Design Results for NRCAM

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 7 To Exon 9 (Pair 8)
Forward (893,21)ACATTGTTGTCCGCCCATCCAAmplicon SizecDNA: 180 bpgenomic: 6,004
Reverse (1072,22)GAGAAACTCTCTCACTTTGTGGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.125 kcal/mol
Forward Dimers-0.247 kcal/mol
Reverse Loops0.609 kcal/mol
Reverse Dimers-0.739 kcal/mol
Forward-Reverse Dimers-0.704 kcal/mol
Amplicon Folding0.048 kcal/mol outside primersite
Amplicon SequenceACATTGTTGTCCGCCCATCCAGATCACCATTGTGGACCAAAGAAAAACTTGAACCAATCA
CACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)180893 - 1072
NM_001193582 (NRCAM)180893 - 1072
NM_005010 (NRCAM)180875 - 1054
NM_001037132 (NRCAM)180513 - 692
NM_001193583 (NRCAM)180893 - 1072
Exon 7 To Exon 9 (Pair 7)
Forward (893,21)ACATTGTTGTCCGCCCATCCAAmplicon SizecDNA: 275 bpgenomic: 6,099
Reverse (1167,24)GGTTTGAGTATGATTAAATCTAGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.125 kcal/mol
Forward Dimers-0.247 kcal/mol
Reverse Loops1.897 kcal/mol
Reverse Dimers-0.567 kcal/mol
Forward-Reverse Dimers-1.359 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACATTGTTGTCCGCCCATCCAGATCACCATTGTGGACCAAAGAAAAACTTGAACCAATCA
CACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCTAGATTTAATCATACTCAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)275513 - 787
NM_001193583 (NRCAM)275893 - 1167
NM_001193582 (NRCAM)275893 - 1167
NM_005010 (NRCAM)275875 - 1149
NM_001193584 (NRCAM)275893 - 1167
Exon 7 To Exon 9 (Pair 6)
Forward (893,21)ACATTGTTGTCCGCCCATCCAAmplicon SizecDNA: 257 bpgenomic: 6,081
Reverse (1149,24)TCTAGCATAACAGATATAGTCTTCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.125 kcal/mol
Forward Dimers-0.247 kcal/mol
Reverse Loops0.68 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.034 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACATTGTTGTCCGCCCATCCAGATCACCATTGTGGACCAAAGAAAAACTTGAACCAATCA
CACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)257875 - 1131
NM_001193582 (NRCAM)257893 - 1149
NM_001193583 (NRCAM)257893 - 1149
NM_001037132 (NRCAM)257513 - 769
NM_001193584 (NRCAM)257893 - 1149
Exon 7 To Exon 9 (Pair 5)
Forward (893,21)ACATTGTTGTCCGCCCATCCAAmplicon SizecDNA: 254 bpgenomic: 6,078
Reverse (1146,23)AGCATAACAGATATAGTCTTCGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.125 kcal/mol
Forward Dimers-0.247 kcal/mol
Reverse Loops0.68 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.034 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACATTGTTGTCCGCCCATCCAGATCACCATTGTGGACCAAAGAAAAACTTGAACCAATCA
CACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)254893 - 1146
NM_005010 (NRCAM)254875 - 1128
NM_001037132 (NRCAM)254513 - 766
NM_001193583 (NRCAM)254893 - 1146
NM_001193584 (NRCAM)254893 - 1146
Exon 7 To Exon 9 (Pair 4)
Forward (893,21)ACATTGTTGTCCGCCCATCCAAmplicon SizecDNA: 299 bpgenomic: 6,123
Reverse (1191,23)AGAAATAGGTTGCTTCTGCTGTANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.125 kcal/mol
Forward Dimers-0.247 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.079 kcal/mol
Forward-Reverse Dimers-0.794 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACATTGTTGTCCGCCCATCCAGATCACCATTGTGGACCAAAGAAAAACTTGAACCAATCA
CACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)299513 - 811
NM_001193583 (NRCAM)299893 - 1191
NM_001193582 (NRCAM)299893 - 1191
NM_005010 (NRCAM)299875 - 1173
NM_001193584 (NRCAM)299893 - 1191
Exon 7 To Exon 9 (Pair 3)
Forward (892,21)AACATTGTTGTCCGCCCATCCAmplicon SizecDNA: 276 bpgenomic: 6,100
Reverse (1167,24)GGTTTGAGTATGATTAAATCTAGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.584 kcal/mol
Forward Dimers-1.329 kcal/mol
Reverse Loops1.897 kcal/mol
Reverse Dimers-0.567 kcal/mol
Forward-Reverse Dimers-1.359 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceAACATTGTTGTCCGCCCATCCAGATCACCATTGTGGACCAAAGAAAAACTTGAACCAATC
ACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCA
CCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
CAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGAC
TATATCTGTTATGCTAGATTTAATCATACTCAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193583 (NRCAM)276892 - 1167
NM_001037132 (NRCAM)276512 - 787
NM_005010 (NRCAM)276874 - 1149
NM_001193582 (NRCAM)276892 - 1167
NM_001193584 (NRCAM)276892 - 1167
Exon 7 To Exon 9 (Pair 2)
Forward (892,21)AACATTGTTGTCCGCCCATCCAmplicon SizecDNA: 258 bpgenomic: 6,082
Reverse (1149,24)TCTAGCATAACAGATATAGTCTTCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.584 kcal/mol
Forward Dimers-1.329 kcal/mol
Reverse Loops0.68 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.034 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceAACATTGTTGTCCGCCCATCCAGATCACCATTGTGGACCAAAGAAAAACTTGAACCAATC
ACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCA
CCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
CAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGAC
TATATCTGTTATGCTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)258874 - 1131
NM_001193582 (NRCAM)258892 - 1149
NM_001193583 (NRCAM)258892 - 1149
NM_001037132 (NRCAM)258512 - 769
NM_001193584 (NRCAM)258892 - 1149
Exon 7 To Exon 9 (Pair 1)
Forward (893,21)ACATTGTTGTCCGCCCATCCAAmplicon SizecDNA: 298 bpgenomic: 6,122
Reverse (1190,23)GAAATAGGTTGCTTCTGCTGTATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.125 kcal/mol
Forward Dimers-0.247 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.794 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACATTGTTGTCCGCCCATCCAGATCACCATTGTGGACCAAAGAAAAACTTGAACCAATCA
CACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)298875 - 1172
NM_001193583 (NRCAM)298893 - 1190
NM_001193582 (NRCAM)298893 - 1190
NM_001037132 (NRCAM)298513 - 810
NM_001193584 (NRCAM)298893 - 1190
Exon 7 To Exon 9 (Pair 9)
Forward (893,21)ACATTGTTGTCCGCCCATCCAAmplicon SizecDNA: 297 bpgenomic: 6,121
Reverse (1189,23)AAATAGGTTGCTTCTGCTGTATGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.125 kcal/mol
Forward Dimers-0.247 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.794 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACATTGTTGTCCGCCCATCCAGATCACCATTGTGGACCAAAGAAAAACTTGAACCAATCA
CACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193583 (NRCAM)297893 - 1189
NM_001037132 (NRCAM)297513 - 809
NM_005010 (NRCAM)297875 - 1171
NM_001193582 (NRCAM)297893 - 1189
NM_001193584 (NRCAM)297893 - 1189
Exon 7 To Exon 9 (Pair 10)
Forward (892,21)AACATTGTTGTCCGCCCATCCAmplicon SizecDNA: 255 bpgenomic: 6,079
Reverse (1146,23)AGCATAACAGATATAGTCTTCGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.584 kcal/mol
Forward Dimers-1.329 kcal/mol
Reverse Loops0.68 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.034 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceAACATTGTTGTCCGCCCATCCAGATCACCATTGTGGACCAAAGAAAAACTTGAACCAATC
ACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCA
CCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
CAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGAC
TATATCTGTTATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)255874 - 1128
NM_001193582 (NRCAM)255892 - 1146
NM_001193583 (NRCAM)255892 - 1146
NM_001037132 (NRCAM)255512 - 766
NM_001193584 (NRCAM)255892 - 1146
Exon 8 To Exon 10 (Pair 76)
Forward (965,22)GTCAGTCTTTAGTACTTCCCTGAmplicon SizecDNA: 271 bpgenomic: 5,429
Reverse (1235,23)GCAGCTATAGTGTCATTCAATTCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.968 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTT
GGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATG
GGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATG
CTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGTGATTT
CAGTGGATGAATTGAATGACACTATAGCTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005010 (NRCAM)271947 - 1217
NM_001193582 (NRCAM)271965 - 1235
NM_001037132 (NRCAM)271585 - 855
Exon 8 To Exon 9 (Pair 141)
Forward (996,24)AATTGGATTACCACCACCTATAATAmplicon SizecDNA: 154 bpgenomic: 4,806
Reverse (1149,24)TCTAGCATAACAGATATAGTCTTCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops0.68 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.71 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceAATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACA
AAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGA
GGACACCCGCGAAGACTATATCTGTTATGCTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)154996 - 1149
NM_005010 (NRCAM)154978 - 1131
NM_001193582 (NRCAM)154996 - 1149
NM_001193583 (NRCAM)154996 - 1149
NM_001037132 (NRCAM)154616 - 769
Exon 8 To Exon 9 (Pair 140)
Forward (999,24)TGGATTACCACCACCTATAATATTAmplicon SizecDNA: 169 bpgenomic: 4,821
Reverse (1167,24)GGTTTGAGTATGATTAAATCTAGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.772 kcal/mol
Forward Dimers-1.163 kcal/mol
Reverse Loops1.897 kcal/mol
Reverse Dimers-0.567 kcal/mol
Forward-Reverse Dimers-1.64 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAG
TGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGA
CACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)169999 - 1167
NM_005010 (NRCAM)169981 - 1149
NM_001037132 (NRCAM)169619 - 787
NM_001193583 (NRCAM)169999 - 1167
NM_001193584 (NRCAM)169999 - 1167
Exon 8 To Exon 9 (Pair 139)
Forward (950,22)TCACACTTCAAAGTGGTCAGTCAmplicon SizecDNA: 240 bpgenomic: 4,892
Reverse (1189,23)AAATAGGTTGCTTCTGCTGTATGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCAC
CACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTT
CTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAG
ACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)240950 - 1189
NM_001037132 (NRCAM)240570 - 809
NM_001193583 (NRCAM)240950 - 1189
NM_001193582 (NRCAM)240950 - 1189
NM_005010 (NRCAM)240932 - 1171
Exon 8 To Exon 9 (Pair 138)
Forward (998,24)TTGGATTACCACCACCTATAATATAmplicon SizecDNA: 152 bpgenomic: 4,804
Reverse (1149,24)TCTAGCATAACAGATATAGTCTTCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops0.68 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.71 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAA
GTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGG
ACACCCGCGAAGACTATATCTGTTATGCTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193583 (NRCAM)152998 - 1149
NM_001037132 (NRCAM)152618 - 769
NM_005010 (NRCAM)152980 - 1131
NM_001193582 (NRCAM)152998 - 1149
NM_001193584 (NRCAM)152998 - 1149
Exon 8 To Exon 9 (Pair 137)
Forward (966,22)TCAGTCTTTAGTACTTCCCTGCAmplicon SizecDNA: 106 bpgenomic: 4,758
Reverse (1071,23)AGAAACTCTCTCACTTTGTGGAANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.172 kcal/mol
Reverse Dimers-0.176 kcal/mol
Forward-Reverse Dimers-1.795 kcal/mol
Amplicon Folding0.052 kcal/mol inside primersite
Amplicon SequenceTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTTG
GATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)106966 - 1071
NM_005010 (NRCAM)106948 - 1053
NM_001037132 (NRCAM)106586 - 691
NM_001193583 (NRCAM)106966 - 1071
NM_001193584 (NRCAM)106966 - 1071
Exon 8 To Exon 9 (Pair 136)
Forward (952,23)ACACTTCAAAGTGGTCAGTCTTTAmplicon SizecDNA: 238 bpgenomic: 4,890
Reverse (1189,23)AAATAGGTTGCTTCTGCTGTATGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCA
CCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
CAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGAC
TATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)238572 - 809
NM_001193583 (NRCAM)238952 - 1189
NM_001193582 (NRCAM)238952 - 1189
NM_005010 (NRCAM)238934 - 1171
NM_001193584 (NRCAM)238952 - 1189
Exon 8 To Exon 9 (Pair 135)
Forward (965,22)GTCAGTCTTTAGTACTTCCCTGAmplicon SizecDNA: 220 bpgenomic: 4,872
Reverse (1184,22)GGTTGCTTCTGCTGTATGGTTTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.511 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTT
GGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATG
GGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATG
CTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)220585 - 804
NM_001193583 (NRCAM)220965 - 1184
NM_001193582 (NRCAM)220965 - 1184
NM_005010 (NRCAM)220947 - 1166
NM_001193584 (NRCAM)220965 - 1184
Exon 8 To Exon 9 (Pair 134)
Forward (954,23)ACTTCAAAGTGGTCAGTCTTTAGAmplicon SizecDNA: 231 bpgenomic: 4,883
Reverse (1184,22)GGTTGCTTCTGCTGTATGGTTTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.13 kcal/mol
Forward Dimers-1.195 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACC
TATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCA
AGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTA
TATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)231954 - 1184
NM_001193582 (NRCAM)231954 - 1184
NM_005010 (NRCAM)231936 - 1166
NM_001037132 (NRCAM)231574 - 804
NM_001193583 (NRCAM)231954 - 1184
Exon 8 To Exon 10 (Pair 75)
Forward (965,22)GTCAGTCTTTAGTACTTCCCTGAmplicon SizecDNA: 273 bpgenomic: 5,431
Reverse (1237,24)TAGCAGCTATAGTGTCATTCAATTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.968 kcal/mol in 3' area
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTT
GGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATG
GGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATG
CTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGTGATTT
CAGTGGATGAATTGAATGACACTATAGCTGCTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005010 (NRCAM)273947 - 1219
NM_001193582 (NRCAM)273965 - 1237
NM_001037132 (NRCAM)273585 - 857
Exon 8 To Exon 9 (Pair 133)
Forward (964,22)GGTCAGTCTTTAGTACTTCCCTAmplicon SizecDNA: 222 bpgenomic: 4,874
Reverse (1185,22)AGGTTGCTTCTGCTGTATGGTTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.511 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTT
TGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAAT
GGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTAT
GCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193583 (NRCAM)222964 - 1185
NM_001037132 (NRCAM)222584 - 805
NM_005010 (NRCAM)222946 - 1167
NM_001193582 (NRCAM)222964 - 1185
NM_001193584 (NRCAM)222964 - 1185
Exon 8 To Exon 9 (Pair 132)
Forward (952,23)ACACTTCAAAGTGGTCAGTCTTTAmplicon SizecDNA: 216 bpgenomic: 4,868
Reverse (1167,24)GGTTTGAGTATGATTAAATCTAGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.897 kcal/mol
Reverse Dimers-0.567 kcal/mol
Forward-Reverse Dimers-1.746 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCA
CCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
CAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGAC
TATATCTGTTATGCTAGATTTAATCATACTCAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)216934 - 1149
NM_001193582 (NRCAM)216952 - 1167
NM_001193583 (NRCAM)216952 - 1167
NM_001037132 (NRCAM)216572 - 787
NM_001193584 (NRCAM)216952 - 1167
Exon 8 To Exon 10 (Pair 74)
Forward (964,22)GGTCAGTCTTTAGTACTTCCCTAmplicon SizecDNA: 270 bpgenomic: 5,428
Reverse (1233,24)AGCTATAGTGTCATTCAATTCATCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.968 kcal/mol
Reverse Dimers-1.696 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTT
TGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAAT
GGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTAT
GCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGTGATT
TCAGTGGATGAATTGAATGACACTATAGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005010 (NRCAM)270946 - 1215
NM_001193582 (NRCAM)270964 - 1233
NM_001037132 (NRCAM)270584 - 853
Exon 8 To Exon 10 (Pair 73)
Forward (997,24)ATTGGATTACCACCACCTATAATAAmplicon SizecDNA: 237 bpgenomic: 5,395
Reverse (1233,24)AGCTATAGTGTCATTCAATTCATCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops1.968 kcal/mol
Reverse Dimers-1.696 kcal/mol
Forward-Reverse Dimers-1.287 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAA
AGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAG
GACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAG
AAGCAACCTATTTCTGTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)237617 - 853
NM_005010 (NRCAM)237979 - 1215
NM_001193582 (NRCAM)237997 - 1233
Exon 8 To Exon 9 (Pair 131)
Forward (948,23)AATCACACTTCAAAGTGGTCAGTAmplicon SizecDNA: 243 bpgenomic: 4,895
Reverse (1190,23)GAAATAGGTTGCTTCTGCTGTATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceAATCACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACC
ACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGT
TTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGA
AGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTAT
TTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)243568 - 810
NM_001193583 (NRCAM)243948 - 1190
NM_001193582 (NRCAM)243948 - 1190
NM_005010 (NRCAM)243930 - 1172
NM_001193584 (NRCAM)243948 - 1190
Exon 8 To Exon 10 (Pair 72)
Forward (996,24)AATTGGATTACCACCACCTATAATAmplicon SizecDNA: 245 bpgenomic: 5,403
Reverse (1240,24)AATTAGCAGCTATAGTGTCATTCANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops2.038 kcal/mol in 3' area
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-0.609 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceAATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACA
AAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGA
GGACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCA
GAAGCAACCTATTTCTGTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGC
TAATT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)245616 - 860
NM_005010 (NRCAM)245978 - 1222
NM_001193582 (NRCAM)245996 - 1240
Exon 8 To Exon 9 (Pair 130)
Forward (964,22)GGTCAGTCTTTAGTACTTCCCTAmplicon SizecDNA: 183 bpgenomic: 4,835
Reverse (1146,23)AGCATAACAGATATAGTCTTCGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops0.68 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.235 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTT
TGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAAT
GGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTAT
GCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)183946 - 1128
NM_001193582 (NRCAM)183964 - 1146
NM_001193583 (NRCAM)183964 - 1146
NM_001037132 (NRCAM)183584 - 766
NM_001193584 (NRCAM)183964 - 1146
Exon 8 To Exon 9 (Pair 129)
Forward (954,23)ACTTCAAAGTGGTCAGTCTTTAGAmplicon SizecDNA: 238 bpgenomic: 4,890
Reverse (1191,23)AGAAATAGGTTGCTTCTGCTGTANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.13 kcal/mol
Forward Dimers-1.195 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.079 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACC
TATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCA
AGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTA
TATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)238954 - 1191
NM_001037132 (NRCAM)238574 - 811
NM_001193583 (NRCAM)238954 - 1191
NM_001193582 (NRCAM)238954 - 1191
NM_005010 (NRCAM)238936 - 1173
Exon 8 To Exon 9 (Pair 128)
Forward (964,22)GGTCAGTCTTTAGTACTTCCCTAmplicon SizecDNA: 218 bpgenomic: 4,870
Reverse (1181,22)TGCTTCTGCTGTATGGTTTGAGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.511 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTT
TGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAAT
GGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTAT
GCTAGATTTAATCATACTCAAACCATACAGCAGAAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)218964 - 1181
NM_005010 (NRCAM)218946 - 1163
NM_001037132 (NRCAM)218584 - 801
NM_001193583 (NRCAM)218964 - 1181
NM_001193584 (NRCAM)218964 - 1181
Exon 8 To Exon 10 (Pair 71)
Forward (952,23)ACACTTCAAAGTGGTCAGTCTTTAmplicon SizecDNA: 284 bpgenomic: 5,442
Reverse (1235,23)GCAGCTATAGTGTCATTCAATTCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.968 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-2.771 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCA
CCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
CAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGAC
TATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCT
GTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)284572 - 855
NM_001193582 (NRCAM)284952 - 1235
NM_005010 (NRCAM)284934 - 1217
Exon 8 To Exon 9 (Pair 127)
Forward (999,24)TGGATTACCACCACCTATAATATTAmplicon SizecDNA: 119 bpgenomic: 4,771
Reverse (1117,21)CCTCTGGGAGGACATTGGAAANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.772 kcal/mol
Forward Dimers-1.163 kcal/mol
Reverse Loops0.011 kcal/mol
Reverse Dimers-1.559 kcal/mol
Forward-Reverse Dimers-2.471 kcal/mol
Amplicon Folding-0.259 kcal/mol outside primersite
Amplicon SequenceTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAG
TGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)119999 - 1117
NM_005010 (NRCAM)119981 - 1099
NM_001193582 (NRCAM)119999 - 1117
NM_001193583 (NRCAM)119999 - 1117
NM_001037132 (NRCAM)119619 - 737
Exon 8 To Exon 10 (Pair 70)
Forward (954,23)ACTTCAAAGTGGTCAGTCTTTAGAmplicon SizecDNA: 289 bpgenomic: 5,447
Reverse (1242,24)CAAATTAGCAGCTATAGTGTCATTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.13 kcal/mol
Forward Dimers-1.195 kcal/mol
Reverse Loops2.135 kcal/mol
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-0.894 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACC
TATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCA
AGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTA
TATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGT
GAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTAATTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)289574 - 862
NM_001193582 (NRCAM)289954 - 1242
NM_005010 (NRCAM)289936 - 1224
Exon 8 To Exon 10 (Pair 69)
Forward (957,23)TCAAAGTGGTCAGTCTTTAGTACAmplicon SizecDNA: 282 bpgenomic: 5,440
Reverse (1238,24)TTAGCAGCTATAGTGTCATTCAATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.452 kcal/mol
Reverse Loops1.968 kcal/mol in 3' area
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-0.386 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTAT
AATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGG
TTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATAT
CTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAA
GGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)282577 - 858
NM_001193582 (NRCAM)282957 - 1238
NM_005010 (NRCAM)282939 - 1220
Exon 8 To Exon 10 (Pair 68)
Forward (967,22)CAGTCTTTAGTACTTCCCTGCAAmplicon SizecDNA: 265 bpgenomic: 5,423
Reverse (1231,24)CTATAGTGTCATTCAATTCATCCANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.968 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTTGG
ATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATGGG
GACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATGCT
AGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGTGATTTCA
GTGGATGAATTGAATGACACTATAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)265587 - 851
NM_001193582 (NRCAM)265967 - 1231
NM_005010 (NRCAM)265949 - 1213
Exon 8 To Exon 10 (Pair 67)
Forward (953,23)CACTTCAAAGTGGTCAGTCTTTAAmplicon SizecDNA: 285 bpgenomic: 5,443
Reverse (1237,24)TAGCAGCTATAGTGTCATTCAATTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.59 kcal/mol
Forward Dimers-1.735 kcal/mol
Reverse Loops1.968 kcal/mol in 3' area
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-1.368 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTG
TGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005010 (NRCAM)285935 - 1219
NM_001193582 (NRCAM)285953 - 1237
NM_001037132 (NRCAM)285573 - 857
Exon 8 To Exon 9 (Pair 126)
Forward (965,22)GTCAGTCTTTAGTACTTCCCTGAmplicon SizecDNA: 107 bpgenomic: 4,759
Reverse (1071,23)AGAAACTCTCTCACTTTGTGGAANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.172 kcal/mol
Reverse Dimers-0.176 kcal/mol
Forward-Reverse Dimers-1.795 kcal/mol
Amplicon Folding0.052 kcal/mol inside primersite
Amplicon SequenceGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTT
GGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)107585 - 691
NM_001193583 (NRCAM)107965 - 1071
NM_001193582 (NRCAM)107965 - 1071
NM_005010 (NRCAM)107947 - 1053
NM_001193584 (NRCAM)107965 - 1071
Exon 8 To Exon 10 (Pair 66)
Forward (997,24)ATTGGATTACCACCACCTATAATAAmplicon SizecDNA: 248 bpgenomic: 5,406
Reverse (1244,23)CTCAAATTAGCAGCTATAGTGTCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops2.135 kcal/mol
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-0.991 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAA
AGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAG
GACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAG
AAGCAACCTATTTCTGTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCT
AATTTGAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005010 (NRCAM)248979 - 1226
NM_001193582 (NRCAM)248997 - 1244
NM_001037132 (NRCAM)248617 - 864
Exon 8 To Exon 9 (Pair 125)
Forward (915,23)ATCACCATTGTGGACCAAAGAAAAmplicon SizecDNA: 285 bpgenomic: 4,937
Reverse (1199,23)ACCTTCACAGAAATAGGTTGCTTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.073 kcal/mol
Forward Dimers-1.382 kcal/mol
Reverse Loops0.878 kcal/mol
Reverse Dimers-1.883 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceATCACCATTGTGGACCAAAGAAAAACTTGAACCAATCACACTTCAAAGTGGTCAGTCTTT
AGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTTGGATGGATAA
TTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTA
TTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATGCTAGATTTAA
TCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)285915 - 1199
NM_001193582 (NRCAM)285915 - 1199
NM_005010 (NRCAM)285897 - 1181
NM_001037132 (NRCAM)285535 - 819
NM_001193583 (NRCAM)285915 - 1199
Exon 8 To Exon 9 (Pair 124)
Forward (950,22)TCACACTTCAAAGTGGTCAGTCAmplicon SizecDNA: 218 bpgenomic: 4,870
Reverse (1167,24)GGTTTGAGTATGATTAAATCTAGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.897 kcal/mol
Reverse Dimers-0.567 kcal/mol
Forward-Reverse Dimers-1.746 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCAC
CACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTT
CTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAG
ACTATATCTGTTATGCTAGATTTAATCATACTCAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)218950 - 1167
NM_001193583 (NRCAM)218950 - 1167
NM_001037132 (NRCAM)218570 - 787
NM_005010 (NRCAM)218932 - 1149
NM_001193582 (NRCAM)218950 - 1167
Exon 8 To Exon 9 (Pair 123)
Forward (998,24)TTGGATTACCACCACCTATAATATAmplicon SizecDNA: 182 bpgenomic: 4,834
Reverse (1179,23)CTTCTGCTGTATGGTTTGAGTATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops2.558 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.538 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAA
GTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGG
ACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGA
AG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193583 (NRCAM)182998 - 1179
NM_001037132 (NRCAM)182618 - 799
NM_005010 (NRCAM)182980 - 1161
NM_001193582 (NRCAM)182998 - 1179
NM_001193584 (NRCAM)182998 - 1179
Exon 8 To Exon 10 (Pair 65)
Forward (999,24)TGGATTACCACCACCTATAATATTAmplicon SizecDNA: 248 bpgenomic: 5,406
Reverse (1246,23)CACTCAAATTAGCAGCTATAGTGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.772 kcal/mol
Forward Dimers-1.163 kcal/mol
Reverse Loops2.097 kcal/mol in 3' area
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-0.991 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAG
TGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGA
CACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAA
GCAACCTATTTCTGTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTAA
TTTGAGTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005010 (NRCAM)248981 - 1228
NM_001193582 (NRCAM)248999 - 1246
NM_001037132 (NRCAM)248619 - 866
Exon 8 To Exon 10 (Pair 64)
Forward (996,24)AATTGGATTACCACCACCTATAATAmplicon SizecDNA: 238 bpgenomic: 5,396
Reverse (1233,24)AGCTATAGTGTCATTCAATTCATCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops1.968 kcal/mol
Reverse Dimers-1.696 kcal/mol
Forward-Reverse Dimers-1.828 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceAATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACA
AAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGA
GGACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCA
GAAGCAACCTATTTCTGTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)238616 - 853
NM_001193582 (NRCAM)238996 - 1233
NM_005010 (NRCAM)238978 - 1215
Exon 8 To Exon 9 (Pair 122)
Forward (997,24)ATTGGATTACCACCACCTATAATAAmplicon SizecDNA: 171 bpgenomic: 4,823
Reverse (1167,24)GGTTTGAGTATGATTAAATCTAGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops1.897 kcal/mol
Reverse Dimers-0.567 kcal/mol
Forward-Reverse Dimers-1.64 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAA
AGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAG
GACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193583 (NRCAM)171997 - 1167
NM_001037132 (NRCAM)171617 - 787
NM_005010 (NRCAM)171979 - 1149
NM_001193582 (NRCAM)171997 - 1167
NM_001193584 (NRCAM)171997 - 1167
Exon 8 To Exon 9 (Pair 121)
Forward (957,23)TCAAAGTGGTCAGTCTTTAGTACAmplicon SizecDNA: 222 bpgenomic: 4,874
Reverse (1178,23)TTCTGCTGTATGGTTTGAGTATGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.452 kcal/mol
Reverse Loops2.558 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.337 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTAT
AATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGG
TTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATAT
CTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)222957 - 1178
NM_005010 (NRCAM)222939 - 1160
NM_001037132 (NRCAM)222577 - 798
NM_001193583 (NRCAM)222957 - 1178
NM_001193584 (NRCAM)222957 - 1178
Exon 8 To Exon 9 (Pair 120)
Forward (997,24)ATTGGATTACCACCACCTATAATAAmplicon SizecDNA: 185 bpgenomic: 4,837
Reverse (1181,22)TGCTTCTGCTGTATGGTTTGAGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.538 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAA
AGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAG
GACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAG
AAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)185979 - 1163
NM_001193582 (NRCAM)185997 - 1181
NM_001193583 (NRCAM)185997 - 1181
NM_001037132 (NRCAM)185617 - 801
NM_001193584 (NRCAM)185997 - 1181
Exon 8 To Exon 9 (Pair 119)
Forward (964,22)GGTCAGTCTTTAGTACTTCCCTAmplicon SizecDNA: 236 bpgenomic: 4,888
Reverse (1199,23)ACCTTCACAGAAATAGGTTGCTTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops0.878 kcal/mol
Reverse Dimers-1.883 kcal/mol
Forward-Reverse Dimers-1.105 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTT
TGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAAT
GGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTAT
GCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)236964 - 1199
NM_001037132 (NRCAM)236584 - 819
NM_001193583 (NRCAM)236964 - 1199
NM_001193582 (NRCAM)236964 - 1199
NM_005010 (NRCAM)236946 - 1181
Exon 8 To Exon 9 (Pair 118)
Forward (950,22)TCACACTTCAAAGTGGTCAGTCAmplicon SizecDNA: 241 bpgenomic: 4,893
Reverse (1190,23)GAAATAGGTTGCTTCTGCTGTATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCAC
CACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTT
CTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAG
ACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTT
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)241932 - 1172
NM_001193582 (NRCAM)241950 - 1190
NM_001193583 (NRCAM)241950 - 1190
NM_001037132 (NRCAM)241570 - 810
NM_001193584 (NRCAM)241950 - 1190
Exon 8 To Exon 9 (Pair 117)
Forward (957,23)TCAAAGTGGTCAGTCTTTAGTACAmplicon SizecDNA: 193 bpgenomic: 4,845
Reverse (1149,24)TCTAGCATAACAGATATAGTCTTCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.452 kcal/mol
Reverse Loops0.68 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.867 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTAT
AATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGG
TTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATAT
CTGTTATGCTAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)193957 - 1149
NM_001037132 (NRCAM)193577 - 769
NM_001193583 (NRCAM)193957 - 1149
NM_001193582 (NRCAM)193957 - 1149
NM_005010 (NRCAM)193939 - 1131
Exon 8 To Exon 9 (Pair 116)
Forward (999,24)TGGATTACCACCACCTATAATATTAmplicon SizecDNA: 178 bpgenomic: 4,830
Reverse (1176,23)CTGCTGTATGGTTTGAGTATGATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.772 kcal/mol
Forward Dimers-1.163 kcal/mol
Reverse Loops2.558 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.538 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAG
TGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGA
CACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)178999 - 1176
NM_005010 (NRCAM)178981 - 1158
NM_001037132 (NRCAM)178619 - 796
NM_001193583 (NRCAM)178999 - 1176
NM_001193584 (NRCAM)178999 - 1176
Exon 8 To Exon 9 (Pair 115)
Forward (953,23)CACTTCAAAGTGGTCAGTCTTTAAmplicon SizecDNA: 238 bpgenomic: 4,890
Reverse (1190,23)GAAATAGGTTGCTTCTGCTGTATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.59 kcal/mol
Forward Dimers-1.735 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193583 (NRCAM)238953 - 1190
NM_001037132 (NRCAM)238573 - 810
NM_005010 (NRCAM)238935 - 1172
NM_001193582 (NRCAM)238953 - 1190
NM_001193584 (NRCAM)238953 - 1190
Exon 8 To Exon 9 (Pair 114)
Forward (964,22)GGTCAGTCTTTAGTACTTCCCTAmplicon SizecDNA: 204 bpgenomic: 4,856
Reverse (1167,24)GGTTTGAGTATGATTAAATCTAGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.897 kcal/mol
Reverse Dimers-0.567 kcal/mol
Forward-Reverse Dimers-1.502 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTT
TGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAAT
GGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTAT
GCTAGATTTAATCATACTCAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)204946 - 1149
NM_001193582 (NRCAM)204964 - 1167
NM_001193583 (NRCAM)204964 - 1167
NM_001037132 (NRCAM)204584 - 787
NM_001193584 (NRCAM)204964 - 1167
Exon 8 To Exon 9 (Pair 113)
Forward (996,24)AATTGGATTACCACCACCTATAATAmplicon SizecDNA: 122 bpgenomic: 4,774
Reverse (1117,21)CCTCTGGGAGGACATTGGAAANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops0.011 kcal/mol
Reverse Dimers-1.559 kcal/mol
Forward-Reverse Dimers-2.471 kcal/mol
Amplicon Folding-0.259 kcal/mol outside primersite
Amplicon SequenceAATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACA
AAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGA
GG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)122996 - 1117
NM_001193583 (NRCAM)122996 - 1117
NM_001037132 (NRCAM)122616 - 737
NM_005010 (NRCAM)122978 - 1099
NM_001193582 (NRCAM)122996 - 1117
Exon 8 To Exon 9 (Pair 112)
Forward (966,22)TCAGTCTTTAGTACTTCCCTGCAmplicon SizecDNA: 107 bpgenomic: 4,759
Reverse (1072,22)GAGAAACTCTCTCACTTTGTGGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops0.609 kcal/mol
Reverse Dimers-0.739 kcal/mol
Forward-Reverse Dimers-1.795 kcal/mol
Amplicon Folding0.052 kcal/mol inside primersite
Amplicon SequenceTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTTG
GATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)107966 - 1072
NM_005010 (NRCAM)107948 - 1054
NM_001037132 (NRCAM)107586 - 692
NM_001193583 (NRCAM)107966 - 1072
NM_001193584 (NRCAM)107966 - 1072
Exon 8 To Exon 10 (Pair 63)
Forward (995,23)CAATTGGATTACCACCACCTATAAmplicon SizecDNA: 248 bpgenomic: 5,406
Reverse (1242,24)CAAATTAGCAGCTATAGTGTCATTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops2.135 kcal/mol
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-1.239 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCAATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCAC
AAAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAG
AGGACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGC
AGAAGCAACCTATTTCTGTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTG
CTAATTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005010 (NRCAM)248977 - 1224
NM_001193582 (NRCAM)248995 - 1242
NM_001037132 (NRCAM)248615 - 862
Exon 8 To Exon 9 (Pair 111)
Forward (948,23)AATCACACTTCAAAGTGGTCAGTAmplicon SizecDNA: 238 bpgenomic: 4,890
Reverse (1185,22)AGGTTGCTTCTGCTGTATGGTTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceAATCACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACC
ACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGT
TTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGA
AGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)238948 - 1185
NM_005010 (NRCAM)238930 - 1167
NM_001037132 (NRCAM)238568 - 805
NM_001193583 (NRCAM)238948 - 1185
NM_001193584 (NRCAM)238948 - 1185
Exon 8 To Exon 9 (Pair 110)
Forward (953,23)CACTTCAAAGTGGTCAGTCTTTAAmplicon SizecDNA: 234 bpgenomic: 4,886
Reverse (1186,22)TAGGTTGCTTCTGCTGTATGGTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.59 kcal/mol
Forward Dimers-1.735 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)234573 - 806
NM_001193583 (NRCAM)234953 - 1186
NM_001193582 (NRCAM)234953 - 1186
NM_005010 (NRCAM)234935 - 1168
NM_001193584 (NRCAM)234953 - 1186
Exon 8 To Exon 9 (Pair 109)
Forward (948,23)AATCACACTTCAAAGTGGTCAGTAmplicon SizecDNA: 220 bpgenomic: 4,872
Reverse (1167,24)GGTTTGAGTATGATTAAATCTAGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.897 kcal/mol
Reverse Dimers-0.567 kcal/mol
Forward-Reverse Dimers-2.617 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceAATCACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACC
ACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGT
TTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGA
AGACTATATCTGTTATGCTAGATTTAATCATACTCAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)220948 - 1167
NM_001193582 (NRCAM)220948 - 1167
NM_005010 (NRCAM)220930 - 1149
NM_001037132 (NRCAM)220568 - 787
NM_001193583 (NRCAM)220948 - 1167
Exon 8 To Exon 9 (Pair 108)
Forward (995,23)CAATTGGATTACCACCACCTATAAmplicon SizecDNA: 184 bpgenomic: 4,836
Reverse (1178,23)TTCTGCTGTATGGTTTGAGTATGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops2.558 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.538 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCAATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCAC
AAAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAG
AGGACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGC
AGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)184995 - 1178
NM_005010 (NRCAM)184977 - 1160
NM_001193582 (NRCAM)184995 - 1178
NM_001193583 (NRCAM)184995 - 1178
NM_001037132 (NRCAM)184615 - 798
Exon 8 To Exon 10 (Pair 62)
Forward (952,23)ACACTTCAAAGTGGTCAGTCTTTAmplicon SizecDNA: 280 bpgenomic: 5,438
Reverse (1231,24)CTATAGTGTCATTCAATTCATCCANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.968 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-2.771 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCA
CCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
CAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGAC
TATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCT
GTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)280952 - 1231
NM_005010 (NRCAM)280934 - 1213
NM_001037132 (NRCAM)280572 - 851
Exon 8 To Exon 9 (Pair 107)
Forward (998,24)TTGGATTACCACCACCTATAATATAmplicon SizecDNA: 120 bpgenomic: 4,772
Reverse (1117,21)CCTCTGGGAGGACATTGGAAANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops0.011 kcal/mol
Reverse Dimers-1.559 kcal/mol
Forward-Reverse Dimers-2.471 kcal/mol
Amplicon Folding-0.259 kcal/mol outside primersite
Amplicon SequenceTTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAA
GTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)120998 - 1117
NM_001193583 (NRCAM)120998 - 1117
NM_001037132 (NRCAM)120618 - 737
NM_005010 (NRCAM)120980 - 1099
NM_001193582 (NRCAM)120998 - 1117
Exon 8 To Exon 9 (Pair 106)
Forward (957,23)TCAAAGTGGTCAGTCTTTAGTACAmplicon SizecDNA: 233 bpgenomic: 4,885
Reverse (1189,23)AAATAGGTTGCTTCTGCTGTATGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.452 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTAT
AATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGG
TTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATAT
CTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)233957 - 1189
NM_005010 (NRCAM)233939 - 1171
NM_001037132 (NRCAM)233577 - 809
NM_001193583 (NRCAM)233957 - 1189
NM_001193584 (NRCAM)233957 - 1189
Exon 8 To Exon 9 (Pair 105)
Forward (954,23)ACTTCAAAGTGGTCAGTCTTTAGAmplicon SizecDNA: 233 bpgenomic: 4,885
Reverse (1186,22)TAGGTTGCTTCTGCTGTATGGTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.13 kcal/mol
Forward Dimers-1.195 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACC
TATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCA
AGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTA
TATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)233954 - 1186
NM_005010 (NRCAM)233936 - 1168
NM_001037132 (NRCAM)233574 - 806
NM_001193583 (NRCAM)233954 - 1186
NM_001193584 (NRCAM)233954 - 1186
Exon 8 To Exon 10 (Pair 61)
Forward (964,22)GGTCAGTCTTTAGTACTTCCCTAmplicon SizecDNA: 280 bpgenomic: 5,438
Reverse (1243,24)TCAAATTAGCAGCTATAGTGTCATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops2.135 kcal/mol
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTT
TGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAAT
GGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTAT
GCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGTGATT
TCAGTGGATGAATTGAATGACACTATAGCTGCTAATTTGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)280584 - 863
NM_001193582 (NRCAM)280964 - 1243
NM_005010 (NRCAM)280946 - 1225
Exon 8 To Exon 9 (Pair 104)
Forward (967,22)CAGTCTTTAGTACTTCCCTGCAAmplicon SizecDNA: 210 bpgenomic: 4,862
Reverse (1176,23)CTGCTGTATGGTTTGAGTATGATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops2.558 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.502 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTTGG
ATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATGGG
GACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATGCT
AGATTTAATCATACTCAAACCATACAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)210967 - 1176
NM_001193582 (NRCAM)210967 - 1176
NM_005010 (NRCAM)210949 - 1158
NM_001037132 (NRCAM)210587 - 796
NM_001193583 (NRCAM)210967 - 1176
Exon 8 To Exon 10 (Pair 60)
Forward (999,24)TGGATTACCACCACCTATAATATTAmplicon SizecDNA: 245 bpgenomic: 5,403
Reverse (1243,24)TCAAATTAGCAGCTATAGTGTCATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.772 kcal/mol
Forward Dimers-1.163 kcal/mol
Reverse Loops2.135 kcal/mol
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-0.991 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAG
TGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGA
CACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAA
GCAACCTATTTCTGTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTAA
TTTGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005010 (NRCAM)245981 - 1225
NM_001193582 (NRCAM)245999 - 1243
NM_001037132 (NRCAM)245619 - 863
Exon 8 To Exon 9 (Pair 103)
Forward (957,23)TCAAAGTGGTCAGTCTTTAGTACAmplicon SizecDNA: 161 bpgenomic: 4,813
Reverse (1117,21)CCTCTGGGAGGACATTGGAAANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.452 kcal/mol
Reverse Loops0.011 kcal/mol
Reverse Dimers-1.559 kcal/mol
Forward-Reverse Dimers-0.961 kcal/mol
Amplicon Folding-0.259 kcal/mol outside primersite
Amplicon SequenceTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTAT
AATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGG
TTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)161577 - 737
NM_001193583 (NRCAM)161957 - 1117
NM_001193582 (NRCAM)161957 - 1117
NM_005010 (NRCAM)161939 - 1099
NM_001193584 (NRCAM)161957 - 1117
Exon 8 To Exon 10 (Pair 59)
Forward (953,23)CACTTCAAAGTGGTCAGTCTTTAAmplicon SizecDNA: 288 bpgenomic: 5,446
Reverse (1240,24)AATTAGCAGCTATAGTGTCATTCANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.59 kcal/mol
Forward Dimers-1.735 kcal/mol
Reverse Loops2.038 kcal/mol in 3' area
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-1.368 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTG
TGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTAATT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)288953 - 1240
NM_005010 (NRCAM)288935 - 1222
NM_001037132 (NRCAM)288573 - 860
Exon 8 To Exon 10 (Pair 58)
Forward (965,22)GTCAGTCTTTAGTACTTCCCTGAmplicon SizecDNA: 279 bpgenomic: 5,437
Reverse (1243,24)TCAAATTAGCAGCTATAGTGTCATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops2.135 kcal/mol
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTT
GGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATG
GGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATG
CTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGTGATTT
CAGTGGATGAATTGAATGACACTATAGCTGCTAATTTGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)279585 - 863
NM_001193582 (NRCAM)279965 - 1243
NM_005010 (NRCAM)279947 - 1225
Exon 8 To Exon 9 (Pair 102)
Forward (951,22)CACACTTCAAAGTGGTCAGTCTAmplicon SizecDNA: 234 bpgenomic: 4,886
Reverse (1184,22)GGTTGCTTCTGCTGTATGGTTTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACC
ACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTC
TCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGA
CTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)234571 - 804
NM_001193583 (NRCAM)234951 - 1184
NM_001193582 (NRCAM)234951 - 1184
NM_005010 (NRCAM)234933 - 1166
NM_001193584 (NRCAM)234951 - 1184
Exon 8 To Exon 9 (Pair 101)
Forward (952,23)ACACTTCAAAGTGGTCAGTCTTTAmplicon SizecDNA: 225 bpgenomic: 4,877
Reverse (1176,23)CTGCTGTATGGTTTGAGTATGATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops2.558 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.746 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCA
CCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
CAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGAC
TATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193583 (NRCAM)225952 - 1176
NM_001037132 (NRCAM)225572 - 796
NM_005010 (NRCAM)225934 - 1158
NM_001193582 (NRCAM)225952 - 1176
NM_001193584 (NRCAM)225952 - 1176
Exon 8 To Exon 9 (Pair 100)
Forward (952,23)ACACTTCAAAGTGGTCAGTCTTTAmplicon SizecDNA: 235 bpgenomic: 4,887
Reverse (1186,22)TAGGTTGCTTCTGCTGTATGGTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCA
CCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
CAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGAC
TATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)235934 - 1168
NM_001193582 (NRCAM)235952 - 1186
NM_001193583 (NRCAM)235952 - 1186
NM_001037132 (NRCAM)235572 - 806
NM_001193584 (NRCAM)235952 - 1186
Exon 8 To Exon 10 (Pair 57)
Forward (995,23)CAATTGGATTACCACCACCTATAAmplicon SizecDNA: 249 bpgenomic: 5,407
Reverse (1243,24)TCAAATTAGCAGCTATAGTGTCATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops2.135 kcal/mol
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-1.239 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCAATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCAC
AAAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAG
AGGACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGC
AGAAGCAACCTATTTCTGTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTG
CTAATTTGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)249615 - 863
NM_005010 (NRCAM)249977 - 1225
NM_001193582 (NRCAM)249995 - 1243
Exon 8 To Exon 9 (Pair 99)
Forward (950,22)TCACACTTCAAAGTGGTCAGTCAmplicon SizecDNA: 238 bpgenomic: 4,890
Reverse (1187,22)ATAGGTTGCTTCTGCTGTATGGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCAC
CACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTT
CTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAG
ACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)238932 - 1169
NM_001193582 (NRCAM)238950 - 1187
NM_001193583 (NRCAM)238950 - 1187
NM_001037132 (NRCAM)238570 - 807
NM_001193584 (NRCAM)238950 - 1187
Exon 8 To Exon 9 (Pair 98)
Forward (997,24)ATTGGATTACCACCACCTATAATAAmplicon SizecDNA: 180 bpgenomic: 4,832
Reverse (1176,23)CTGCTGTATGGTTTGAGTATGATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops2.558 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.538 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAA
AGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAG
GACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193583 (NRCAM)180997 - 1176
NM_001037132 (NRCAM)180617 - 796
NM_005010 (NRCAM)180979 - 1158
NM_001193582 (NRCAM)180997 - 1176
NM_001193584 (NRCAM)180997 - 1176
Exon 8 To Exon 9 (Pair 97)
Forward (998,24)TTGGATTACCACCACCTATAATATAmplicon SizecDNA: 189 bpgenomic: 4,841
Reverse (1186,22)TAGGTTGCTTCTGCTGTATGGTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.753 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAA
GTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGG
ACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGA
AGCAACCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)189998 - 1186
NM_005010 (NRCAM)189980 - 1168
NM_001193582 (NRCAM)189998 - 1186
NM_001193583 (NRCAM)189998 - 1186
NM_001037132 (NRCAM)189618 - 806
Exon 8 To Exon 9 (Pair 96)
Forward (996,24)AATTGGATTACCACCACCTATAATAmplicon SizecDNA: 191 bpgenomic: 4,843
Reverse (1186,22)TAGGTTGCTTCTGCTGTATGGTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.753 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceAATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACA
AAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGA
GGACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCA
GAAGCAACCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)191978 - 1168
NM_001193582 (NRCAM)191996 - 1186
NM_001193583 (NRCAM)191996 - 1186
NM_001037132 (NRCAM)191616 - 806
NM_001193584 (NRCAM)191996 - 1186
Exon 8 To Exon 10 (Pair 56)
Forward (957,23)TCAAAGTGGTCAGTCTTTAGTACAmplicon SizecDNA: 287 bpgenomic: 5,445
Reverse (1243,24)TCAAATTAGCAGCTATAGTGTCATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.452 kcal/mol
Reverse Loops2.135 kcal/mol
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-0.386 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTAT
AATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGG
TTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATAT
CTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAA
GGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTAATTTGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)287957 - 1243
NM_005010 (NRCAM)287939 - 1225
NM_001037132 (NRCAM)287577 - 863
Exon 8 To Exon 10 (Pair 55)
Forward (957,23)TCAAAGTGGTCAGTCTTTAGTACAmplicon SizecDNA: 281 bpgenomic: 5,439
Reverse (1237,24)TAGCAGCTATAGTGTCATTCAATTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.452 kcal/mol
Reverse Loops1.968 kcal/mol in 3' area
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-0.386 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTAT
AATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGG
TTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATAT
CTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAA
GGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)281577 - 857
NM_005010 (NRCAM)281939 - 1219
NM_001193582 (NRCAM)281957 - 1237
Exon 8 To Exon 9 (Pair 95)
Forward (995,23)CAATTGGATTACCACCACCTATAAmplicon SizecDNA: 185 bpgenomic: 4,837
Reverse (1179,23)CTTCTGCTGTATGGTTTGAGTATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops2.558 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.538 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCAATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCAC
AAAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAG
AGGACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGC
AGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)185995 - 1179
NM_005010 (NRCAM)185977 - 1161
NM_001037132 (NRCAM)185615 - 799
NM_001193583 (NRCAM)185995 - 1179
NM_001193584 (NRCAM)185995 - 1179
Exon 8 To Exon 10 (Pair 54)
Forward (997,24)ATTGGATTACCACCACCTATAATAAmplicon SizecDNA: 250 bpgenomic: 5,408
Reverse (1246,23)CACTCAAATTAGCAGCTATAGTGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops2.097 kcal/mol in 3' area
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-0.991 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAA
AGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAG
GACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAG
AAGCAACCTATTTCTGTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCT
AATTTGAGTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)250617 - 866
NM_001193582 (NRCAM)250997 - 1246
NM_005010 (NRCAM)250979 - 1228
Exon 8 To Exon 10 (Pair 53)
Forward (965,22)GTCAGTCTTTAGTACTTCCCTGAmplicon SizecDNA: 276 bpgenomic: 5,434
Reverse (1240,24)AATTAGCAGCTATAGTGTCATTCANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops2.038 kcal/mol in 3' area
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTT
GGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATG
GGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATG
CTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGTGATTT
CAGTGGATGAATTGAATGACACTATAGCTGCTAATT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)276585 - 860
NM_005010 (NRCAM)276947 - 1222
NM_001193582 (NRCAM)276965 - 1240
Exon 8 To Exon 9 (Pair 94)
Forward (997,24)ATTGGATTACCACCACCTATAATAAmplicon SizecDNA: 184 bpgenomic: 4,836
Reverse (1180,22)GCTTCTGCTGTATGGTTTGAGTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops1.399 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.538 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAA
AGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAG
GACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAG
AAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)184997 - 1180
NM_001037132 (NRCAM)184617 - 800
NM_001193583 (NRCAM)184997 - 1180
NM_001193582 (NRCAM)184997 - 1180
NM_005010 (NRCAM)184979 - 1162
Exon 8 To Exon 9 (Pair 93)
Forward (996,24)AATTGGATTACCACCACCTATAATAmplicon SizecDNA: 151 bpgenomic: 4,803
Reverse (1146,23)AGCATAACAGATATAGTCTTCGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops0.68 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-0.71 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceAATTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACA
AAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGA
GGACACCCGCGAAGACTATATCTGTTATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)151978 - 1128
NM_001193582 (NRCAM)151996 - 1146
NM_001193583 (NRCAM)151996 - 1146
NM_001037132 (NRCAM)151616 - 766
NM_001193584 (NRCAM)151996 - 1146
Exon 8 To Exon 10 (Pair 52)
Forward (954,23)ACTTCAAAGTGGTCAGTCTTTAGAmplicon SizecDNA: 278 bpgenomic: 5,436
Reverse (1231,24)CTATAGTGTCATTCAATTCATCCANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.13 kcal/mol
Forward Dimers-1.195 kcal/mol
Reverse Loops1.968 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-0.894 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACC
TATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCA
AGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTA
TATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGT
GAAGGTGATTTCAGTGGATGAATTGAATGACACTATAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)278574 - 851
NM_005010 (NRCAM)278936 - 1213
NM_001193582 (NRCAM)278954 - 1231
Exon 8 To Exon 10 (Pair 51)
Forward (953,23)CACTTCAAAGTGGTCAGTCTTTAAmplicon SizecDNA: 290 bpgenomic: 5,448
Reverse (1242,24)CAAATTAGCAGCTATAGTGTCATTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.59 kcal/mol
Forward Dimers-1.735 kcal/mol
Reverse Loops2.135 kcal/mol
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-1.368 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTG
TGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTAATTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)290573 - 862
NM_001193582 (NRCAM)290953 - 1242
NM_005010 (NRCAM)290935 - 1224
Exon 8 To Exon 9 (Pair 92)
Forward (915,23)ATCACCATTGTGGACCAAAGAAAAmplicon SizecDNA: 276 bpgenomic: 4,928
Reverse (1190,23)GAAATAGGTTGCTTCTGCTGTATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.073 kcal/mol
Forward Dimers-1.382 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceATCACCATTGTGGACCAAAGAAAAACTTGAACCAATCACACTTCAAAGTGGTCAGTCTTT
AGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTTGGATGGATAA
TTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTA
TTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATGCTAGATTTAA
TCATACTCAAACCATACAGCAGAAGCAACCTATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)276915 - 1190
NM_005010 (NRCAM)276897 - 1172
NM_001193582 (NRCAM)276915 - 1190
NM_001193583 (NRCAM)276915 - 1190
NM_001037132 (NRCAM)276535 - 810
Exon 8 To Exon 10 (Pair 50)
Forward (965,22)GTCAGTCTTTAGTACTTCCCTGAmplicon SizecDNA: 269 bpgenomic: 5,427
Reverse (1233,24)AGCTATAGTGTCATTCAATTCATCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.968 kcal/mol
Reverse Dimers-1.696 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTT
GGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATG
GGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATG
CTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGTGATTT
CAGTGGATGAATTGAATGACACTATAGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)269585 - 853
NM_001193582 (NRCAM)269965 - 1233
NM_005010 (NRCAM)269947 - 1215
Exon 8 To Exon 9 (Pair 91)
Forward (953,23)CACTTCAAAGTGGTCAGTCTTTAAmplicon SizecDNA: 194 bpgenomic: 4,846
Reverse (1146,23)AGCATAACAGATATAGTCTTCGCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.59 kcal/mol
Forward Dimers-1.735 kcal/mol
Reverse Loops0.68 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.48 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCAC
CTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTC
AAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACT
ATATCTGTTATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)194573 - 766
NM_001193583 (NRCAM)194953 - 1146
NM_001193582 (NRCAM)194953 - 1146
NM_005010 (NRCAM)194935 - 1128
NM_001193584 (NRCAM)194953 - 1146
Exon 8 To Exon 9 (Pair 90)
Forward (951,22)CACACTTCAAAGTGGTCAGTCTAmplicon SizecDNA: 233 bpgenomic: 4,885
Reverse (1183,22)GTTGCTTCTGCTGTATGGTTTGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACC
ACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTC
TCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGA
CTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)233951 - 1183
NM_001193583 (NRCAM)233951 - 1183
NM_001037132 (NRCAM)233571 - 803
NM_005010 (NRCAM)233933 - 1165
NM_001193582 (NRCAM)233951 - 1183
Exon 8 To Exon 9 (Pair 89)
Forward (999,24)TGGATTACCACCACCTATAATATTAmplicon SizecDNA: 179 bpgenomic: 4,831
Reverse (1177,23)TCTGCTGTATGGTTTGAGTATGANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.772 kcal/mol
Forward Dimers-1.163 kcal/mol
Reverse Loops2.558 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.538 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAG
TGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGA
CACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)179619 - 797
NM_001193583 (NRCAM)179999 - 1177
NM_001193582 (NRCAM)179999 - 1177
NM_005010 (NRCAM)179981 - 1159
NM_001193584 (NRCAM)179999 - 1177
Exon 8 To Exon 9 (Pair 88)
Forward (957,23)TCAAAGTGGTCAGTCTTTAGTACAmplicon SizecDNA: 234 bpgenomic: 4,886
Reverse (1190,23)GAAATAGGTTGCTTCTGCTGTATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.452 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTAT
AATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGG
TTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATAT
CTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)234957 - 1190
NM_001193582 (NRCAM)234957 - 1190
NM_005010 (NRCAM)234939 - 1172
NM_001037132 (NRCAM)234577 - 810
NM_001193583 (NRCAM)234957 - 1190
Exon 8 To Exon 10 (Pair 49)
Forward (966,22)TCAGTCTTTAGTACTTCCCTGCAmplicon SizecDNA: 268 bpgenomic: 5,426
Reverse (1233,24)AGCTATAGTGTCATTCAATTCATCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.968 kcal/mol
Reverse Dimers-1.696 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTTG
GATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATGG
GGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATGC
TAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGTGATTTC
AGTGGATGAATTGAATGACACTATAGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)268586 - 853
NM_001193582 (NRCAM)268966 - 1233
NM_005010 (NRCAM)268948 - 1215
Exon 8 To Exon 10 (Pair 48)
Forward (964,22)GGTCAGTCTTTAGTACTTCCCTAmplicon SizecDNA: 272 bpgenomic: 5,430
Reverse (1235,23)GCAGCTATAGTGTCATTCAATTCNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.968 kcal/mol in 3' area
Reverse Dimers-2.644 kcal/mol
Forward-Reverse Dimers-1.123 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTT
TGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAAT
GGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTAT
GCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAAGGTGATT
TCAGTGGATGAATTGAATGACACTATAGCTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)272584 - 855
NM_005010 (NRCAM)272946 - 1217
NM_001193582 (NRCAM)272964 - 1235
Exon 8 To Exon 9 (Pair 87)
Forward (951,22)CACACTTCAAAGTGGTCAGTCTAmplicon SizecDNA: 239 bpgenomic: 4,891
Reverse (1189,23)AAATAGGTTGCTTCTGCTGTATGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACC
ACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTC
TCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGA
CTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193584 (NRCAM)239951 - 1189
NM_005010 (NRCAM)239933 - 1171
NM_001193582 (NRCAM)239951 - 1189
NM_001193583 (NRCAM)239951 - 1189
NM_001037132 (NRCAM)239571 - 809
Exon 8 To Exon 9 (Pair 86)
Forward (964,22)GGTCAGTCTTTAGTACTTCCCTAmplicon SizecDNA: 108 bpgenomic: 4,760
Reverse (1071,23)AGAAACTCTCTCACTTTGTGGAANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-2.454 kcal/mol
Reverse Loops1.172 kcal/mol
Reverse Dimers-0.176 kcal/mol
Forward-Reverse Dimers-1.795 kcal/mol
Amplicon Folding0.052 kcal/mol inside primersite
Amplicon SequenceGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTT
TGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)108964 - 1071
NM_005010 (NRCAM)108946 - 1053
NM_001037132 (NRCAM)108584 - 691
NM_001193583 (NRCAM)108964 - 1071
NM_001193584 (NRCAM)108964 - 1071
Exon 8 To Exon 9 (Pair 85)
Forward (915,23)ATCACCATTGTGGACCAAAGAAAAmplicon SizecDNA: 275 bpgenomic: 4,927
Reverse (1189,23)AAATAGGTTGCTTCTGCTGTATGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.073 kcal/mol
Forward Dimers-1.382 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceATCACCATTGTGGACCAAAGAAAAACTTGAACCAATCACACTTCAAAGTGGTCAGTCTTT
AGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTATAATATTTTGGATGGATAA
TTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTA
TTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATATCTGTTATGCTAGATTTAA
TCATACTCAAACCATACAGCAGAAGCAACCTATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005010 (NRCAM)275897 - 1171
NM_001193582 (NRCAM)275915 - 1189
NM_001193583 (NRCAM)275915 - 1189
NM_001037132 (NRCAM)275535 - 809
NM_001193584 (NRCAM)275915 - 1189
Exon 8 To Exon 10 (Pair 47)
Forward (998,24)TTGGATTACCACCACCTATAATATAmplicon SizecDNA: 245 bpgenomic: 5,403
Reverse (1242,24)CAAATTAGCAGCTATAGTGTCATTNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.701 kcal/mol
Forward Dimers-1.234 kcal/mol
Reverse Loops2.135 kcal/mol
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-0.991 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTTGGATTACCACCACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAA
GTGAGAGAGTTTCTCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGG
ACACCCGCGAAGACTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGA
AGCAACCTATTTCTGTGAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTA
ATTTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)245998 - 1242
NM_005010 (NRCAM)245980 - 1224
NM_001037132 (NRCAM)245618 - 862
Exon 8 To Exon 10 (Pair 46)
Forward (957,23)TCAAAGTGGTCAGTCTTTAGTACAmplicon SizecDNA: 290 bpgenomic: 5,448
Reverse (1246,23)CACTCAAATTAGCAGCTATAGTGNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.436 kcal/mol
Forward Dimers-0.452 kcal/mol
Reverse Loops2.097 kcal/mol in 3' area
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-1.749 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACCTAT
AATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCAAGG
TTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTATAT
CTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGTGAA
GGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTAATTTGAGTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)290957 - 1246
NM_005010 (NRCAM)290939 - 1228
NM_001037132 (NRCAM)290577 - 866
Exon 8 To Exon 9 (Pair 84)
Forward (951,22)CACACTTCAAAGTGGTCAGTCTAmplicon SizecDNA: 240 bpgenomic: 4,892
Reverse (1190,23)GAAATAGGTTGCTTCTGCTGTATNr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops0.048 kcal/mol
Forward Dimers-2.277 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.898 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceCACACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACC
ACCTATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTC
TCAAGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGA
CTATATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001193582 (NRCAM)240951 - 1190
NM_005010 (NRCAM)240933 - 1172
NM_001037132 (NRCAM)240571 - 810
NM_001193583 (NRCAM)240951 - 1190
NM_001193584 (NRCAM)240951 - 1190
Exon 8 To Exon 10 (Pair 45)
Forward (954,23)ACTTCAAAGTGGTCAGTCTTTAGAmplicon SizecDNA: 287 bpgenomic: 5,445
Reverse (1240,24)AATTAGCAGCTATAGTGTCATTCANr. of Isoforms 5 out of 5 (by amplicon BlastN)
Folding EnergiesForward Loops1.13 kcal/mol
Forward Dimers-1.195 kcal/mol
Reverse Loops2.038 kcal/mol in 3' area
Reverse Dimers-2.656 kcal/mol
Forward-Reverse Dimers-0.894 kcal/mol
Amplicon Folding-2.383 kcal/mol outside primersite
Amplicon SequenceACTTCAAAGTGGTCAGTCTTTAGTACTTCCCTGCAGACCCCCAATTGGATTACCACCACC
TATAATATTTTGGATGGATAATTCCTTTCAAAGACTTCCACAAAGTGAGAGAGTTTCTCA
AGGTTTGAATGGGGACCTTTATTTTTCCAATGTCCTCCCAGAGGACACCCGCGAAGACTA
TATCTGTTATGCTAGATTTAATCATACTCAAACCATACAGCAGAAGCAACCTATTTCTGT
GAAGGTGATTTCAGTGGATGAATTGAATGACACTATAGCTGCTAATT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001037132 (NRCAM)287574 - 860
NM_001193582 (NRCAM)287954 - 1240
NM_005010 (NRCAM)287936 - 1222
 

See below for some more details.

Program Output:

Loading ...