Design Results for PHF8

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 22 To Exon 23 (Pair 1)
Forward (3353,22)CTGATGATGATGACCCTGCTTTAmplicon SizecDNA: 152 bpgenomic: 18,752
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-1.494 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceCTGATGATGATGACCCTGCTTTGAAATCTCGACCCAAGAAAAAGAAGAATTCAGATGATG
CTCCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAAGCAGGACCGTCCTGTGC
GTGAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184897 (PHF8)1522664 - 2815
NM_015107 (PHF8)1522967 - 3118
NM_001184898 (PHF8)1522587 - 2738
NM_001184896 (PHF8)1522816 - 2967
Exon 22 To Exon 23 (Pair 2)
Forward (3394,23)AAGAAGAATTCAGATGATGCTCCAmplicon SizecDNA: 111 bpgenomic: 18,711
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceAAGAAGAATTCAGATGATGCTCCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCG
AAGCAGGACCGTCCTGTGCGTGAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184897 (PHF8)1112705 - 2815
NM_015107 (PHF8)1113008 - 3118
NM_001184896 (PHF8)1112857 - 2967
NM_001184898 (PHF8)1112628 - 2738
Exon 22 To Exon 23 (Pair 3)
Forward (3344,22)CACTGGAGTCTGATGATGATGAAmplicon SizecDNA: 161 bpgenomic: 18,761
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol
Forward Dimers-1.246 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-1.981 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceCACTGGAGTCTGATGATGATGACCCTGCTTTGAAATCTCGACCCAAGAAAAAGAAGAATT
CAGATGATGCTCCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAAGCAGGACC
GTCCTGTGCGTGAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184896 (PHF8)1612807 - 2967
NM_001184898 (PHF8)1612578 - 2738
NM_015107 (PHF8)1612958 - 3118
NM_001184897 (PHF8)1612655 - 2815
Exon 22 To Exon 23 (Pair 4)
Forward (3343,22)TCACTGGAGTCTGATGATGATGAmplicon SizecDNA: 162 bpgenomic: 18,762
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol
Forward Dimers-1.246 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-1.981 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceTCACTGGAGTCTGATGATGATGACCCTGCTTTGAAATCTCGACCCAAGAAAAAGAAGAAT
TCAGATGATGCTCCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAAGCAGGAC
CGTCCTGTGCGTGAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184898 (PHF8)1622577 - 2738
NM_001184896 (PHF8)1622806 - 2967
NM_015107 (PHF8)1622957 - 3118
NM_001184897 (PHF8)1622654 - 2815
Exon 22 To Exon 23 (Pair 5)
Forward (3341,22)CTTCACTGGAGTCTGATGATGAAmplicon SizecDNA: 164 bpgenomic: 18,764
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol
Forward Dimers-1.246 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-1.981 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceCTTCACTGGAGTCTGATGATGATGACCCTGCTTTGAAATCTCGACCCAAGAAAAAGAAGA
ATTCAGATGATGCTCCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAAGCAGG
ACCGTCCTGTGCGTGAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184898 (PHF8)1642575 - 2738
NM_001184896 (PHF8)1642804 - 2967
NM_001184897 (PHF8)1642652 - 2815
NM_015107 (PHF8)1642955 - 3118
Exon 22 To Exon 23 (Pair 6)
Forward (3356,23)ATGATGATGACCCTGCTTTGAAAAmplicon SizecDNA: 149 bpgenomic: 18,749
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.568 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-1.494 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceATGATGATGACCCTGCTTTGAAATCTCGACCCAAGAAAAAGAAGAATTCAGATGATGCTC
CATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAAGCAGGACCGTCCTGTGCGTG
AGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184897 (PHF8)1492667 - 2815
NM_015107 (PHF8)1492970 - 3118
NM_001184896 (PHF8)1492819 - 2967
NM_001184898 (PHF8)1492590 - 2738
Exon 22 To Exon 23 (Pair 7)
Forward (3355,22)GATGATGATGACCCTGCTTTGAAmplicon SizecDNA: 150 bpgenomic: 18,750
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-1.494 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceGATGATGATGACCCTGCTTTGAAATCTCGACCCAAGAAAAAGAAGAATTCAGATGATGCT
CCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAAGCAGGACCGTCCTGTGCGT
GAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184898 (PHF8)1502589 - 2738
NM_001184896 (PHF8)1502818 - 2967
NM_015107 (PHF8)1502969 - 3118
NM_001184897 (PHF8)1502666 - 2815
Exon 22 To Exon 23 (Pair 8)
Forward (3345,22)ACTGGAGTCTGATGATGATGACAmplicon SizecDNA: 160 bpgenomic: 18,760
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.632 kcal/mol
Forward Dimers-0.772 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-1.981 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceACTGGAGTCTGATGATGATGACCCTGCTTTGAAATCTCGACCCAAGAAAAAGAAGAATTC
AGATGATGCTCCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAAGCAGGACCG
TCCTGTGCGTGAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015107 (PHF8)1602959 - 3118
NM_001184897 (PHF8)1602656 - 2815
NM_001184896 (PHF8)1602808 - 2967
NM_001184898 (PHF8)1602579 - 2738
Exon 22 To Exon 23 (Pair 9)
Forward (3354,22)TGATGATGATGACCCTGCTTTGAmplicon SizecDNA: 151 bpgenomic: 18,751
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.005 kcal/mol
Forward Dimers0.044 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-1.494 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceTGATGATGATGACCCTGCTTTGAAATCTCGACCCAAGAAAAAGAAGAATTCAGATGATGC
TCCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAAGCAGGACCGTCCTGTGCG
TGAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_015107 (PHF8)1512968 - 3118
NM_001184897 (PHF8)1512665 - 2815
NM_001184898 (PHF8)1512588 - 2738
NM_001184896 (PHF8)1512817 - 2967
Exon 22 To Exon 23 (Pair 10)
Forward (3339,22)TCCTTCACTGGAGTCTGATGATAmplicon SizecDNA: 166 bpgenomic: 18,766
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol
Forward Dimers-1.246 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-1.981 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceTCCTTCACTGGAGTCTGATGATGATGACCCTGCTTTGAAATCTCGACCCAAGAAAAAGAA
GAATTCAGATGATGCTCCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAAGCA
GGACCGTCCTGTGCGTGAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184896 (PHF8)1662802 - 2967
NM_001184898 (PHF8)1662573 - 2738
NM_015107 (PHF8)1662953 - 3118
NM_001184897 (PHF8)1662650 - 2815
Exon 22 To Exon 23 (Pair 11)
Forward (3396,23)GAAGAATTCAGATGATGCTCCATAmplicon SizecDNA: 109 bpgenomic: 18,709
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.025 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceGAAGAATTCAGATGATGCTCCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAA
GCAGGACCGTCCTGTGCGTGAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184896 (PHF8)1092859 - 2967
NM_001184898 (PHF8)1092630 - 2738
NM_015107 (PHF8)1093010 - 3118
NM_001184897 (PHF8)1092707 - 2815
Exon 22 To Exon 23 (Pair 12)
Forward (3338,22)ATCCTTCACTGGAGTCTGATGAAmplicon SizecDNA: 167 bpgenomic: 18,767
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.158 kcal/mol
Forward Dimers-1.246 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-1.981 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceATCCTTCACTGGAGTCTGATGATGATGACCCTGCTTTGAAATCTCGACCCAAGAAAAAGA
AGAATTCAGATGATGCTCCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAAGC
AGGACCGTCCTGTGCGTGAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184897 (PHF8)1672649 - 2815
NM_015107 (PHF8)1672952 - 3118
NM_001184898 (PHF8)1672572 - 2738
NM_001184896 (PHF8)1672801 - 2967
Exon 22 To Exon 23 (Pair 13)
Forward (3395,23)AGAAGAATTCAGATGATGCTCCAAmplicon SizecDNA: 110 bpgenomic: 18,710
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-1.696 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceAGAAGAATTCAGATGATGCTCCATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGA
AGCAGGACCGTCCTGTGCGTGAGGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184896 (PHF8)1102858 - 2967
NM_001184898 (PHF8)1102629 - 2738
NM_001184897 (PHF8)1102706 - 2815
NM_015107 (PHF8)1103009 - 3118
Exon 22 To Exon 23 (Pair 14)
Forward (3357,23)TGATGATGACCCTGCTTTGAAATAmplicon SizecDNA: 148 bpgenomic: 18,748
Reverse (3504,21)TGTCTCAATAGAGGCTACCCGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.79 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.543 kcal/mol
Forward-Reverse Dimers-1.494 kcal/mol
Amplicon Folding-0.729 kcal/mol outside primersite
Amplicon SequenceTGATGATGACCCTGCTTTGAAATCTCGACCCAAGAAAAAGAAGAATTCAGATGATGCTCC
ATGGAGTCCTAAAGCCCGCGTGACCCCAACTCTGCCGAAGCAGGACCGTCCTGTGCGTGA
GGGGACCCGGGTAGCCTCTATTGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001184897 (PHF8)1482668 - 2815
NM_015107 (PHF8)1482971 - 3118
NM_001184896 (PHF8)1482820 - 2967
NM_001184898 (PHF8)1482591 - 2738
 

See below for some more details.

Program Output:

Loading ...