Design Results for PAH

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (355,22)TTGTAACTCTCTTCTCCTCCCTAmplicon SizecDNA: 211 bpgenomic: 4,383
Reverse (565,24)TGATTGCAGTTGTCTTCAATATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.075 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops0.994 kcal/mol in 3' area
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.816 kcal/mol
Amplicon Folding-2.625 kcal/mol outside primersite
Amplicon SequenceTTGTAACTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTG
CAAACCTGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCA
TGTCCACTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAGG
AAACAAGCTATATTGAAGACAACTGCAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000277 (PAH)211354 - 564
Exon 1 To Exon 2 (Pair 2)
Forward (412,21)TTGCAAACCTGCCTGTACCTGAmplicon SizecDNA: 154 bpgenomic: 4,326
Reverse (565,24)TGATTGCAGTTGTCTTCAATATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.595 kcal/mol
Forward Dimers-2.102 kcal/mol
Reverse Loops0.994 kcal/mol in 3' area
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-2.418 kcal/mol
Amplicon Folding-1.744 kcal/mol outside primersite
Amplicon SequenceTTGCAAACCTGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCA
GCATGTCCACTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGAC
AGGAAACAAGCTATATTGAAGACAACTGCAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000277 (PAH)154411 - 564
Exon 1 To Exon 2 (Pair 3)
Forward (354,22)TTTGTAACTCTCTTCTCCTCCCAmplicon SizecDNA: 212 bpgenomic: 4,384
Reverse (565,24)TGATTGCAGTTGTCTTCAATATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.075 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops0.994 kcal/mol in 3' area
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.816 kcal/mol
Amplicon Folding-2.625 kcal/mol outside primersite
Amplicon SequenceTTTGTAACTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTT
GCAAACCTGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGC
ATGTCCACTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG
GAAACAAGCTATATTGAAGACAACTGCAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000277 (PAH)212353 - 564
Exon 1 To Exon 2 (Pair 4)
Forward (413,21)TGCAAACCTGCCTGTACCTGAAmplicon SizecDNA: 153 bpgenomic: 4,325
Reverse (565,24)TGATTGCAGTTGTCTTCAATATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.595 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.994 kcal/mol in 3' area
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-2.347 kcal/mol
Amplicon Folding-1.744 kcal/mol outside primersite
Amplicon SequenceTGCAAACCTGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAG
CATGTCCACTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACA
GGAAACAAGCTATATTGAAGACAACTGCAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000277 (PAH)153412 - 564
Exon 1 To Exon 2 (Pair 5)
Forward (356,22)TGTAACTCTCTTCTCCTCCCTAAmplicon SizecDNA: 210 bpgenomic: 4,382
Reverse (565,24)TGATTGCAGTTGTCTTCAATATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.075 kcal/mol
Forward Dimers0.155 kcal/mol
Reverse Loops0.994 kcal/mol in 3' area
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.816 kcal/mol
Amplicon Folding-2.625 kcal/mol outside primersite
Amplicon SequenceTGTAACTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGC
AAACCTGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCAT
GTCCACTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAGGA
AACAAGCTATATTGAAGACAACTGCAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000277 (PAH)210355 - 564
 

See below for some more details.

Program Output:

Loading ...