Design Results for PEX6

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size90Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 9 To Exon 10 (Pair 1)
Forward (1992,21)GGATCTCTATGCCCTTCTGACAmplicon SizecDNA: 138 bpgenomic: 262
Reverse (2129,20)AAGTCCTCAGCCAGGAGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.986 kcal/mol
Forward Dimers-0.192 kcal/mol
Reverse Loops0.157 kcal/mol
Reverse Dimers-1.752 kcal/mol
Forward-Reverse Dimers-2.113 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceGGATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTC
AGGTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCC
TCTCCTGGCTGAGGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1381992 - 2129
Exon 9 To Exon 10 (Pair 2)
Forward (1993,21)GATCTCTATGCCCTTCTGACCAmplicon SizecDNA: 132 bpgenomic: 256
Reverse (2124,20)CTCAGCCAGGAGAGGAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.986 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceGATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCA
GGTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCT
CTCCTGGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1321993 - 2124
Exon 9 To Exon 10 (Pair 3)
Forward (1994,21)ATCTCTATGCCCTTCTGACCCAmplicon SizecDNA: 130 bpgenomic: 254
Reverse (2123,20)TCAGCCAGGAGAGGAAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.549 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCAG
GTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCTC
TCCTGGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1301994 - 2123
Exon 9 To Exon 10 (Pair 4)
Forward (1997,21)TCTATGCCCTTCTGACCCACAAmplicon SizecDNA: 133 bpgenomic: 257
Reverse (2129,20)AAGTCCTCAGCCAGGAGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.923 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.157 kcal/mol
Reverse Dimers-1.752 kcal/mol
Forward-Reverse Dimers-2.113 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCAGGTT
TGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCTCTCC
TGGCTGAGGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1331997 - 2129
Exon 9 To Exon 10 (Pair 5)
Forward (1994,21)ATCTCTATGCCCTTCTGACCCAmplicon SizecDNA: 136 bpgenomic: 260
Reverse (2129,20)AAGTCCTCAGCCAGGAGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.549 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.157 kcal/mol
Reverse Dimers-1.752 kcal/mol
Forward-Reverse Dimers-2.113 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCAG
GTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCTC
TCCTGGCTGAGGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1361994 - 2129
Exon 9 To Exon 10 (Pair 6)
Forward (1993,21)GATCTCTATGCCCTTCTGACCAmplicon SizecDNA: 131 bpgenomic: 255
Reverse (2123,20)TCAGCCAGGAGAGGAAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.986 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceGATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCA
GGTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCT
CTCCTGGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1311993 - 2123
Exon 9 To Exon 10 (Pair 7)
Forward (1995,21)TCTCTATGCCCTTCTGACCCAAmplicon SizecDNA: 130 bpgenomic: 254
Reverse (2124,20)CTCAGCCAGGAGAGGAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.767 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceTCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCAGG
TTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCTCT
CCTGGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1301995 - 2124
Exon 9 To Exon 10 (Pair 8)
Forward (1993,21)GATCTCTATGCCCTTCTGACCAmplicon SizecDNA: 137 bpgenomic: 261
Reverse (2129,20)AAGTCCTCAGCCAGGAGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.986 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops0.157 kcal/mol
Reverse Dimers-1.752 kcal/mol
Forward-Reverse Dimers-2.113 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceGATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCA
GGTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCT
CTCCTGGCTGAGGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1371993 - 2129
Exon 9 To Exon 10 (Pair 9)
Forward (1991,21)GGGATCTCTATGCCCTTCTGAAmplicon SizecDNA: 146 bpgenomic: 270
Reverse (2136,20)CTGCCCAAAGTCCTCAGCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.181 kcal/mol
Forward Dimers-1.466 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol in 3' area
Forward-Reverse Dimers-2.196 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceGGGATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACT
CAGGTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTC
CTCTCCTGGCTGAGGACTTTGGGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1461991 - 2136
Exon 9 To Exon 10 (Pair 10)
Forward (1991,21)GGGATCTCTATGCCCTTCTGAAmplicon SizecDNA: 145 bpgenomic: 269
Reverse (2135,20)TGCCCAAAGTCCTCAGCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.181 kcal/mol
Forward Dimers-1.466 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers0.022 kcal/mol in 3' area
Forward-Reverse Dimers-2.196 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceGGGATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACT
CAGGTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTC
CTCTCCTGGCTGAGGACTTTGGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1451991 - 2135
Exon 9 To Exon 10 (Pair 11)
Forward (1997,21)TCTATGCCCTTCTGACCCACAAmplicon SizecDNA: 127 bpgenomic: 251
Reverse (2123,20)TCAGCCAGGAGAGGAAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.923 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCAGGTT
TGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCTCTCC
TGGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1271997 - 2123
Exon 9 To Exon 10 (Pair 12)
Forward (1991,21)GGGATCTCTATGCCCTTCTGAAmplicon SizecDNA: 134 bpgenomic: 258
Reverse (2124,20)CTCAGCCAGGAGAGGAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.181 kcal/mol
Forward Dimers-1.466 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceGGGATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACT
CAGGTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTC
CTCTCCTGGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1341991 - 2124
Exon 9 To Exon 10 (Pair 13)
Forward (1992,21)GGATCTCTATGCCCTTCTGACAmplicon SizecDNA: 133 bpgenomic: 257
Reverse (2124,20)CTCAGCCAGGAGAGGAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.986 kcal/mol
Forward Dimers-0.192 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceGGATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTC
AGGTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCC
TCTCCTGGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1331992 - 2124
Exon 9 To Exon 10 (Pair 14)
Forward (1995,21)TCTCTATGCCCTTCTGACCCAAmplicon SizecDNA: 129 bpgenomic: 253
Reverse (2123,20)TCAGCCAGGAGAGGAAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.767 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceTCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCAGG
TTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCTCT
CCTGGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1291995 - 2123
Exon 9 To Exon 10 (Pair 15)
Forward (1992,21)GGATCTCTATGCCCTTCTGACAmplicon SizecDNA: 132 bpgenomic: 256
Reverse (2123,20)TCAGCCAGGAGAGGAAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.986 kcal/mol
Forward Dimers-0.192 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceGGATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTC
AGGTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCC
TCTCCTGGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1321992 - 2123
Exon 9 To Exon 10 (Pair 16)
Forward (1997,21)TCTATGCCCTTCTGACCCACAAmplicon SizecDNA: 128 bpgenomic: 252
Reverse (2124,20)CTCAGCCAGGAGAGGAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.923 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCAGGTT
TGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCTCTCC
TGGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1281997 - 2124
Exon 9 To Exon 10 (Pair 17)
Forward (1994,21)ATCTCTATGCCCTTCTGACCCAmplicon SizecDNA: 131 bpgenomic: 255
Reverse (2124,20)CTCAGCCAGGAGAGGAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.549 kcal/mol
Forward Dimers0.136 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCAG
GTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCTC
TCCTGGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1311994 - 2124
Exon 9 To Exon 10 (Pair 18)
Forward (1991,21)GGGATCTCTATGCCCTTCTGAAmplicon SizecDNA: 139 bpgenomic: 263
Reverse (2129,20)AAGTCCTCAGCCAGGAGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.181 kcal/mol
Forward Dimers-1.466 kcal/mol
Reverse Loops0.157 kcal/mol
Reverse Dimers-1.752 kcal/mol
Forward-Reverse Dimers-2.113 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceGGGATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACT
CAGGTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTC
CTCTCCTGGCTGAGGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1391991 - 2129
Exon 9 To Exon 10 (Pair 19)
Forward (1995,21)TCTCTATGCCCTTCTGACCCAAmplicon SizecDNA: 135 bpgenomic: 259
Reverse (2129,20)AAGTCCTCAGCCAGGAGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.767 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops0.157 kcal/mol
Reverse Dimers-1.752 kcal/mol
Forward-Reverse Dimers-2.113 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceTCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACTCAGG
TTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTCCTCT
CCTGGCTGAGGACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1351995 - 2129
Exon 9 To Exon 10 (Pair 20)
Forward (1991,21)GGGATCTCTATGCCCTTCTGAAmplicon SizecDNA: 133 bpgenomic: 257
Reverse (2123,20)TCAGCCAGGAGAGGAAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.181 kcal/mol
Forward Dimers-1.466 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.202 kcal/mol
Amplicon Folding-2.796 kcal/mol outside primersite
Amplicon SequenceGGGATCTCTATGCCCTTCTGACCCACAGCAGCCGGGCAGCCTGCACCAGGATCAAGAACT
CAGGTTTGGCAGGTGGCTTGACTGAGGAGGATGAGGGGGAGCTGTGTGCTGCCGGCTTTC
CTCTCCTGGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000287 (PEX6)1331991 - 2123
 

See below for some more details.

Program Output:

Loading ...