Design Results for PHF14

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size300

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 16 To Exon 17 (Pair 1)
Forward (2992,23)TTCCTAGAGAGAGAAGACAAAGAAmplicon SizecDNA: 178 bpgenomic: 40,578
Reverse (3169,21)AAGAGGTTTCCGGGATTGCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.325 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATT
TAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACC
CTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)1782992 - 3169
NR_033435 (PHF14)1782204 - 2381
Exon 16 To Exon 17 (Pair 2)
Forward (2986,23)AAAGAGTTCCTAGAGAGAGAAGAAmplicon SizecDNA: 226 bpgenomic: 40,626
Reverse (3211,24)CTATCGAGAGTTTAATCCACATTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.836 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAAAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTG
AAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCA
GATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACC
TCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2262986 - 3211
NR_033435 (PHF14)2262198 - 2423
Exon 16 To Exon 17 (Pair 3)
Forward (2988,22)AGAGTTCCTAGAGAGAGAAGACAmplicon SizecDNA: 224 bpgenomic: 40,624
Reverse (3211,24)CTATCGAGAGTTTAATCCACATTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.836 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAA
GATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGA
TACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTC
TTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2242988 - 3211
NR_033435 (PHF14)2242200 - 2423
Exon 16 To Exon 17 (Pair 4)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 294 bpgenomic: 40,694
Reverse (3336,24)TTGTTAGTCCAAGTAACAAACCAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.406 kcal/mol
Reverse Dimers-1.065 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAA
ACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAG
TAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTTT
GCTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACTAACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2943043 - 3336
NR_033435 (PHF14)2942255 - 2548
Exon 16 To Exon 17 (Pair 5)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 290 bpgenomic: 40,690
Reverse (3332,24)TAGTCCAAGTAACAAACCAATCAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.774 kcal/mol
Reverse Dimers-0.239 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAA
ACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAG
TAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTTT
GCTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2902255 - 2544
NM_014660 (PHF14)2903043 - 3332
Exon 16 To Exon 17 (Pair 6)
Forward (2994,22)CCTAGAGAGAGAAGACAAAGACAmplicon SizecDNA: 255 bpgenomic: 40,655
Reverse (3248,23)AAGGACAATATAGCTGTTCTCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.074 kcal/mol in 3' area
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-1.906 kcal/mol
Amplicon Folding-1.82 kcal/mol outside primersite
Amplicon SequenceCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTA
AGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCT
TCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTTAT
AAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGAGAAC
AGCTATATTGTCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2552206 - 2460
NM_014660 (PHF14)2552994 - 3248
Exon 16 To Exon 17 (Pair 7)
Forward (3039,24)AAGGCTGAAGATTTAAGAACTGAAAmplicon SizecDNA: 267 bpgenomic: 40,667
Reverse (3305,23)TATTCTATCCAAACCTGACAAGCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.835 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.598 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-1.803 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceAAGGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAAT
CTTGTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCC
GGAAACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACAT
AAAGTAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCC
TTTTGCTTGTCAGGTTTGGATAGAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2672251 - 2517
NM_014660 (PHF14)2673039 - 3305
Exon 16 To Exon 17 (Pair 8)
Forward (3044,24)TGAAGATTTAAGAACTGAATGTGCAmplicon SizecDNA: 203 bpgenomic: 40,603
Reverse (3246,23)GGACAATATAGCTGTTCTCCTTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.421 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGT
CAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAA
CCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGT
AAAGGAGAACAGCTATATTGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2032256 - 2458
NM_014660 (PHF14)2033044 - 3246
Exon 16 To Exon 17 (Pair 9)
Forward (3050,24)TTTAAGAACTGAATGTGCAACTTGAmplicon SizecDNA: 190 bpgenomic: 40,590
Reverse (3239,24)ATAGCTGTTCTCCTTTACTTTATGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceTTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATA
CCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
TTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGA
GAACAGCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1902262 - 2451
NM_014660 (PHF14)1903050 - 3239
Exon 16 To Exon 17 (Pair 10)
Forward (3044,24)TGAAGATTTAAGAACTGAATGTGCAmplicon SizecDNA: 288 bpgenomic: 40,688
Reverse (3331,24)AGTCCAAGTAACAAACCAATCAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.774 kcal/mol
Reverse Dimers-0.239 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGT
CAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAA
CCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGT
AAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTTTG
CTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2882256 - 2543
NM_014660 (PHF14)2883044 - 3331
Exon 16 To Exon 17 (Pair 11)
Forward (2989,22)GAGTTCCTAGAGAGAGAAGACAAmplicon SizecDNA: 157 bpgenomic: 40,557
Reverse (3145,21)AGGATGAGCTGTGGCAGAGTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.67 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAG
ATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGAT
ACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NR_033435 (PHF14)1572201 - 2357
NM_014660 (PHF14)1572989 - 3145
Exon 16 To Exon 17 (Pair 12)
Forward (3050,24)TTTAAGAACTGAATGTGCAACTTGAmplicon SizecDNA: 194 bpgenomic: 40,594
Reverse (3243,24)CAATATAGCTGTTCTCCTTTACTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceTTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATA
CCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
TTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGA
GAACAGCTATATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1942262 - 2455
NM_014660 (PHF14)1943050 - 3243
Exon 16 To Exon 17 (Pair 13)
Forward (3044,24)TGAAGATTTAAGAACTGAATGTGCAmplicon SizecDNA: 85 bpgenomic: 40,485
Reverse (3128,22)AGTTGGGTCTCATGAAGGGTATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.896 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.564 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGT
CAGATACCCTTCATGAGACCCAACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)852256 - 2340
NM_014660 (PHF14)853044 - 3128
Exon 16 To Exon 17 (Pair 14)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 87 bpgenomic: 40,487
Reverse (3129,21)GAGTTGGGTCTCATGAAGGGTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.848 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.127 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)873043 - 3129
NR_033435 (PHF14)872255 - 2341
Exon 16 To Exon 17 (Pair 15)
Forward (2986,23)AAAGAGTTCCTAGAGAGAGAAGAAmplicon SizecDNA: 185 bpgenomic: 40,585
Reverse (3170,21)AAAGAGGTTTCCGGGATTGCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.477 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAAAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTG
AAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCA
GATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACC
TCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1852198 - 2382
NM_014660 (PHF14)1852986 - 3170
Exon 16 To Exon 17 (Pair 16)
Forward (2992,23)TTCCTAGAGAGAGAAGACAAAGAAmplicon SizecDNA: 256 bpgenomic: 40,656
Reverse (3247,23)AGGACAATATAGCTGTTCTCCTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.31 kcal/mol in 3' area
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-1.67 kcal/mol
Amplicon Folding-1.82 kcal/mol outside primersite
Amplicon SequenceTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATT
TAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACC
CTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTT
ATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGAGA
ACAGCTATATTGTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2562992 - 3247
NR_033435 (PHF14)2562204 - 2459
Exon 16 To Exon 17 (Pair 17)
Forward (2989,22)GAGTTCCTAGAGAGAGAAGACAAmplicon SizecDNA: 153 bpgenomic: 40,553
Reverse (3141,20)TGAGCTGTGGCAGAGTTGGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAG
ATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGAT
ACCCTTCATGAGACCCAACTCTGCCACAGCTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_014660 (PHF14)1532989 - 3141
NR_033435 (PHF14)1532201 - 2353
Exon 16 To Exon 17 (Pair 18)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 203 bpgenomic: 40,603
Reverse (3244,24)ACAATATAGCTGTTCTCCTTTACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGA
AACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAA
GTAAAGGAGAACAGCTATATTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2032254 - 2456
NM_014660 (PHF14)2033042 - 3244
Exon 16 To Exon 17 (Pair 19)
Forward (2986,23)AAAGAGTTCCTAGAGAGAGAAGAAmplicon SizecDNA: 160 bpgenomic: 40,560
Reverse (3145,21)AGGATGAGCTGTGGCAGAGTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.67 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAAAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTG
AAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCA
GATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_014660 (PHF14)1602986 - 3145
NR_033435 (PHF14)1602198 - 2357
Exon 16 To Exon 17 (Pair 20)
Forward (3040,24)AGGCTGAAGATTTAAGAACTGAATAmplicon SizecDNA: 207 bpgenomic: 40,607
Reverse (3246,23)GGACAATATAGCTGTTCTCCTTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.835 kcal/mol
Forward Dimers-1.327 kcal/mol
Reverse Loops1.421 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceAGGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATC
TTGTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCG
GAAACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATA
AAGTAAAGGAGAACAGCTATATTGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2072252 - 2458
NM_014660 (PHF14)2073040 - 3246
Exon 16 To Exon 17 (Pair 21)
Forward (2994,22)CCTAGAGAGAGAAGACAAAGACAmplicon SizecDNA: 176 bpgenomic: 40,576
Reverse (3169,21)AAGAGGTTTCCGGGATTGCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.325 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTA
AGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCT
TCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1762206 - 2381
NM_014660 (PHF14)1762994 - 3169
Exon 16 To Exon 17 (Pair 22)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 291 bpgenomic: 40,691
Reverse (3333,24)TTAGTCCAAGTAACAAACCAATCANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.774 kcal/mol
Reverse Dimers-0.239 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAA
ACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAG
TAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTTT
GCTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2912255 - 2545
NM_014660 (PHF14)2913043 - 3333
Exon 16 To Exon 17 (Pair 23)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 204 bpgenomic: 40,604
Reverse (3246,23)GGACAATATAGCTGTTCTCCTTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.421 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAA
ACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAG
TAAAGGAGAACAGCTATATTGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2043043 - 3246
NR_033435 (PHF14)2042255 - 2458
Exon 16 To Exon 17 (Pair 24)
Forward (2994,22)CCTAGAGAGAGAAGACAAAGACAmplicon SizecDNA: 254 bpgenomic: 40,654
Reverse (3247,23)AGGACAATATAGCTGTTCTCCTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.31 kcal/mol in 3' area
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-1.365 kcal/mol
Amplicon Folding-1.82 kcal/mol outside primersite
Amplicon SequenceCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTA
AGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCT
TCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTTAT
AAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGAGAAC
AGCTATATTGTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2542994 - 3247
NR_033435 (PHF14)2542206 - 2459
Exon 16 To Exon 17 (Pair 25)
Forward (2986,23)AAAGAGTTCCTAGAGAGAGAAGAAmplicon SizecDNA: 227 bpgenomic: 40,627
Reverse (3212,24)TCTATCGAGAGTTTAATCCACATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.531 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-0.893 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAAAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTG
AAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCA
GATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACC
TCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2272986 - 3212
NR_033435 (PHF14)2272198 - 2424
Exon 16 To Exon 17 (Pair 26)
Forward (2988,22)AGAGTTCCTAGAGAGAGAAGACAmplicon SizecDNA: 153 bpgenomic: 40,553
Reverse (3140,20)GAGCTGTGGCAGAGTTGGGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAA
GATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGA
TACCCTTCATGAGACCCAACTCTGCCACAGCTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_014660 (PHF14)1532988 - 3140
NR_033435 (PHF14)1532200 - 2352
Exon 16 To Exon 17 (Pair 27)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 97 bpgenomic: 40,497
Reverse (3139,20)AGCTGTGGCAGAGTTGGGTCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.225 kcal/mol
Forward-Reverse Dimers-2.127 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTCTGCCACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)973043 - 3139
NR_033435 (PHF14)972255 - 2351
Exon 16 To Exon 17 (Pair 28)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 291 bpgenomic: 40,691
Reverse (3332,24)TAGTCCAAGTAACAAACCAATCAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.774 kcal/mol
Reverse Dimers-0.239 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGA
AACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAA
GTAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTT
TGCTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2913042 - 3332
NR_033435 (PHF14)2912254 - 2544
Exon 16 To Exon 17 (Pair 29)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 201 bpgenomic: 40,601
Reverse (3243,24)CAATATAGCTGTTCTCCTTTACTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAA
ACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAG
TAAAGGAGAACAGCTATATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2013043 - 3243
NR_033435 (PHF14)2012255 - 2455
Exon 16 To Exon 17 (Pair 30)
Forward (2988,22)AGAGTTCCTAGAGAGAGAAGACAmplicon SizecDNA: 152 bpgenomic: 40,552
Reverse (3139,20)AGCTGTGGCAGAGTTGGGTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.225 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAA
GATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGA
TACCCTTCATGAGACCCAACTCTGCCACAGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NR_033435 (PHF14)1522200 - 2351
NM_014660 (PHF14)1522988 - 3139
Exon 16 To Exon 17 (Pair 31)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 294 bpgenomic: 40,694
Reverse (3335,24)TGTTAGTCCAAGTAACAAACCAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.774 kcal/mol in 3' area
Reverse Dimers-0.62 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGA
AACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAA
GTAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTT
TGCTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACTAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2943042 - 3335
NR_033435 (PHF14)2942254 - 2547
Exon 16 To Exon 17 (Pair 32)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 202 bpgenomic: 40,602
Reverse (3243,24)CAATATAGCTGTTCTCCTTTACTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGA
AACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAA
GTAAAGGAGAACAGCTATATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2023042 - 3243
NR_033435 (PHF14)2022254 - 2455
Exon 16 To Exon 17 (Pair 33)
Forward (2989,22)GAGTTCCTAGAGAGAGAAGACAAmplicon SizecDNA: 181 bpgenomic: 40,581
Reverse (3169,21)AAGAGGTTTCCGGGATTGCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.325 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAG
ATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGAT
ACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCT
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)1812989 - 3169
NR_033435 (PHF14)1812201 - 2381
Exon 16 To Exon 17 (Pair 34)
Forward (2996,23)TAGAGAGAGAAGACAAAGACAGTAmplicon SizecDNA: 174 bpgenomic: 40,574
Reverse (3169,21)AAGAGGTTTCCGGGATTGCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.199 kcal/mol in 3' area
Forward Dimers0.248 kcal/mol in 3' area
Reverse Loops1.325 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-0.68 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTAAG
AACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCTTC
ATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1742208 - 2381
NM_014660 (PHF14)1742996 - 3169
Exon 16 To Exon 17 (Pair 35)
Forward (2990,23)AGTTCCTAGAGAGAGAAGACAAAAmplicon SizecDNA: 181 bpgenomic: 40,581
Reverse (3170,21)AAAGAGGTTTCCGGGATTGCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.477 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGA
TTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATA
CCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1812202 - 2382
NM_014660 (PHF14)1812990 - 3170
Exon 16 To Exon 17 (Pair 36)
Forward (2988,22)AGAGTTCCTAGAGAGAGAAGACAmplicon SizecDNA: 261 bpgenomic: 40,661
Reverse (3248,23)AAGGACAATATAGCTGTTCTCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.074 kcal/mol in 3' area
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.211 kcal/mol
Amplicon Folding-1.82 kcal/mol outside primersite
Amplicon SequenceAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAA
GATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGA
TACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTC
TTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAG
GAGAACAGCTATATTGTCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2612988 - 3248
NR_033435 (PHF14)2612200 - 2460
Exon 16 To Exon 17 (Pair 37)
Forward (2986,23)AAAGAGTTCCTAGAGAGAGAAGAAmplicon SizecDNA: 154 bpgenomic: 40,554
Reverse (3139,20)AGCTGTGGCAGAGTTGGGTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.225 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAAAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTG
AAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCA
GATACCCTTCATGAGACCCAACTCTGCCACAGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_014660 (PHF14)1542986 - 3139
NR_033435 (PHF14)1542198 - 2351
Exon 16 To Exon 17 (Pair 38)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 196 bpgenomic: 40,596
Reverse (3238,24)TAGCTGTTCTCCTTTACTTTATGTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAA
ACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAG
TAAAGGAGAACAGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1962255 - 2450
NM_014660 (PHF14)1963043 - 3238
Exon 16 To Exon 17 (Pair 39)
Forward (2990,23)AGTTCCTAGAGAGAGAAGACAAAAmplicon SizecDNA: 222 bpgenomic: 40,622
Reverse (3211,24)CTATCGAGAGTTTAATCCACATTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.836 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGA
TTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATA
CCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
TTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2222990 - 3211
NR_033435 (PHF14)2222202 - 2423
Exon 16 To Exon 17 (Pair 40)
Forward (2992,23)TTCCTAGAGAGAGAAGACAAAGAAmplicon SizecDNA: 175 bpgenomic: 40,575
Reverse (3166,20)AGGTTTCCGGGATTGCCTCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.054 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-0.887 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATT
TAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACC
CTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1752204 - 2378
NM_014660 (PHF14)1752992 - 3166
Exon 16 To Exon 17 (Pair 41)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 290 bpgenomic: 40,690
Reverse (3331,24)AGTCCAAGTAACAAACCAATCAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.774 kcal/mol
Reverse Dimers-0.239 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGA
AACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAA
GTAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTT
TGCTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2903042 - 3331
NR_033435 (PHF14)2902254 - 2543
Exon 16 To Exon 17 (Pair 42)
Forward (3050,24)TTTAAGAACTGAATGTGCAACTTGAmplicon SizecDNA: 189 bpgenomic: 40,589
Reverse (3238,24)TAGCTGTTCTCCTTTACTTTATGTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceTTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATA
CCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
TTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGA
GAACAGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1892262 - 2450
NM_014660 (PHF14)1893050 - 3238
Exon 16 To Exon 17 (Pair 43)
Forward (2988,22)AGAGTTCCTAGAGAGAGAAGACAmplicon SizecDNA: 154 bpgenomic: 40,554
Reverse (3141,20)TGAGCTGTGGCAGAGTTGGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAA
GATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGA
TACCCTTCATGAGACCCAACTCTGCCACAGCTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_014660 (PHF14)1542988 - 3141
NR_033435 (PHF14)1542200 - 2353
Exon 16 To Exon 17 (Pair 44)
Forward (3050,24)TTTAAGAACTGAATGTGCAACTTGAmplicon SizecDNA: 256 bpgenomic: 40,656
Reverse (3305,23)TATTCTATCCAAACCTGACAAGCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.598 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-1.381 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceTTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATA
CCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
TTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGA
GAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTTTGCTTGTC
AGGTTTGGATAGAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2562262 - 2517
NM_014660 (PHF14)2563050 - 3305
Exon 16 To Exon 17 (Pair 45)
Forward (2989,22)GAGTTCCTAGAGAGAGAAGACAAmplicon SizecDNA: 151 bpgenomic: 40,551
Reverse (3139,20)AGCTGTGGCAGAGTTGGGTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.225 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAG
ATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGAT
ACCCTTCATGAGACCCAACTCTGCCACAGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_014660 (PHF14)1512989 - 3139
NR_033435 (PHF14)1512201 - 2351
Exon 16 To Exon 17 (Pair 46)
Forward (2994,22)CCTAGAGAGAGAAGACAAAGACAmplicon SizecDNA: 148 bpgenomic: 40,548
Reverse (3141,20)TGAGCTGTGGCAGAGTTGGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-0.922 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTA
AGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCT
TCATGAGACCCAACTCTGCCACAGCTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NR_033435 (PHF14)1482206 - 2353
NM_014660 (PHF14)1482994 - 3141
Exon 16 To Exon 17 (Pair 47)
Forward (2994,22)CCTAGAGAGAGAAGACAAAGACAmplicon SizecDNA: 177 bpgenomic: 40,577
Reverse (3170,21)AAAGAGGTTTCCGGGATTGCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.477 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTA
AGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCT
TCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)1772994 - 3170
NR_033435 (PHF14)1772206 - 2382
Exon 16 To Exon 17 (Pair 48)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 205 bpgenomic: 40,605
Reverse (3246,23)GGACAATATAGCTGTTCTCCTTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.421 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGA
AACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAA
GTAAAGGAGAACAGCTATATTGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2053042 - 3246
NR_033435 (PHF14)2052254 - 2458
Exon 16 To Exon 17 (Pair 49)
Forward (3044,24)TGAAGATTTAAGAACTGAATGTGCAmplicon SizecDNA: 262 bpgenomic: 40,662
Reverse (3305,23)TATTCTATCCAAACCTGACAAGCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.598 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-1.381 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGT
CAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAA
CCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGT
AAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTTTG
CTTGTCAGGTTTGGATAGAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2622256 - 2517
NM_014660 (PHF14)2623044 - 3305
Exon 16 To Exon 17 (Pair 50)
Forward (2994,22)CCTAGAGAGAGAAGACAAAGACAmplicon SizecDNA: 219 bpgenomic: 40,619
Reverse (3212,24)TCTATCGAGAGTTTAATCCACATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.531 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-0.893 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTA
AGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCT
TCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTTAT
AAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2192994 - 3212
NR_033435 (PHF14)2192206 - 2424
Exon 16 To Exon 17 (Pair 51)
Forward (2994,22)CCTAGAGAGAGAAGACAAAGACAmplicon SizecDNA: 146 bpgenomic: 40,546
Reverse (3139,20)AGCTGTGGCAGAGTTGGGTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.225 kcal/mol
Forward-Reverse Dimers-0.922 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTA
AGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCT
TCATGAGACCCAACTCTGCCACAGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NR_033435 (PHF14)1462206 - 2351
NM_014660 (PHF14)1462994 - 3139
Exon 16 To Exon 17 (Pair 52)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 96 bpgenomic: 40,496
Reverse (3138,20)GCTGTGGCAGAGTTGGGTCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops0.937 kcal/mol
Reverse Dimers-2.069 kcal/mol
Forward-Reverse Dimers-2.127 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTCTGCCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)963043 - 3138
NR_033435 (PHF14)962255 - 2350
Exon 16 To Exon 17 (Pair 53)
Forward (3044,24)TGAAGATTTAAGAACTGAATGTGCAmplicon SizecDNA: 123 bpgenomic: 40,523
Reverse (3166,20)AGGTTTCCGGGATTGCCTCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.054 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGT
CAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAA
CCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)1233044 - 3166
NR_033435 (PHF14)1232256 - 2378
Exon 16 To Exon 17 (Pair 54)
Forward (2996,23)TAGAGAGAGAAGACAAAGACAGTAmplicon SizecDNA: 216 bpgenomic: 40,616
Reverse (3211,24)CTATCGAGAGTTTAATCCACATTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.199 kcal/mol in 3' area
Forward Dimers0.248 kcal/mol in 3' area
Reverse Loops1.836 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-0.716 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTAAG
AACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCTTC
ATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTTATAA
GTGTGATTTTAAAAATGTGGATTAAACTCTCGATAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2162208 - 2423
NM_014660 (PHF14)2162996 - 3211
Exon 16 To Exon 17 (Pair 55)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 171 bpgenomic: 40,571
Reverse (3212,24)TCTATCGAGAGTTTAATCCACATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.531 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-2.235 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGA
AACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)1713042 - 3212
NR_033435 (PHF14)1712254 - 2424
Exon 16 To Exon 17 (Pair 56)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 98 bpgenomic: 40,498
Reverse (3139,20)AGCTGTGGCAGAGTTGGGTCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.225 kcal/mol
Forward-Reverse Dimers-2.127 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)982254 - 2351
NM_014660 (PHF14)983042 - 3139
Exon 16 To Exon 17 (Pair 57)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 87 bpgenomic: 40,487
Reverse (3128,22)AGTTGGGTCTCATGAAGGGTATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.896 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.564 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)872254 - 2340
NM_014660 (PHF14)873042 - 3128
Exon 16 To Exon 17 (Pair 58)
Forward (2990,23)AGTTCCTAGAGAGAGAAGACAAAAmplicon SizecDNA: 223 bpgenomic: 40,623
Reverse (3212,24)TCTATCGAGAGTTTAATCCACATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.531 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-0.893 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGA
TTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATA
CCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
TTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2232202 - 2424
NM_014660 (PHF14)2232990 - 3212
Exon 16 To Exon 17 (Pair 59)
Forward (2996,23)TAGAGAGAGAAGACAAAGACAGTAmplicon SizecDNA: 217 bpgenomic: 40,617
Reverse (3212,24)TCTATCGAGAGTTTAATCCACATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.199 kcal/mol in 3' area
Forward Dimers0.248 kcal/mol in 3' area
Reverse Loops1.531 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-0.893 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTAAG
AACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCTTC
ATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTTATAA
GTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2172996 - 3212
NR_033435 (PHF14)2172208 - 2424
Exon 16 To Exon 17 (Pair 60)
Forward (3038,23)CAAGGCTGAAGATTTAAGAACTGAmplicon SizecDNA: 133 bpgenomic: 40,533
Reverse (3170,21)AAAGAGGTTTCCGGGATTGCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.809 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.477 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-1.763 kcal/mol
Amplicon Folding0.068 kcal/mol outside primersite
Amplicon SequenceCAAGGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAA
TCTTGTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCC
CGGAAACCTCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1332250 - 2382
NM_014660 (PHF14)1333038 - 3170
Exon 16 To Exon 17 (Pair 61)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 293 bpgenomic: 40,693
Reverse (3335,24)TGTTAGTCCAAGTAACAAACCAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.774 kcal/mol in 3' area
Reverse Dimers-0.62 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAA
ACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAG
TAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTTT
GCTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACTAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2933043 - 3335
NR_033435 (PHF14)2932255 - 2547
Exon 16 To Exon 17 (Pair 62)
Forward (2992,23)TTCCTAGAGAGAGAAGACAAAGAAmplicon SizecDNA: 257 bpgenomic: 40,657
Reverse (3248,23)AAGGACAATATAGCTGTTCTCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.074 kcal/mol in 3' area
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.211 kcal/mol
Amplicon Folding-1.82 kcal/mol outside primersite
Amplicon SequenceTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATT
TAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACC
CTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTT
ATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGAGA
ACAGCTATATTGTCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2572992 - 3248
NR_033435 (PHF14)2572204 - 2460
Exon 16 To Exon 17 (Pair 63)
Forward (2989,22)GAGTTCCTAGAGAGAGAAGACAAmplicon SizecDNA: 152 bpgenomic: 40,552
Reverse (3140,20)GAGCTGTGGCAGAGTTGGGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAG
ATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGAT
ACCCTTCATGAGACCCAACTCTGCCACAGCTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_014660 (PHF14)1522989 - 3140
NR_033435 (PHF14)1522201 - 2352
Exon 16 To Exon 17 (Pair 64)
Forward (3040,24)AGGCTGAAGATTTAAGAACTGAATAmplicon SizecDNA: 200 bpgenomic: 40,600
Reverse (3239,24)ATAGCTGTTCTCCTTTACTTTATGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.835 kcal/mol
Forward Dimers-1.327 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceAGGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATC
TTGTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCG
GAAACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATA
AAGTAAAGGAGAACAGCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2003040 - 3239
NR_033435 (PHF14)2002252 - 2451
Exon 16 To Exon 17 (Pair 65)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 128 bpgenomic: 40,528
Reverse (3169,21)AAGAGGTTTCCGGGATTGCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.325 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-1.224 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGA
AACCTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1282254 - 2381
NM_014660 (PHF14)1283042 - 3169
Exon 16 To Exon 17 (Pair 66)
Forward (2994,22)CCTAGAGAGAGAAGACAAAGACAmplicon SizecDNA: 136 bpgenomic: 40,536
Reverse (3129,21)GAGTTGGGTCTCATGAAGGGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.848 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.161 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTA
AGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCT
TCATGAGACCCAACTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_014660 (PHF14)1362994 - 3129
NR_033435 (PHF14)1362206 - 2341
Exon 16 To Exon 17 (Pair 67)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 88 bpgenomic: 40,488
Reverse (3130,21)AGAGTTGGGTCTCATGAAGGGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.535 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.127 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)882255 - 2342
NM_014660 (PHF14)883043 - 3130
Exon 16 To Exon 17 (Pair 68)
Forward (2992,23)TTCCTAGAGAGAGAAGACAAAGAAmplicon SizecDNA: 138 bpgenomic: 40,538
Reverse (3129,21)GAGTTGGGTCTCATGAAGGGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.848 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.161 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATT
TAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACC
CTTCATGAGACCCAACTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NR_033435 (PHF14)1382204 - 2341
NM_014660 (PHF14)1382992 - 3129
Exon 16 To Exon 17 (Pair 69)
Forward (2986,23)AAAGAGTTCCTAGAGAGAGAAGAAmplicon SizecDNA: 262 bpgenomic: 40,662
Reverse (3247,23)AGGACAATATAGCTGTTCTCCTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.31 kcal/mol in 3' area
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-1.67 kcal/mol
Amplicon Folding-1.82 kcal/mol outside primersite
Amplicon SequenceAAAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTG
AAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCA
GATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACC
TCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAA
AGGAGAACAGCTATATTGTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2622986 - 3247
NR_033435 (PHF14)2622198 - 2459
Exon 16 To Exon 17 (Pair 70)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 198 bpgenomic: 40,598
Reverse (3239,24)ATAGCTGTTCTCCTTTACTTTATGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGA
AACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAA
GTAAAGGAGAACAGCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1982254 - 2451
NM_014660 (PHF14)1983042 - 3239
Exon 16 To Exon 17 (Pair 71)
Forward (3050,24)TTTAAGAACTGAATGTGCAACTTGAmplicon SizecDNA: 197 bpgenomic: 40,597
Reverse (3246,23)GGACAATATAGCTGTTCTCCTTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.421 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceTTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATA
CCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
TTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGA
GAACAGCTATATTGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1972262 - 2458
NM_014660 (PHF14)1973050 - 3246
Exon 16 To Exon 17 (Pair 72)
Forward (3052,23)TAAGAACTGAATGTGCAACTTGCAmplicon SizecDNA: 188 bpgenomic: 40,588
Reverse (3239,24)ATAGCTGTTCTCCTTTACTTTATGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.861 kcal/mol in 3' area
Forward Dimers-1.212 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACC
CTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTT
ATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGAGA
ACAGCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)1883052 - 3239
NR_033435 (PHF14)1882264 - 2451
Exon 16 To Exon 17 (Pair 73)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 86 bpgenomic: 40,486
Reverse (3128,22)AGTTGGGTCTCATGAAGGGTATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.896 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.564 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)862255 - 2340
NM_014660 (PHF14)863043 - 3128
Exon 16 To Exon 17 (Pair 74)
Forward (3043,24)CTGAAGATTTAAGAACTGAATGTGAmplicon SizecDNA: 289 bpgenomic: 40,689
Reverse (3331,24)AGTCCAAGTAACAAACCAATCAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.774 kcal/mol
Reverse Dimers-0.239 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTG
TCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAA
ACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAG
TAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTTT
GCTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2892255 - 2543
NM_014660 (PHF14)2893043 - 3331
Exon 16 To Exon 17 (Pair 75)
Forward (2986,23)AAAGAGTTCCTAGAGAGAGAAGAAmplicon SizecDNA: 181 bpgenomic: 40,581
Reverse (3166,20)AGGTTTCCGGGATTGCCTCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.054 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-0.887 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAAAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTG
AAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCA
GATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACC
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1812198 - 2378
NM_014660 (PHF14)1812986 - 3166
Exon 16 To Exon 17 (Pair 76)
Forward (2990,23)AGTTCCTAGAGAGAGAAGACAAAAmplicon SizecDNA: 254 bpgenomic: 40,654
Reverse (3243,24)CAATATAGCTGTTCTCCTTTACTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-1.307 kcal/mol
Amplicon Folding-1.82 kcal/mol outside primersite
Amplicon SequenceAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGA
TTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATA
CCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
TTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGA
GAACAGCTATATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2542990 - 3243
NR_033435 (PHF14)2542202 - 2455
Exon 16 To Exon 17 (Pair 77)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 89 bpgenomic: 40,489
Reverse (3130,21)AGAGTTGGGTCTCATGAAGGGNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.535 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.127 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)892254 - 2342
NM_014660 (PHF14)893042 - 3130
Exon 16 To Exon 17 (Pair 78)
Forward (2986,23)AAAGAGTTCCTAGAGAGAGAAGAAmplicon SizecDNA: 184 bpgenomic: 40,584
Reverse (3169,21)AAGAGGTTTCCGGGATTGCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.325 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAAAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTG
AAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCA
GATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACC
TCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1842198 - 2381
NM_014660 (PHF14)1842986 - 3169
Exon 16 To Exon 17 (Pair 79)
Forward (2988,22)AGAGTTCCTAGAGAGAGAAGACAmplicon SizecDNA: 225 bpgenomic: 40,625
Reverse (3212,24)TCTATCGAGAGTTTAATCCACATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.531 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-0.893 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAA
GATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGA
TACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTC
TTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2252200 - 2424
NM_014660 (PHF14)2252988 - 3212
Exon 16 To Exon 17 (Pair 80)
Forward (3052,23)TAAGAACTGAATGTGCAACTTGCAmplicon SizecDNA: 193 bpgenomic: 40,593
Reverse (3244,24)ACAATATAGCTGTTCTCCTTTACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.861 kcal/mol in 3' area
Forward Dimers-1.212 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACC
CTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTT
ATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGAGA
ACAGCTATATTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1932264 - 2456
NM_014660 (PHF14)1933052 - 3244
Exon 16 To Exon 17 (Pair 81)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 129 bpgenomic: 40,529
Reverse (3170,21)AAAGAGGTTTCCGGGATTGCCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.477 kcal/mol in 3' area
Reverse Dimers-2.596 kcal/mol
Forward-Reverse Dimers-1.224 kcal/mol
Amplicon Folding0.068 kcal/mol inside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGA
AACCTCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)1293042 - 3170
NR_033435 (PHF14)1292254 - 2382
Exon 16 To Exon 17 (Pair 82)
Forward (3044,24)TGAAGATTTAAGAACTGAATGTGCAmplicon SizecDNA: 292 bpgenomic: 40,692
Reverse (3335,24)TGTTAGTCCAAGTAACAAACCAATNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.774 kcal/mol in 3' area
Reverse Dimers-0.62 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGT
CAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAA
CCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGT
AAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTTTG
CTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACTAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2922256 - 2547
NM_014660 (PHF14)2923044 - 3335
Exon 16 To Exon 17 (Pair 83)
Forward (3044,24)TGAAGATTTAAGAACTGAATGTGCAmplicon SizecDNA: 195 bpgenomic: 40,595
Reverse (3238,24)TAGCTGTTCTCCTTTACTTTATGTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGT
CAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAA
CCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGT
AAAGGAGAACAGCTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1952256 - 2450
NM_014660 (PHF14)1953044 - 3238
Exon 16 To Exon 17 (Pair 84)
Forward (3044,24)TGAAGATTTAAGAACTGAATGTGCAmplicon SizecDNA: 200 bpgenomic: 40,600
Reverse (3243,24)CAATATAGCTGTTCTCCTTTACTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGT
CAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAA
CCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGT
AAAGGAGAACAGCTATATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2002256 - 2455
NM_014660 (PHF14)2003044 - 3243
Exon 16 To Exon 17 (Pair 85)
Forward (2996,23)TAGAGAGAGAAGACAAAGACAGTAmplicon SizecDNA: 133 bpgenomic: 40,533
Reverse (3128,22)AGTTGGGTCTCATGAAGGGTATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.199 kcal/mol in 3' area
Forward Dimers0.248 kcal/mol in 3' area
Reverse Loops1.896 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.161 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATTTAAG
AACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACCCTTC
ATGAGACCCAACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NR_033435 (PHF14)1332208 - 2340
NM_014660 (PHF14)1332996 - 3128
Exon 16 To Exon 17 (Pair 86)
Forward (2990,23)AGTTCCTAGAGAGAGAAGACAAAAmplicon SizecDNA: 259 bpgenomic: 40,659
Reverse (3248,23)AAGGACAATATAGCTGTTCTCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.074 kcal/mol in 3' area
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.211 kcal/mol
Amplicon Folding-1.82 kcal/mol outside primersite
Amplicon SequenceAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGA
TTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATA
CCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTT
TTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGA
GAACAGCTATATTGTCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2592202 - 2460
NM_014660 (PHF14)2592990 - 3248
Exon 16 To Exon 17 (Pair 87)
Forward (3052,23)TAAGAACTGAATGTGCAACTTGCAmplicon SizecDNA: 195 bpgenomic: 40,595
Reverse (3246,23)GGACAATATAGCTGTTCTCCTTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.861 kcal/mol in 3' area
Forward Dimers-1.212 kcal/mol
Reverse Loops1.421 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACC
CTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTT
ATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGGAGA
ACAGCTATATTGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1952264 - 2458
NM_014660 (PHF14)1953052 - 3246
Exon 16 To Exon 17 (Pair 88)
Forward (2989,22)GAGTTCCTAGAGAGAGAAGACAAmplicon SizecDNA: 260 bpgenomic: 40,660
Reverse (3248,23)AAGGACAATATAGCTGTTCTCCTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.074 kcal/mol in 3' area
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.211 kcal/mol
Amplicon Folding-1.82 kcal/mol outside primersite
Amplicon SequenceGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAG
ATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGAT
ACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCT
TTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGG
AGAACAGCTATATTGTCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2602989 - 3248
NR_033435 (PHF14)2602201 - 2460
Exon 16 To Exon 17 (Pair 89)
Forward (3038,23)CAAGGCTGAAGATTTAAGAACTGAmplicon SizecDNA: 268 bpgenomic: 40,668
Reverse (3305,23)TATTCTATCCAAACCTGACAAGCNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.809 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.598 kcal/mol
Reverse Dimers0.133 kcal/mol in 3' area
Forward-Reverse Dimers-1.803 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceCAAGGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAA
TCTTGTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCC
CGGAAACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACA
TAAAGTAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGC
CTTTTGCTTGTCAGGTTTGGATAGAATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2682250 - 2517
NM_014660 (PHF14)2683038 - 3305
Exon 16 To Exon 17 (Pair 90)
Forward (2988,22)AGAGTTCCTAGAGAGAGAAGACAmplicon SizecDNA: 260 bpgenomic: 40,660
Reverse (3247,23)AGGACAATATAGCTGTTCTCCTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.31 kcal/mol in 3' area
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-1.67 kcal/mol
Amplicon Folding-1.82 kcal/mol outside primersite
Amplicon SequenceAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAA
GATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGA
TACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTC
TTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAG
GAGAACAGCTATATTGTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2602988 - 3247
NR_033435 (PHF14)2602200 - 2459
Exon 16 To Exon 17 (Pair 91)
Forward (3044,24)TGAAGATTTAAGAACTGAATGTGCAmplicon SizecDNA: 293 bpgenomic: 40,693
Reverse (3336,24)TTGTTAGTCCAAGTAACAAACCAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.406 kcal/mol
Reverse Dimers-1.065 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGT
CAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAA
CCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGT
AAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTTTG
CTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACTAACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2932256 - 2548
NM_014660 (PHF14)2933044 - 3336
Exon 16 To Exon 17 (Pair 92)
Forward (3044,24)TGAAGATTTAAGAACTGAATGTGCAmplicon SizecDNA: 201 bpgenomic: 40,601
Reverse (3244,24)ACAATATAGCTGTTCTCCTTTACTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.043 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGT
CAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAA
CCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGT
AAAGGAGAACAGCTATATTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2013044 - 3244
NR_033435 (PHF14)2012256 - 2456
Exon 16 To Exon 17 (Pair 93)
Forward (2989,22)GAGTTCCTAGAGAGAGAAGACAAmplicon SizecDNA: 223 bpgenomic: 40,623
Reverse (3211,24)CTATCGAGAGTTTAATCCACATTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.836 kcal/mol
Reverse Dimers-1.262 kcal/mol
Forward-Reverse Dimers-0.799 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAG
ATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGAT
ACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCT
TTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2232989 - 3211
NR_033435 (PHF14)2232201 - 2423
Exon 16 To Exon 17 (Pair 94)
Forward (2986,23)AAAGAGTTCCTAGAGAGAGAAGAAmplicon SizecDNA: 155 bpgenomic: 40,555
Reverse (3140,20)GAGCTGTGGCAGAGTTGGGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.244 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-0.917 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceAAAGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTG
AAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCA
GATACCCTTCATGAGACCCAACTCTGCCACAGCTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_014660 (PHF14)1552986 - 3140
NR_033435 (PHF14)1552198 - 2352
Exon 16 To Exon 17 (Pair 95)
Forward (2992,23)TTCCTAGAGAGAGAAGACAAAGAAmplicon SizecDNA: 221 bpgenomic: 40,621
Reverse (3212,24)TCTATCGAGAGTTTAATCCACATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.531 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-0.893 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATT
TAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACC
CTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCTTTT
ATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2212992 - 3212
NR_033435 (PHF14)2212204 - 2424
Exon 16 To Exon 17 (Pair 96)
Forward (3040,24)AGGCTGAAGATTTAAGAACTGAATAmplicon SizecDNA: 204 bpgenomic: 40,604
Reverse (3243,24)CAATATAGCTGTTCTCCTTTACTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.835 kcal/mol
Forward Dimers-1.327 kcal/mol
Reverse Loops1.437 kcal/mol
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-2.315 kcal/mol
Amplicon Folding-0.803 kcal/mol outside primersite
Amplicon SequenceAGGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATC
TTGTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCG
GAAACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATA
AAGTAAAGGAGAACAGCTATATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2043040 - 3243
NR_033435 (PHF14)2042252 - 2455
Exon 16 To Exon 17 (Pair 97)
Forward (2989,22)GAGTTCCTAGAGAGAGAAGACAAmplicon SizecDNA: 259 bpgenomic: 40,659
Reverse (3247,23)AGGACAATATAGCTGTTCTCCTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.31 kcal/mol in 3' area
Reverse Dimers-2.064 kcal/mol
Forward-Reverse Dimers-1.67 kcal/mol
Amplicon Folding-1.82 kcal/mol outside primersite
Amplicon SequenceGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAG
ATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGAT
ACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCT
TTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAAGTAAAGG
AGAACAGCTATATTGTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)2592201 - 2459
NM_014660 (PHF14)2592989 - 3247
Exon 16 To Exon 17 (Pair 98)
Forward (3042,24)GCTGAAGATTTAAGAACTGAATGTAmplicon SizecDNA: 295 bpgenomic: 40,695
Reverse (3336,24)TTGTTAGTCCAAGTAACAAACCAANr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.44 kcal/mol in 3' area
Forward Dimers-0.605 kcal/mol
Reverse Loops1.406 kcal/mol
Reverse Dimers-1.065 kcal/mol
Forward-Reverse Dimers-1.683 kcal/mol
Amplicon Folding-1.126 kcal/mol outside primersite
Amplicon SequenceGCTGAAGATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTT
GTCAGATACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGA
AACCTCTTTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGAGTACATAAA
GTAAAGGAGAACAGCTATATTGTCCTTTCTATAAGCTTGTCACTGCAAAAAGTTGCCTTT
TGCTTGTCAGGTTTGGATAGAATATAATTGATTGGTTTGTTACTTGGACTAACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2953042 - 3336
NR_033435 (PHF14)2952254 - 2548
Exon 16 To Exon 17 (Pair 99)
Forward (2992,23)TTCCTAGAGAGAGAAGACAAAGAAmplicon SizecDNA: 154 bpgenomic: 40,554
Reverse (3145,21)AGGATGAGCTGTGGCAGAGTTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops0.846 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-1.67 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAGATT
TAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGATACC
CTTCATGAGACCCAACTCTGCCACAGCTCATCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_033435 (PHF14)1542204 - 2357
NM_014660 (PHF14)1542992 - 3145
Exon 16 To Exon 17 (Pair 100)
Forward (2989,22)GAGTTCCTAGAGAGAGAAGACAAmplicon SizecDNA: 224 bpgenomic: 40,624
Reverse (3212,24)TCTATCGAGAGTTTAATCCACATTNr. of Isoforms 2 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.625 kcal/mol
Forward Dimers-1.048 kcal/mol
Reverse Loops1.531 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-0.893 kcal/mol
Amplicon Folding-1.017 kcal/mol outside primersite
Amplicon SequenceGAGTTCCTAGAGAGAGAAGACAAAGACAGTCTGTGTTGCAAAAGAAGCCCAAGGCTGAAG
ATTTAAGAACTGAATGTGCAACTTGCAAGGGAACTGGAGACAATGAAAATCTTGTCAGAT
ACCCTTCATGAGACCCAACTCTGCCACAGCTCATCCTCGGAGGCAATCCCGGAAACCTCT
TTTATAAGTGTGATTTTAAAAATGTGGATTAAACTCTCGATAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014660 (PHF14)2242989 - 3212
NR_033435 (PHF14)2242201 - 2424
 

See below for some more details.

Program Output:

Loading ...