM_001204262 (NR3C1)1221606 - 1727
NM_001204260 (NR3C1)1221606 - 1727
NM_001204265 (NR3C1)1221606 - 1727
NM_001020825 (NR3C1)1221606 - 1727
NM_001018077 (NR3C1)1222108 - 2229
NM_001018074 (NR3C1)1221436 - 1557
NM_001204261 (NR3C1)1221606 - 1727
NM_001204258 (NR3C1)1221606 - 1727
NM_001018075 (NR3C1)1221339 - 1460
Exon 8 To Exon 9 (Pair 18)
Forward (3427,22)TCAAGTGCAAACCTGCTGTGTTAmplicon SizecDNA: 118 bpgenomic: 3,195
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.329 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-2.426 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceTCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACT
CTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTACACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001020825 (NR3C1)1182338 - 2455
NM_001018077 (NR3C1)1182840 - 2957
NM_001018074 (NR3C1)1182168 - 2285
NM_001204258 (NR3C1)1182338 - 2455
NM_001204261 (NR3C1)1182338 - 2455
NM_001018075 (NR3C1)1182071 - 2188
NM_001018076 (NR3C1)1181964 - 2081
NM_001204264 (NR3C1)1182338 - 2455
NM_000176 (NR3C1)1182338 - 2455
NM_001204259 (NR3C1)1182338 - 2455
NM_001024094 (NR3C1)1182341 - 2458
NM_001204263 (NR3C1)1182338 - 2455
NM_001204262 (NR3C1)1182338 - 2455
NM_001204260 (NR3C1)1182338 - 2455
NM_001204265 (NR3C1)1182338 - 2455
Exon 8 To Exon 9 (Pair 17)
Forward (3450,24)TGCTCCTGATCTGATTATTAATGAAmplicon SizecDNA: 94 bpgenomic: 3,171
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-2.188 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATG
TAAACACATGCTGTATGTTTCCTCTGAGTTACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)942361 - 2454
NM_001204265 (NR3C1)942361 - 2454
NM_001024094 (NR3C1)942364 - 2457
NM_001204263 (NR3C1)942361 - 2454
NM_001204262 (NR3C1)942361 - 2454
NM_001204259 (NR3C1)942361 - 2454
NM_001018076 (NR3C1)941987 - 2080
NM_001204264 (NR3C1)942361 - 2454
NM_000176 (NR3C1)942361 - 2454
NM_001018075 (NR3C1)942094 - 2187
NM_001204258 (NR3C1)942361 - 2454
NM_001204261 (NR3C1)942361 - 2454
NM_001018077 (NR3C1)942863 - 2956
NM_001018074 (NR3C1)942191 - 2284
NM_001020825 (NR3C1)942361 - 2454
Exon 8 To Exon 9 (Pair 16)
Forward (3428,22)CAAGTGCAAACCTGCTGTGTTTAmplicon SizecDNA: 117 bpgenomic: 3,194
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.329 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-2.426 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTC
TACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTACACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018077 (NR3C1)1172841 - 2957
NM_001018074 (NR3C1)1172169 - 2285
NM_001020825 (NR3C1)1172339 - 2455
NM_001018075 (NR3C1)1172072 - 2188
NM_001204261 (NR3C1)1172339 - 2455
NM_001204258 (NR3C1)1172339 - 2455
NM_001204259 (NR3C1)1172339 - 2455
NM_001018076 (NR3C1)1171965 - 2081
NM_000176 (NR3C1)1172339 - 2455
NM_001204264 (NR3C1)1172339 - 2455
NM_001204260 (NR3C1)1172339 - 2455
NM_001204265 (NR3C1)1172339 - 2455
NM_001024094 (NR3C1)1172342 - 2458
NM_001204263 (NR3C1)1172339 - 2455
NM_001204262 (NR3C1)1172339 - 2455
Exon 8 To Exon 9 (Pair 15)
Forward (3428,22)CAAGTGCAAACCTGCTGTGTTTAmplicon SizecDNA: 116 bpgenomic: 3,193
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.329 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-2.426 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTC
TACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204261 (NR3C1)1162339 - 2454
NM_001204258 (NR3C1)1162339 - 2454
NM_001018075 (NR3C1)1162072 - 2187
NM_001020825 (NR3C1)1162339 - 2454
NM_001018077 (NR3C1)1162841 - 2956
NM_001018074 (NR3C1)1162169 - 2284
NM_001024094 (NR3C1)1162342 - 2457
NM_001204262 (NR3C1)1162339 - 2454
NM_001204263 (NR3C1)1162339 - 2454
NM_001204260 (NR3C1)1162339 - 2454
NM_001204265 (NR3C1)1162339 - 2454
NM_001204264 (NR3C1)1162339 - 2454
NM_000176 (NR3C1)1162339 - 2454
NM_001018076 (NR3C1)1161965 - 2080
NM_001204259 (NR3C1)1162339 - 2454
Exon 8 To Exon 9 (Pair 14)
Forward (3450,24)TGCTCCTGATCTGATTATTAATGAAmplicon SizecDNA: 96 bpgenomic: 3,173
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-2.188 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATG
TAAACACATGCTGTATGTTTCCTCTGAGTTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001020825 (NR3C1)962361 - 2456
NM_001018077 (NR3C1)962863 - 2958
NM_001018074 (NR3C1)962191 - 2286
NM_001204258 (NR3C1)962361 - 2456
NM_001204261 (NR3C1)962361 - 2456
NM_001018075 (NR3C1)962094 - 2189
NM_000176 (NR3C1)962361 - 2456
NM_001204264 (NR3C1)962361 - 2456
NM_001018076 (NR3C1)961987 - 2082
NM_001204259 (NR3C1)962361 - 2456
NM_001024094 (NR3C1)962364 - 2459
NM_001204262 (NR3C1)962361 - 2456
NM_001204263 (NR3C1)962361 - 2456
NM_001204260 (NR3C1)962361 - 2456
NM_001204265 (NR3C1)962361 - 2456
Exon 8 To Exon 9 (Pair 13)
Forward (3427,22)TCAAGTGCAAACCTGCTGTGTTAmplicon SizecDNA: 117 bpgenomic: 3,194
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.329 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-2.426 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceTCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACT
CTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204258 (NR3C1)1172338 - 2454
NM_001204261 (NR3C1)1172338 - 2454
NM_001018075 (NR3C1)1172071 - 2187
NM_001020825 (NR3C1)1172338 - 2454
NM_001018074 (NR3C1)1172168 - 2284
NM_001018077 (NR3C1)1172840 - 2956
NM_001204263 (NR3C1)1172338 - 2454
NM_001204262 (NR3C1)1172338 - 2454
NM_001024094 (NR3C1)1172341 - 2457
NM_001204265 (NR3C1)1172338 - 2454
NM_001204260 (NR3C1)1172338 - 2454
NM_001018076 (NR3C1)1171964 - 2080
NM_000176 (NR3C1)1172338 - 2454
NM_001204264 (NR3C1)1172338 - 2454
NM_001204259 (NR3C1)1172338 - 2454
Exon 8 To Exon 9 (Pair 12)
Forward (3428,22)CAAGTGCAAACCTGCTGTGTTTAmplicon SizecDNA: 118 bpgenomic: 3,195
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.329 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-2.426 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTC
TACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018074 (NR3C1)1182169 - 2286
NM_001018077 (NR3C1)1182841 - 2958
NM_001020825 (NR3C1)1182339 - 2456
NM_001018075 (NR3C1)1182072 - 2189
NM_001204258 (NR3C1)1182339 - 2456
NM_001204261 (NR3C1)1182339 - 2456
NM_001204259 (NR3C1)1182339 - 2456
NM_001204264 (NR3C1)1182339 - 2456
NM_000176 (NR3C1)1182339 - 2456
NM_001018076 (NR3C1)1181965 - 2082
NM_001204265 (NR3C1)1182339 - 2456
NM_001204260 (NR3C1)1182339 - 2456
NM_001204262 (NR3C1)1182339 - 2456
NM_001204263 (NR3C1)1182339 - 2456
NM_001024094 (NR3C1)1182342 - 2459
Exon 8 To Exon 9 (Pair 11)
Forward (3450,24)TGCTCCTGATCTGATTATTAATGAAmplicon SizecDNA: 95 bpgenomic: 3,172
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-2.188 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATG
TAAACACATGCTGTATGTTTCCTCTGAGTTACACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)952361 - 2455
NM_001018076 (NR3C1)951987 - 2081
NM_000176 (NR3C1)952361 - 2455
NM_001204264 (NR3C1)952361 - 2455
NM_001204265 (NR3C1)952361 - 2455
NM_001204260 (NR3C1)952361 - 2455
NM_001204263 (NR3C1)952361 - 2455
NM_001204262 (NR3C1)952361 - 2455
NM_001024094 (NR3C1)952364 - 2458
NM_001018074 (NR3C1)952191 - 2285
NM_001018077 (NR3C1)952863 - 2957
NM_001020825 (NR3C1)952361 - 2455
NM_001018075 (NR3C1)952094 - 2188
NM_001204261 (NR3C1)952361 - 2455
NM_001204258 (NR3C1)952361 - 2455
Exon 8 To Exon 9 (Pair 10)
Forward (3450,24)TGCTCCTGATCTGATTATTAATGAAmplicon SizecDNA: 155 bpgenomic: 3,232
Reverse (3604,22)CTGAAGAGAGAAGCAGTAAGGTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.877 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.632 kcal/mol outside primersite
Amplicon SequenceTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATG
TAAACACATGCTGTATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGTA
TCTCTGTATGAAAACCTTACTGCTTCTCTCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204261 (NR3C1)1552361 - 2515
NM_001204258 (NR3C1)1552361 - 2515
NM_001018075 (NR3C1)1552094 - 2248
NM_001020825 (NR3C1)1552361 - 2515
NM_001018074 (NR3C1)1552191 - 2345
NM_001018077 (NR3C1)1552863 - 3017
NM_001204263 (NR3C1)1552361 - 2515
NM_001204262 (NR3C1)1552361 - 2515
NM_001024094 (NR3C1)1552364 - 2518
NM_001204265 (NR3C1)1552361 - 2515
NM_001204260 (NR3C1)1552361 - 2515
NM_001018076 (NR3C1)1551987 - 2141
NM_001204264 (NR3C1)1552361 - 2515
NM_000176 (NR3C1)1552361 - 2515
NM_001204259 (NR3C1)1552361 - 2515
Exon 8 To Exon 9 (Pair 9)
Forward (3449,24)TTGCTCCTGATCTGATTATTAATGAmplicon SizecDNA: 96 bpgenomic: 3,173
Reverse (3544,23)TGTGTAACTCAGAGGAAACATACNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-2.188 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAAT
GTAAACACATGCTGTATGTTTCCTCTGAGTTACACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204259 (NR3C1)962360 - 2455
NM_001204264 (NR3C1)962360 - 2455
NM_000176 (NR3C1)962360 - 2455
NM_001018076 (NR3C1)961986 - 2081
NM_001204260 (NR3C1)962360 - 2455
NM_001204265 (NR3C1)962360 - 2455
NM_001024094 (NR3C1)962363 - 2458
NM_001204262 (NR3C1)962360 - 2455
NM_001204263 (NR3C1)962360 - 2455
NM_001018077 (NR3C1)962862 - 2957
NM_001018074 (NR3C1)962190 - 2285
NM_001020825 (NR3C1)962360 - 2455
NM_001018075 (NR3C1)962093 - 2188
NM_001204261 (NR3C1)962360 - 2455
NM_001204258 (NR3C1)962360 - 2455
Exon 8 To Exon 9 (Pair 8)
Forward (3449,24)TTGCTCCTGATCTGATTATTAATGAmplicon SizecDNA: 95 bpgenomic: 3,172
Reverse (3543,23)GTGTAACTCAGAGGAAACATACANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.619 kcal/mol
Reverse Dimers-0.72 kcal/mol
Forward-Reverse Dimers-2.188 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAAT
GTAAACACATGCTGTATGTTTCCTCTGAGTTACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204261 (NR3C1)952360 - 2454
NM_001204258 (NR3C1)952360 - 2454
NM_001018075 (NR3C1)952093 - 2187
NM_001020825 (NR3C1)952360 - 2454
NM_001018077 (NR3C1)952862 - 2956
NM_001018074 (NR3C1)952190 - 2284
NM_001024094 (NR3C1)952363 - 2457
NM_001204262 (NR3C1)952360 - 2454
NM_001204263 (NR3C1)952360 - 2454
NM_001204260 (NR3C1)952360 - 2454
NM_001204265 (NR3C1)952360 - 2454
NM_000176 (NR3C1)952360 - 2454
NM_001204264 (NR3C1)952360 - 2454
NM_001018076 (NR3C1)951986 - 2080
NM_001204259 (NR3C1)952360 - 2454
Exon 8 To Exon 9 (Pair 7)
Forward (3449,24)TTGCTCCTGATCTGATTATTAATGAmplicon SizecDNA: 156 bpgenomic: 3,233
Reverse (3604,22)CTGAAGAGAGAAGCAGTAAGGTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.877 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-0.632 kcal/mol outside primersite
Amplicon SequenceTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAAT
GTAAACACATGCTGTATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGT
ATCTCTGTATGAAAACCTTACTGCTTCTCTCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001020825 (NR3C1)1562360 - 2515
NM_001018074 (NR3C1)1562190 - 2345
NM_001018077 (NR3C1)1562862 - 3017
NM_001204261 (NR3C1)1562360 - 2515
NM_001204258 (NR3C1)1562360 - 2515
NM_001018075 (NR3C1)1562093 - 2248
NM_001018076 (NR3C1)1561986 - 2141
NM_001204264 (NR3C1)1562360 - 2515
NM_000176 (NR3C1)1562360 - 2515
NM_001204259 (NR3C1)1562360 - 2515
NM_001204263 (NR3C1)1562360 - 2515
NM_001204262 (NR3C1)1562360 - 2515
NM_001024094 (NR3C1)1562363 - 2518
NM_001204265 (NR3C1)1562360 - 2515
NM_001204260 (NR3C1)1562360 - 2515
Exon 8 To Exon 9 (Pair 6)
Forward (3450,24)TGCTCCTGATCTGATTATTAATGAAmplicon SizecDNA: 157 bpgenomic: 3,234
Reverse (3606,22)ACCTGAAGAGAGAAGCAGTAAGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.666 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.632 kcal/mol outside primersite
Amplicon SequenceTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATG
TAAACACATGCTGTATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGTA
TCTCTGTATGAAAACCTTACTGCTTCTCTCTTCAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001020825 (NR3C1)1552361 - 2515
NM_001018077 (NR3C1)1552863 - 3017
NM_001018074 (NR3C1)1552191 - 2345
NM_001204261 (NR3C1)1552361 - 2515
NM_001204258 (NR3C1)1552361 - 2515
NM_001018075 (NR3C1)1552094 - 2248
NM_001018076 (NR3C1)1551987 - 2141
NM_000176 (NR3C1)1552361 - 2515
NM_001204264 (NR3C1)1552361 - 2515
NM_001204259 (NR3C1)1552361 - 2515
NM_001024094 (NR3C1)1552364 - 2518
NM_001204263 (NR3C1)1552361 - 2515
NM_001204262 (NR3C1)1552361 - 2515
NM_001204260 (NR3C1)1552361 - 2515
NM_001204265 (NR3C1)1572361 - 2517
Exon 8 To Exon 9 (Pair 5)
Forward (3449,24)TTGCTCCTGATCTGATTATTAATGAmplicon SizecDNA: 158 bpgenomic: 3,235
Reverse (3606,22)ACCTGAAGAGAGAAGCAGTAAGNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.666 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-0.632 kcal/mol outside primersite
Amplicon SequenceTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAAT
GTAAACACATGCTGTATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGT
ATCTCTGTATGAAAACCTTACTGCTTCTCTCTTCAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204258 (NR3C1)1562360 - 2515
NM_001204261 (NR3C1)1562360 - 2515
NM_001018075 (NR3C1)1562093 - 2248
NM_001020825 (NR3C1)1562360 - 2515
NM_001018077 (NR3C1)1562862 - 3017
NM_001018074 (NR3C1)1562190 - 2345
NM_001024094 (NR3C1)1562363 - 2518
NM_001204263 (NR3C1)1562360 - 2515
NM_001204262 (NR3C1)1562360 - 2515
NM_001204260 (NR3C1)1562360 - 2515
NM_001204265 (NR3C1)1582360 - 2517
NM_001018076 (NR3C1)1561986 - 2141
NM_001204264 (NR3C1)1562360 - 2515
NM_000176 (NR3C1)1562360 - 2515
NM_001204259 (NR3C1)1562360 - 2515
Exon 8 To Exon 9 (Pair 4)
Forward (3427,22)TCAAGTGCAAACCTGCTGTGTTAmplicon SizecDNA: 119 bpgenomic: 3,196
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops0.329 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-2.426 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceTCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACT
CTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001018076 (NR3C1)1191964 - 2082
NM_001204264 (NR3C1)1192338 - 2456
NM_000176 (NR3C1)1192338 - 2456
NM_001204259 (NR3C1)1192338 - 2456
NM_001204263 (NR3C1)1192338 - 2456
NM_001204262 (NR3C1)1192338 - 2456
NM_001024094 (NR3C1)1192341 - 2459
NM_001204265 (NR3C1)1192338 - 2456
NM_001204260 (NR3C1)1192338 - 2456
NM_001020825 (NR3C1)1192338 - 2456
NM_001018074 (NR3C1)1192168 - 2286
NM_001018077 (NR3C1)1192840 - 2958
NM_001204261 (NR3C1)1192338 - 2456
NM_001204258 (NR3C1)1192338 - 2456
NM_001018075 (NR3C1)1192071 - 2189
Exon 8 To Exon 9 (Pair 3)
Forward (3449,24)TTGCTCCTGATCTGATTATTAATGAmplicon SizecDNA: 155 bpgenomic: 3,232
Reverse (3603,23)TGAAGAGAGAAGCAGTAAGGTTTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops2.496 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.522 kcal/mol
Amplicon Folding-0.632 kcal/mol outside primersite
Amplicon SequenceTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAAT
GTAAACACATGCTGTATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGT
ATCTCTGTATGAAAACCTTACTGCTTCTCTCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204260 (NR3C1)1552360 - 2514
NM_001204265 (NR3C1)1552360 - 2514
NM_001024094 (NR3C1)1552363 - 2517
NM_001204263 (NR3C1)1552360 - 2514
NM_001204262 (NR3C1)1552360 - 2514
NM_001204259 (NR3C1)1552360 - 2514
NM_001018076 (NR3C1)1551986 - 2140
NM_000176 (NR3C1)1552360 - 2514
NM_001204264 (NR3C1)1552360 - 2514
NM_001018075 (NR3C1)1552093 - 2247
NM_001204258 (NR3C1)1552360 - 2514
NM_001204261 (NR3C1)1552360 - 2514
NM_001018077 (NR3C1)1552862 - 3016
NM_001018074 (NR3C1)1552190 - 2344
NM_001020825 (NR3C1)1552360 - 2514
Exon 8 To Exon 9 (Pair 2)
Forward (3449,24)TTGCTCCTGATCTGATTATTAATGAmplicon SizecDNA: 97 bpgenomic: 3,174
Reverse (3545,23)CTGTGTAACTCAGAGGAAACATANr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-1.291 kcal/mol
Forward-Reverse Dimers-2.188 kcal/mol
Amplicon Folding-0.625 kcal/mol outside primersite
Amplicon SequenceTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAAT
GTAAACACATGCTGTATGTTTCCTCTGAGTTACACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204263 (NR3C1)972360 - 2456
NM_001204262 (NR3C1)972360 - 2456
NM_001024094 (NR3C1)972363 - 2459
NM_001204265 (NR3C1)972360 - 2456
NM_001204260 (NR3C1)972360 - 2456
NM_001018076 (NR3C1)971986 - 2082
NM_001204264 (NR3C1)972360 - 2456
NM_000176 (NR3C1)972360 - 2456
NM_001204259 (NR3C1)972360 - 2456
NM_001204261 (NR3C1)972360 - 2456
NM_001204258 (NR3C1)972360 - 2456
NM_001018075 (NR3C1)972093 - 2189
NM_001020825 (NR3C1)972360 - 2456
NM_001018074 (NR3C1)972190 - 2286
NM_001018077 (NR3C1)972862 - 2958
Exon 8 To Exon 9 (Pair 1)
Forward (3450,24)TGCTCCTGATCTGATTATTAATGAAmplicon SizecDNA: 154 bpgenomic: 3,231
Reverse (3603,23)TGAAGAGAGAAGCAGTAAGGTTTNr. of Isoforms 15 out of 15 (by amplicon BlastN)
Folding EnergiesForward Loops1.619 kcal/mol in 3' area
Forward Dimers-1.46 kcal/mol
Reverse Loops2.496 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.451 kcal/mol
Amplicon Folding-0.632 kcal/mol outside primersite
Amplicon SequenceTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATG
TAAACACATGCTGTATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGTA
TCTCTGTATGAAAACCTTACTGCTTCTCTCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001204258 (NR3C1)1542361 - 2514
NM_001204261 (NR3C1)1542361 - 2514
NM_001018075 (NR3C1)1542094 - 2247
NM_001020825 (NR3C1)1542361 - 2514
NM_001018074 (NR3C1)1542191 - 2344
NM_001018077 (NR3C1)1542863 - 3016
NM_001204263 (NR3C1)1542361 - 2514
NM_001204262 (NR3C1)1542361 - 2514
NM_001024094 (NR3C1)1542364 - 2517
NM_001204265 (NR3C1)1542361 - 2514
NM_001204260 (NR3C1)1542361 - 2514
NM_001018076 (NR3C1)1541987 - 2140
NM_001204264 (NR3C1)1542361 - 2514
NM_000176 (NR3C1)1542361 - 2514
NM_001204259 (NR3C1)1542361 - 2514
 

See below for some more details.

Program Output:

Loading ...