Design Results for PPARGC1A

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size200
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 191 bpgenomic: 5,163
Reverse (236,23)GAAAGATCAAGTTCAGGAAGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CTTGATCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)19146 - 236
Exon 1 To Exon 2 (Pair 2)
Forward (44,21)TTGCCTGCATGAGTGTGTGCTAmplicon SizecDNA: 193 bpgenomic: 5,165
Reverse (236,23)GAAAGATCAAGTTCAGGAAGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGG
CGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGA
GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTG
AACTTGATCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)19344 - 236
Exon 1 To Exon 2 (Pair 3)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 196 bpgenomic: 5,168
Reverse (236,23)GAAAGATCAAGTTCAGGAAGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)19641 - 236
Exon 1 To Exon 2 (Pair 4)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 180 bpgenomic: 5,152
Reverse (225,22)TTCAGGAAGATCTGGGCAAAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.987 kcal/mol
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)18046 - 225
Exon 1 To Exon 2 (Pair 5)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 182 bpgenomic: 5,154
Reverse (227,22)AGTTCAGGAAGATCTGGGCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.747 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)18246 - 227
Exon 1 To Exon 2 (Pair 6)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 165 bpgenomic: 5,137
Reverse (271,22)AGCTGTCTGTATCCAAGTCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.993 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.628 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAAC
TTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)165107 - 271
Exon 1 To Exon 2 (Pair 7)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 119 bpgenomic: 5,091
Reverse (225,22)TTCAGGAAGATCTGGGCAAAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.987 kcal/mol
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-0.997 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)119107 - 225
Exon 1 To Exon 2 (Pair 8)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 130 bpgenomic: 5,102
Reverse (236,23)GAAAGATCAAGTTCAGGAAGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.251 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAAC
TTGATCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)130107 - 236
Exon 1 To Exon 2 (Pair 9)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 121 bpgenomic: 5,093
Reverse (227,22)AGTTCAGGAAGATCTGGGCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.747 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-0.997 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAAC
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)121107 - 227
Exon 1 To Exon 2 (Pair 10)
Forward (131,21)ACATGTGCAACCAGGACTCTGAmplicon SizecDNA: 132 bpgenomic: 5,104
Reverse (262,23)TATCCAAGTCGTTCACATCTAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers-2.36 kcal/mol
Reverse Loops1.214 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGACATCGAGTGTGCTGCTCTGGTTG
GTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGATGTGA
ACGACTTGGATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)132131 - 262
Exon 1 To Exon 2 (Pair 11)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 122 bpgenomic: 5,094
Reverse (228,22)AAGTTCAGGAAGATCTGGGCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.747 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-0.997 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAAC
TT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)122107 - 228
Exon 1 To Exon 2 (Pair 12)
Forward (131,21)ACATGTGCAACCAGGACTCTGAmplicon SizecDNA: 131 bpgenomic: 5,103
Reverse (261,23)ATCCAAGTCGTTCACATCTAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers-2.36 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGACATCGAGTGTGCTGCTCTGGTTG
GTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGATGTGA
ACGACTTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)131131 - 261
Exon 1 To Exon 2 (Pair 13)
Forward (131,21)ACATGTGCAACCAGGACTCTGAmplicon SizecDNA: 129 bpgenomic: 5,101
Reverse (259,22)CCAAGTCGTTCACATCTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers-2.36 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGACATCGAGTGTGCTGCTCTGGTTG
GTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGATGTGA
ACGACTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)129131 - 259
Exon 1 To Exon 2 (Pair 14)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 183 bpgenomic: 5,155
Reverse (228,22)AAGTTCAGGAAGATCTGGGCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.747 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)18346 - 228
Exon 5 To Exon 6 (Pair 1)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 73 bpgenomic: 931
Reverse (1271,23)ATACTCTTCGCTTTATTGCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.888 kcal/mol in 3' area
Reverse Dimers0.016 kcal/mol
Forward-Reverse Dimers-1.206 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)73635 - 707
Exon 5 To Exon 6 (Pair 2)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 163 bpgenomic: 1,021
Reverse (1361,20)GTGGGTTTGGTGTGAGGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers1.193 kcal/mol in 3' area
Forward-Reverse Dimers-1.822 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)163635 - 797
Exon 5 To Exon 6 (Pair 3)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 162 bpgenomic: 1,020
Reverse (1325,22)AGATATTTGAGAAGCTCCGAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops0.934 kcal/mol in 3' area
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-1.588 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGCA
AAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)162600 - 761
Exon 5 To Exon 6 (Pair 4)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 163 bpgenomic: 1,021
Reverse (1326,22)CAGATATTTGAGAAGCTCCGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.735 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-1.588 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGCA
AAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)163600 - 762
Exon 5 To Exon 6 (Pair 5)
Forward (1162,21)GAATGCAGTGGTCTCAGTACCAmplicon SizecDNA: 165 bpgenomic: 1,023
Reverse (1326,22)CAGATATTTGAGAAGCTCCGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.735 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-1.588 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAAC
CCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAG
CAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)165598 - 762
Exon 5 To Exon 6 (Pair 6)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 135 bpgenomic: 993
Reverse (1333,23)TTGTGGTCAGATATTTGAGAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.975 kcal/mol
Reverse Dimers-0.586 kcal/mol
Forward-Reverse Dimers-1.709 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)135635 - 769
Exon 5 To Exon 6 (Pair 7)
Forward (1163,21)AATGCAGTGGTCTCAGTACCCAmplicon SizecDNA: 164 bpgenomic: 1,022
Reverse (1326,22)CAGATATTTGAGAAGCTCCGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.735 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-1.588 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACC
CTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGC
AAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)164599 - 762
Exon 5 To Exon 6 (Pair 8)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 107 bpgenomic: 965
Reverse (1270,23)TACTCTTCGCTTTATTGCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.888 kcal/mol
Reverse Dimers0.016 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)107600 - 706
Exon 5 To Exon 6 (Pair 9)
Forward (1162,21)GAATGCAGTGGTCTCAGTACCAmplicon SizecDNA: 164 bpgenomic: 1,022
Reverse (1325,22)AGATATTTGAGAAGCTCCGAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops0.934 kcal/mol in 3' area
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-1.588 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAAC
CCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAG
CAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)164598 - 761
Exon 5 To Exon 6 (Pair 10)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 74 bpgenomic: 932
Reverse (1272,23)AATACTCTTCGCTTTATTGCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.888 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)74635 - 708
Exon 5 To Exon 6 (Pair 11)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 161 bpgenomic: 1,019
Reverse (1359,20)GGGTTTGGTGTGAGGAGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers1.193 kcal/mol in 3' area
Forward-Reverse Dimers-1.822 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)161635 - 795
Exon 5 To Exon 6 (Pair 12)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 170 bpgenomic: 1,028
Reverse (1368,21)GTTCTCTGTGGGTTTGGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.489 kcal/mol
Reverse Dimers1.586 kcal/mol
Forward-Reverse Dimers-2.276 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)170635 - 804
Exon 5 To Exon 6 (Pair 13)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 159 bpgenomic: 1,017
Reverse (1357,21)GTTTGGTGTGAGGAGGGTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.193 kcal/mol in 3' area
Reverse Dimers0.441 kcal/mol in 3' area
Forward-Reverse Dimers-1.822 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)159635 - 793
Exon 5 To Exon 6 (Pair 14)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 108 bpgenomic: 966
Reverse (1271,23)ATACTCTTCGCTTTATTGCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.888 kcal/mol in 3' area
Reverse Dimers0.016 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)108600 - 707
Exon 5 To Exon 6 (Pair 15)
Forward (1163,21)AATGCAGTGGTCTCAGTACCCAmplicon SizecDNA: 163 bpgenomic: 1,021
Reverse (1325,22)AGATATTTGAGAAGCTCCGAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops0.934 kcal/mol in 3' area
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-1.588 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACC
CTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGC
AAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)163599 - 761
Exon 5 To Exon 6 (Pair 16)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 166 bpgenomic: 1,024
Reverse (1364,21)TCTGTGGGTTTGGTGTGAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.672 kcal/mol
Reverse Dimers0.26 kcal/mol in 3' area
Forward-Reverse Dimers-2.261 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)166635 - 800
Exon 5 To Exon 6 (Pair 17)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 72 bpgenomic: 930
Reverse (1270,23)TACTCTTCGCTTTATTGCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.888 kcal/mol
Reverse Dimers0.016 kcal/mol
Forward-Reverse Dimers-1.206 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)72635 - 706
Exon 5 To Exon 6 (Pair 18)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 168 bpgenomic: 1,026
Reverse (1366,21)TCTCTGTGGGTTTGGTGTGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.504 kcal/mol
Reverse Dimers0.31 kcal/mol in 3' area
Forward-Reverse Dimers-2.276 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)168635 - 802
Exon 5 To Exon 6 (Pair 19)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 162 bpgenomic: 1,020
Reverse (1360,20)TGGGTTTGGTGTGAGGAGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers1.193 kcal/mol in 3' area
Forward-Reverse Dimers-1.822 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)162635 - 796
Exon 5 To Exon 6 (Pair 20)
Forward (1202,22)ATCACAGGATCAGAACAAACCCAmplicon SizecDNA: 176 bpgenomic: 1,034
Reverse (1377,21)GCTGTTTCTGTTCTCTGTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.285 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.489 kcal/mol in 3' area
Reverse Dimers0.612 kcal/mol
Forward-Reverse Dimers-2.889 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAG
CGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAAT
ATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)176638 - 813
Exon 5 To Exon 6 (Pair 21)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 191 bpgenomic: 1,049
Reverse (1389,22)TTTGTCTCTGCTGCTGTTTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.052 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCA
GCAGAGACAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)191635 - 825
Exon 5 To Exon 6 (Pair 22)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 109 bpgenomic: 967
Reverse (1272,23)AATACTCTTCGCTTTATTGCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.888 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)109600 - 708
Exon 5 To Exon 6 (Pair 23)
Forward (1202,22)ATCACAGGATCAGAACAAACCCAmplicon SizecDNA: 188 bpgenomic: 1,046
Reverse (1389,22)TTTGTCTCTGCTGCTGTTTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.285 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.052 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAG
CGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAAT
ATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCA
GAGACAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)188638 - 825
Exon 5 To Exon 6 (Pair 24)
Forward (1202,22)ATCACAGGATCAGAACAAACCCAmplicon SizecDNA: 187 bpgenomic: 1,045
Reverse (1388,22)TTGTCTCTGCTGCTGTTTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.285 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.052 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAG
CGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAAT
ATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCA
GAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)187638 - 824
Exon 5 To Exon 6 (Pair 25)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 190 bpgenomic: 1,048
Reverse (1388,22)TTGTCTCTGCTGCTGTTTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.052 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCA
GCAGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)190635 - 824
Exon 5 To Exon 6 (Pair 26)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 160 bpgenomic: 1,018
Reverse (1358,20)GGTTTGGTGTGAGGAGGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.47 kcal/mol in 3' area
Reverse Dimers1.143 kcal/mol in 3' area
Forward-Reverse Dimers-1.822 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)160635 - 794
Exon 6 To Exon 9 (Pair 1)
Forward (1412,21)ACACACAGTCGCAGTCACAACAmplicon SizecDNA: 170 bpgenomic: 13,844
Reverse (1581,20)AGTGGTGGGTGGAGTTAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.179 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.585 kcal/mol in 3' area
Reverse Dimers0.332 kcal/mol in 3' area
Forward-Reverse Dimers-2.2 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGA
CCCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGCA
CCTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)170848 - 1017
Exon 6 To Exon 7 (Pair 1)
Forward (1357,21)CCCACAGAGAACAGAAACAGCAmplicon SizecDNA: 111 bpgenomic: 4,002
Reverse (1467,24)AGGAAGAGATAAAGTTGTTGGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers0.26 kcal/mol in 3' area
Reverse Loops1.935 kcal/mol
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-1.368 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceCCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACA
CAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)111793 - 903
Exon 6 To Exon 9 (Pair 2)
Forward (1412,21)ACACACAGTCGCAGTCACAACAmplicon SizecDNA: 171 bpgenomic: 13,845
Reverse (1582,20)GAGTGGTGGGTGGAGTTAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.179 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.642 kcal/mol
Reverse Dimers0.492 kcal/mol in 3' area
Forward-Reverse Dimers-2.2 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGA
CCCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGCA
CCTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)171848 - 1018
Exon 6 To Exon 9 (Pair 3)
Forward (1419,22)GTCGCAGTCACAACACTTACAAAmplicon SizecDNA: 163 bpgenomic: 13,837
Reverse (1581,20)AGTGGTGGGTGGAGTTAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.396 kcal/mol
Forward Dimers-1.265 kcal/mol
Reverse Loops2.585 kcal/mol in 3' area
Reverse Dimers0.332 kcal/mol in 3' area
Forward-Reverse Dimers-2.945 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGACCCCAGA
GTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGCACCTTAAG
TGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)163855 - 1017
Exon 6 To Exon 9 (Pair 4)
Forward (1411,21)CACACACAGTCGCAGTCACAAAmplicon SizecDNA: 183 bpgenomic: 13,857
Reverse (1593,21)TTTATGAGGAGGAGTGGTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.642 kcal/mol
Reverse Dimers0.712 kcal/mol
Forward-Reverse Dimers-1.127 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTG
ACCCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGC
ACCTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCAT
AAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)183847 - 1029
Exon 6 To Exon 7 (Pair 2)
Forward (1337,21)ATGACCCTCCTCACACCAAACAmplicon SizecDNA: 133 bpgenomic: 4,024
Reverse (1469,23)AGAGGAAGAGATAAAGTTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.054 kcal/mol
Forward Dimers-0.124 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-2.613 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCT
CCAAAAAGAAGTCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTT
TATCTCTTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)133773 - 905
Exon 6 To Exon 9 (Pair 5)
Forward (1411,21)CACACACAGTCGCAGTCACAAAmplicon SizecDNA: 173 bpgenomic: 13,847
Reverse (1583,20)GGAGTGGTGGGTGGAGTTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.642 kcal/mol
Reverse Dimers0.492 kcal/mol in 3' area
Forward-Reverse Dimers-2.74 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTG
ACCCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGC
ACCTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)173847 - 1019
Exon 6 To Exon 7 (Pair 3)
Forward (1339,20)GACCCTCCTCACACCAAACCAmplicon SizecDNA: 130 bpgenomic: 4,021
Reverse (1468,23)GAGGAAGAGATAAAGTTGTTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers1.012 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-2.3 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCC
AAAAAGAAGTCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTA
TCTCTTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)130775 - 904
Exon 6 To Exon 7 (Pair 4)
Forward (1342,20)CCTCCTCACACCAAACCCACAmplicon SizecDNA: 128 bpgenomic: 4,019
Reverse (1469,23)AGAGGAAGAGATAAAGTTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.82 kcal/mol
Forward Dimers1001.39 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-2.613 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCAAA
AAGAAGTCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCT
CTTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)128778 - 905
Exon 6 To Exon 7 (Pair 5)
Forward (1348,21)CACACCAAACCCACAGAGAACAmplicon SizecDNA: 122 bpgenomic: 4,013
Reverse (1469,23)AGAGGAAGAGATAAAGTTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers1001.2 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCAAAAAGAAG
TCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCT
CT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)122784 - 905
Exon 6 To Exon 7 (Pair 6)
Forward (1371,22)AAACAGCAGCAGAGACAAATGCAmplicon SizecDNA: 104 bpgenomic: 3,995
Reverse (1474,22)GGGTCAGAGGAAGAGATAAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.328 kcal/mol in 3' area
Forward Dimers-1.084 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-0.997 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceAAACAGCAGCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAGTCACA
ACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)104807 - 910
Exon 6 To Exon 9 (Pair 6)
Forward (1413,21)CACACAGTCGCAGTCACAACAAmplicon SizecDNA: 181 bpgenomic: 13,855
Reverse (1593,21)TTTATGAGGAGGAGTGGTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.779 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.642 kcal/mol
Reverse Dimers0.712 kcal/mol
Forward-Reverse Dimers-1.127 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceCACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGAC
CCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGCAC
CTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATAA
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)181849 - 1029
Exon 6 To Exon 9 (Pair 7)
Forward (1420,22)TCGCAGTCACAACACTTACAAGAmplicon SizecDNA: 162 bpgenomic: 13,836
Reverse (1581,20)AGTGGTGGGTGGAGTTAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.396 kcal/mol
Forward Dimers-1.265 kcal/mol
Reverse Loops2.585 kcal/mol in 3' area
Reverse Dimers0.332 kcal/mol in 3' area
Forward-Reverse Dimers-2.945 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGACCCCAGAG
TCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGCACCTTAAGT
GTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)162856 - 1017
Exon 6 To Exon 7 (Pair 7)
Forward (1310,23)AGCTTCTCAAATATCTGACCACAAmplicon SizecDNA: 160 bpgenomic: 4,051
Reverse (1469,23)AGAGGAAGAGATAAAGTTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.041 kcal/mol
Forward Dimers-1.822 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-1.626 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceAGCTTCTCAAATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACA
GAAACAGCAGCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAGTCAC
AACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)160746 - 905
Exon 6 To Exon 7 (Pair 8)
Forward (1341,20)CCCTCCTCACACCAAACCCAAmplicon SizecDNA: 128 bpgenomic: 4,019
Reverse (1468,23)GAGGAAGAGATAAAGTTGTTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.82 kcal/mol
Forward Dimers1001.39 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-2.3 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceCCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCAA
AAAGAAGTCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATC
TCTTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)128777 - 904
Exon 6 To Exon 7 (Pair 9)
Forward (1364,22)AGAACAGAAACAGCAGCAGAGAAmplicon SizecDNA: 111 bpgenomic: 4,002
Reverse (1474,22)GGGTCAGAGGAAGAGATAAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-0.662 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGC
AGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)111800 - 910
Exon 6 To Exon 9 (Pair 8)
Forward (1412,21)ACACACAGTCGCAGTCACAACAmplicon SizecDNA: 172 bpgenomic: 13,846
Reverse (1583,20)GGAGTGGTGGGTGGAGTTAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.179 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.642 kcal/mol
Reverse Dimers0.492 kcal/mol in 3' area
Forward-Reverse Dimers-2.2 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGA
CCCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGCA
CCTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)172848 - 1019
Exon 6 To Exon 7 (Pair 10)
Forward (1339,20)GACCCTCCTCACACCAAACCAmplicon SizecDNA: 131 bpgenomic: 4,022
Reverse (1469,23)AGAGGAAGAGATAAAGTTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers1.012 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-2.613 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCC
AAAAAGAAGTCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTA
TCTCTTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)131775 - 905
Exon 6 To Exon 7 (Pair 11)
Forward (1366,22)AACAGAAACAGCAGCAGAGACAAmplicon SizecDNA: 102 bpgenomic: 3,993
Reverse (1467,24)AGGAAGAGATAAAGTTGTTGGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-1.449 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceAACAGAAACAGCAGCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAG
TCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)102802 - 903
Exon 6 To Exon 9 (Pair 9)
Forward (1412,21)ACACACAGTCGCAGTCACAACAmplicon SizecDNA: 174 bpgenomic: 13,848
Reverse (1585,20)GAGGAGTGGTGGGTGGAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.179 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.642 kcal/mol
Reverse Dimers0.492 kcal/mol in 3' area
Forward-Reverse Dimers-2.2 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGA
CCCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGCA
CCTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)174848 - 1021
Exon 6 To Exon 7 (Pair 12)
Forward (1337,21)ATGACCCTCCTCACACCAAACAmplicon SizecDNA: 132 bpgenomic: 4,023
Reverse (1468,23)GAGGAAGAGATAAAGTTGTTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.054 kcal/mol
Forward Dimers-0.124 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-2.3 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCT
CCAAAAAGAAGTCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTT
TATCTCTTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)132773 - 904
Exon 6 To Exon 7 (Pair 13)
Forward (1364,22)AGAACAGAAACAGCAGCAGAGAAmplicon SizecDNA: 104 bpgenomic: 3,995
Reverse (1467,24)AGGAAGAGATAAAGTTGTTGGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-1.449 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGC
AGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)104800 - 903
Exon 6 To Exon 7 (Pair 14)
Forward (1357,21)CCCACAGAGAACAGAAACAGCAmplicon SizecDNA: 118 bpgenomic: 4,009
Reverse (1474,22)GGGTCAGAGGAAGAGATAAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers0.26 kcal/mol in 3' area
Reverse Loops1.9 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-1.039 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceCCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACA
CAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)118793 - 910
Exon 6 To Exon 7 (Pair 15)
Forward (1340,20)ACCCTCCTCACACCAAACCCAmplicon SizecDNA: 130 bpgenomic: 4,021
Reverse (1469,23)AGAGGAAGAGATAAAGTTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.381 kcal/mol
Forward Dimers1001.39 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-2.613 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCA
AAAAGAAGTCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTAT
CTCTTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)130776 - 905
Exon 6 To Exon 7 (Pair 16)
Forward (1339,20)GACCCTCCTCACACCAAACCAmplicon SizecDNA: 136 bpgenomic: 4,027
Reverse (1474,22)GGGTCAGAGGAAGAGATAAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers1.012 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-2.802 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCC
AAAAAGAAGTCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTA
TCTCTTCCTCTGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)136775 - 910
Exon 6 To Exon 9 (Pair 10)
Forward (1412,21)ACACACAGTCGCAGTCACAACAmplicon SizecDNA: 182 bpgenomic: 13,856
Reverse (1593,21)TTTATGAGGAGGAGTGGTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.179 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.642 kcal/mol
Reverse Dimers0.712 kcal/mol
Forward-Reverse Dimers-1.127 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGA
CCCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGCA
CCTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATA
AA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)182848 - 1029
Exon 6 To Exon 7 (Pair 17)
Forward (1367,22)ACAGAAACAGCAGCAGAGACAAAmplicon SizecDNA: 101 bpgenomic: 3,992
Reverse (1467,24)AGGAAGAGATAAAGTTGTTGGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-1.084 kcal/mol
Reverse Loops1.935 kcal/mol
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-1.449 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceACAGAAACAGCAGCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAGT
CACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)101803 - 903
Exon 6 To Exon 9 (Pair 11)
Forward (1411,21)CACACACAGTCGCAGTCACAAAmplicon SizecDNA: 172 bpgenomic: 13,846
Reverse (1582,20)GAGTGGTGGGTGGAGTTAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.642 kcal/mol
Reverse Dimers0.492 kcal/mol in 3' area
Forward-Reverse Dimers-2.74 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTG
ACCCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGC
ACCTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)172847 - 1018
Exon 6 To Exon 9 (Pair 12)
Forward (1413,21)CACACAGTCGCAGTCACAACAAmplicon SizecDNA: 180 bpgenomic: 13,854
Reverse (1592,21)TTATGAGGAGGAGTGGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.779 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.642 kcal/mol
Reverse Dimers0.712 kcal/mol
Forward-Reverse Dimers-1.127 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceCACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGAC
CCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGCAC
CTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)180849 - 1028
Exon 6 To Exon 9 (Pair 13)
Forward (1411,21)CACACACAGTCGCAGTCACAAAmplicon SizecDNA: 171 bpgenomic: 13,845
Reverse (1581,20)AGTGGTGGGTGGAGTTAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.585 kcal/mol in 3' area
Reverse Dimers0.332 kcal/mol in 3' area
Forward-Reverse Dimers-2.74 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTG
ACCCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGC
ACCTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)171847 - 1017
Exon 6 To Exon 7 (Pair 18)
Forward (1342,20)CCTCCTCACACCAAACCCACAmplicon SizecDNA: 127 bpgenomic: 4,018
Reverse (1468,23)GAGGAAGAGATAAAGTTGTTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.82 kcal/mol
Forward Dimers1001.39 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-2.3 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCAAA
AAGAAGTCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCT
CTTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)127778 - 904
Exon 6 To Exon 7 (Pair 19)
Forward (1340,20)ACCCTCCTCACACCAAACCCAmplicon SizecDNA: 129 bpgenomic: 4,020
Reverse (1468,23)GAGGAAGAGATAAAGTTGTTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.381 kcal/mol
Forward Dimers1001.39 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-2.3 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCA
AAAAGAAGTCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTAT
CTCTTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)129776 - 904
Exon 6 To Exon 7 (Pair 20)
Forward (1311,23)GCTTCTCAAATATCTGACCACAAAmplicon SizecDNA: 159 bpgenomic: 4,050
Reverse (1469,23)AGAGGAAGAGATAAAGTTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.041 kcal/mol
Forward Dimers-0.55 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-1.626 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceGCTTCTCAAATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAG
AAACAGCAGCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAGTCACA
ACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)159747 - 905
Exon 6 To Exon 9 (Pair 14)
Forward (1411,21)CACACACAGTCGCAGTCACAAAmplicon SizecDNA: 175 bpgenomic: 13,849
Reverse (1585,20)GAGGAGTGGTGGGTGGAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.705 kcal/mol
Forward Dimers-0.26 kcal/mol
Reverse Loops2.642 kcal/mol
Reverse Dimers0.492 kcal/mol in 3' area
Forward-Reverse Dimers-2.74 kcal/mol
Amplicon Folding-1.077 kcal/mol outside primersite
Amplicon SequenceCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTG
ACCCCAGAGTCACCAAATGACCCCAAGGGTTCCCCATTTGAGAACAAGACTATTGAACGC
ACCTTAAGTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)175847 - 1021
Exon 6 To Exon 7 (Pair 21)
Forward (1341,20)CCCTCCTCACACCAAACCCAAmplicon SizecDNA: 129 bpgenomic: 4,020
Reverse (1469,23)AGAGGAAGAGATAAAGTTGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.82 kcal/mol
Forward Dimers1001.39 kcal/mol
Reverse Loops1.935 kcal/mol in 3' area
Reverse Dimers-0.138 kcal/mol
Forward-Reverse Dimers-2.613 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceCCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCAA
AAAGAAGTCCCACACACAGTCGCAGTCACAACACTTACAAGCCAAACCAACAACTTTATC
TCTTCCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)129777 - 905
Exon 6 To Exon 7 (Pair 22)
Forward (1370,22)GAAACAGCAGCAGAGACAAATGAmplicon SizecDNA: 105 bpgenomic: 3,996
Reverse (1474,22)GGGTCAGAGGAAGAGATAAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.917 kcal/mol in 3' area
Forward Dimers-1.084 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-0.997 kcal/mol
Amplicon Folding0.705 kcal/mol outside primersite
Amplicon SequenceGAAACAGCAGCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAGTCAC
AACACTTACAAGCCAAACCAACAACTTTATCTCTTCCTCTGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)105806 - 910
Exon 8 To Exon 9 (Pair 1)
Forward (1539,21)TGTGGAACTCTCTGGAACTGCAmplicon SizecDNA: 180 bpgenomic: 9,854
Reverse (1718,22)GTGGAGTTATTGCCTTGTGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.348 kcal/mol
Forward Dimers0.2 kcal/mol in 3' area
Reverse Loops2.139 kcal/mol
Reverse Dimers-0.397 kcal/mol
Forward-Reverse Dimers-2.307 kcal/mol
Amplicon Folding-2.018 kcal/mol outside primersite
Amplicon SequenceTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATAAAGCCAA
CCAAGATAACCCTTTTAGGGCTTCTCCAAAGCTGAAGTCCTCTTGCAAGACTGTGGTGCC
ACCACCATCAAAGAAGCCCAGGTACAGTGAGTCTTCTGGTACACAAGGCAATAACTCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)180975 - 1154
Exon 8 To Exon 9 (Pair 2)
Forward (1539,21)TGTGGAACTCTCTGGAACTGCAmplicon SizecDNA: 152 bpgenomic: 9,826
Reverse (1690,21)ACTCACTGTACCTGGGCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.348 kcal/mol
Forward Dimers0.2 kcal/mol in 3' area
Reverse Loops1.539 kcal/mol
Reverse Dimers-1.117 kcal/mol
Forward-Reverse Dimers-1.025 kcal/mol
Amplicon Folding-2.018 kcal/mol outside primersite
Amplicon SequenceTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATAAAGCCAA
CCAAGATAACCCTTTTAGGGCTTCTCCAAAGCTGAAGTCCTCTTGCAAGACTGTGGTGCC
ACCACCATCAAAGAAGCCCAGGTACAGTGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)152975 - 1126
Exon 8 To Exon 9 (Pair 3)
Forward (1539,21)TGTGGAACTCTCTGGAACTGCAmplicon SizecDNA: 151 bpgenomic: 9,825
Reverse (1689,21)CTCACTGTACCTGGGCTTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.348 kcal/mol
Forward Dimers0.2 kcal/mol in 3' area
Reverse Loops2.538 kcal/mol in 3' area
Reverse Dimers-1.117 kcal/mol
Forward-Reverse Dimers-1.025 kcal/mol
Amplicon Folding-2.018 kcal/mol outside primersite
Amplicon SequenceTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATAAAGCCAA
CCAAGATAACCCTTTTAGGGCTTCTCCAAAGCTGAAGTCCTCTTGCAAGACTGTGGTGCC
ACCACCATCAAAGAAGCCCAGGTACAGTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)151975 - 1125
Exon 8 To Exon 9 (Pair 4)
Forward (1539,21)TGTGGAACTCTCTGGAACTGCAmplicon SizecDNA: 182 bpgenomic: 9,856
Reverse (1720,22)TGGTGGAGTTATTGCCTTGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.348 kcal/mol
Forward Dimers0.2 kcal/mol in 3' area
Reverse Loops2.094 kcal/mol
Reverse Dimers-0.397 kcal/mol
Forward-Reverse Dimers-2.307 kcal/mol
Amplicon Folding-2.018 kcal/mol outside primersite
Amplicon SequenceTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATAAAGCCAA
CCAAGATAACCCTTTTAGGGCTTCTCCAAAGCTGAAGTCCTCTTGCAAGACTGTGGTGCC
ACCACCATCAAAGAAGCCCAGGTACAGTGAGTCTTCTGGTACACAAGGCAATAACTCCAC
CA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)182975 - 1156
Exon 8 To Exon 9 (Pair 5)
Forward (1539,21)TGTGGAACTCTCTGGAACTGCAmplicon SizecDNA: 158 bpgenomic: 9,832
Reverse (1696,21)CAGAAGACTCACTGTACCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.348 kcal/mol
Forward Dimers0.2 kcal/mol in 3' area
Reverse Loops0.976 kcal/mol
Reverse Dimers-0.717 kcal/mol
Forward-Reverse Dimers-1.176 kcal/mol
Amplicon Folding-2.018 kcal/mol outside primersite
Amplicon SequenceTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATAAAGCCAA
CCAAGATAACCCTTTTAGGGCTTCTCCAAAGCTGAAGTCCTCTTGCAAGACTGTGGTGCC
ACCACCATCAAAGAAGCCCAGGTACAGTGAGTCTTCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)158975 - 1132
Exon 8 To Exon 9 (Pair 6)
Forward (1539,21)TGTGGAACTCTCTGGAACTGCAmplicon SizecDNA: 149 bpgenomic: 9,823
Reverse (1687,21)CACTGTACCTGGGCTTCTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.348 kcal/mol
Forward Dimers0.2 kcal/mol in 3' area
Reverse Loops2.538 kcal/mol in 3' area
Reverse Dimers-1.117 kcal/mol
Forward-Reverse Dimers-1.025 kcal/mol
Amplicon Folding-2.018 kcal/mol outside primersite
Amplicon SequenceTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATAAAGCCAA
CCAAGATAACCCTTTTAGGGCTTCTCCAAAGCTGAAGTCCTCTTGCAAGACTGTGGTGCC
ACCACCATCAAAGAAGCCCAGGTACAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)149975 - 1123
Exon 8 To Exon 9 (Pair 7)
Forward (1539,21)TGTGGAACTCTCTGGAACTGCAmplicon SizecDNA: 183 bpgenomic: 9,857
Reverse (1721,22)TTGGTGGAGTTATTGCCTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.348 kcal/mol
Forward Dimers0.2 kcal/mol in 3' area
Reverse Loops2.094 kcal/mol
Reverse Dimers-0.397 kcal/mol
Forward-Reverse Dimers-2.307 kcal/mol
Amplicon Folding-2.018 kcal/mol outside primersite
Amplicon SequenceTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATAAAGCCAA
CCAAGATAACCCTTTTAGGGCTTCTCCAAAGCTGAAGTCCTCTTGCAAGACTGTGGTGCC
ACCACCATCAAAGAAGCCCAGGTACAGTGAGTCTTCTGGTACACAAGGCAATAACTCCAC
CAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)183975 - 1157
Exon 8 To Exon 9 (Pair 8)
Forward (1539,21)TGTGGAACTCTCTGGAACTGCAmplicon SizecDNA: 159 bpgenomic: 9,833
Reverse (1697,21)CCAGAAGACTCACTGTACCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.348 kcal/mol
Forward Dimers0.2 kcal/mol in 3' area
Reverse Loops0.976 kcal/mol
Reverse Dimers-0.717 kcal/mol
Forward-Reverse Dimers-2.814 kcal/mol
Amplicon Folding-2.018 kcal/mol outside primersite
Amplicon SequenceTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATAAAGCCAA
CCAAGATAACCCTTTTAGGGCTTCTCCAAAGCTGAAGTCCTCTTGCAAGACTGTGGTGCC
ACCACCATCAAAGAAGCCCAGGTACAGTGAGTCTTCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)159975 - 1133
Exon 8 To Exon 9 (Pair 9)
Forward (1539,21)TGTGGAACTCTCTGGAACTGCAmplicon SizecDNA: 181 bpgenomic: 9,855
Reverse (1719,22)GGTGGAGTTATTGCCTTGTGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.348 kcal/mol
Forward Dimers0.2 kcal/mol in 3' area
Reverse Loops2.139 kcal/mol
Reverse Dimers-0.397 kcal/mol
Forward-Reverse Dimers-2.307 kcal/mol
Amplicon Folding-2.018 kcal/mol outside primersite
Amplicon SequenceTGTGGAACTCTCTGGAACTGCAGGCCTAACTCCACCCACCACTCCTCCTCATAAAGCCAA
CCAAGATAACCCTTTTAGGGCTTCTCCAAAGCTGAAGTCCTCTTGCAAGACTGTGGTGCC
ACCACCATCAAAGAAGCCCAGGTACAGTGAGTCTTCTGGTACACAAGGCAATAACTCCAC
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)181975 - 1155
Exon 11 To Exon 12 (Pair 1)
Forward (2638,22)AGAGAGTATGAGAAGCGAGAGTAmplicon SizecDNA: 167 bpgenomic: 10,568
Reverse (2804,22)GTGCACTCCTCAATTTCACCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.511 kcal/mol in 3' area
Forward Dimers-1.322 kcal/mol
Reverse Loops2.472 kcal/mol in 3' area
Reverse Dimers-2.918 kcal/mol
Forward-Reverse Dimers-1.794 kcal/mol
Amplicon Folding-0.641 kcal/mol outside primersite
Amplicon SequenceAGAGAGTATGAGAAGCGAGAGTCTGAGAGGGCCAAGCAAAGGGAGAGGCAGAGGCAGAAG
GCAATTGAAGAGCGCCGTGTGATTTATGTCGGTAAAATCAGACCTGACACAACACGGACA
GAACTGAGGGACCGTTTTGAAGTTTTTGGTGAAATTGAGGAGTGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)1672074 - 2240
Exon 13 To Exon 14 (Pair 1)
Forward (2911,23)GAAACTGACTTTGAGCTGTACTTAmplicon SizecDNA: 120 bpgenomic: 5,924
Reverse (3030,22)AGAGTCATACTTGCTCTTGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.747 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.839 kcal/mol
Reverse Dimers-1.109 kcal/mol
Forward-Reverse Dimers-2.459 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGAAACTGACTTTGAGCTGTACTTTTGTGGACGCAAGCAATTTTTCAAGTCTAACTATGCA
GACCTAGATTCAAACTCAGATGACTTTGACCCTGCTTCCACCAAGAGCAAGTATGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)1202347 - 2466
Exon 13 To Exon 14 (Pair 2)
Forward (2911,23)GAAACTGACTTTGAGCTGTACTTAmplicon SizecDNA: 117 bpgenomic: 5,921
Reverse (3027,22)GTCATACTTGCTCTTGGTGGAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.747 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops2.108 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.902 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGAAACTGACTTTGAGCTGTACTTTTGTGGACGCAAGCAATTTTTCAAGTCTAACTATGCA
GACCTAGATTCAAACTCAGATGACTTTGACCCTGCTTCCACCAAGAGCAAGTATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)1172347 - 2463
Exon 13 To Exon 14 (Pair 3)
Forward (2847,22)CTACCGTTATACCTGTGATGCTAmplicon SizecDNA: 190 bpgenomic: 5,994
Reverse (3036,22)ATCCAGAGAGTCATACTTGCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.396 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.839 kcal/mol
Reverse Dimers-1.109 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-1.04 kcal/mol outside primersite
Amplicon SequenceCTACCGTTATACCTGTGATGCTTTTGCTGCTCTTGAAAATGGATACACTTTGCGCAGGTC
AAACGAAACTGACTTTGAGCTGTACTTTTGTGGACGCAAGCAATTTTTCAAGTCTAACTA
TGCAGACCTAGATTCAAACTCAGATGACTTTGACCCTGCTTCCACCAAGAGCAAGTATGA
CTCTCTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)1902283 - 2472
Exon 13 To Exon 14 (Pair 4)
Forward (2911,23)GAAACTGACTTTGAGCTGTACTTAmplicon SizecDNA: 118 bpgenomic: 5,922
Reverse (3028,22)AGTCATACTTGCTCTTGGTGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.747 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.402 kcal/mol
Reverse Dimers-0.546 kcal/mol
Forward-Reverse Dimers-1.902 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGAAACTGACTTTGAGCTGTACTTTTGTGGACGCAAGCAATTTTTCAAGTCTAACTATGCA
GACCTAGATTCAAACTCAGATGACTTTGACCCTGCTTCCACCAAGAGCAAGTATGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)1182347 - 2464
Exon 13 To Exon 14 (Pair 5)
Forward (2848,23)TACCGTTATACCTGTGATGCTTTAmplicon SizecDNA: 189 bpgenomic: 5,993
Reverse (3036,22)ATCCAGAGAGTCATACTTGCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.331 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops0.839 kcal/mol
Reverse Dimers-1.109 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-1.04 kcal/mol outside primersite
Amplicon SequenceTACCGTTATACCTGTGATGCTTTTGCTGCTCTTGAAAATGGATACACTTTGCGCAGGTCA
AACGAAACTGACTTTGAGCTGTACTTTTGTGGACGCAAGCAATTTTTCAAGTCTAACTAT
GCAGACCTAGATTCAAACTCAGATGACTTTGACCCTGCTTCCACCAAGAGCAAGTATGAC
TCTCTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)1892284 - 2472
Exon 13 To Exon 14 (Pair 6)
Forward (2911,23)GAAACTGACTTTGAGCTGTACTTAmplicon SizecDNA: 126 bpgenomic: 5,930
Reverse (3036,22)ATCCAGAGAGTCATACTTGCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.747 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.839 kcal/mol
Reverse Dimers-1.109 kcal/mol
Forward-Reverse Dimers-2.459 kcal/mol
Amplicon Folding0.183 kcal/mol outside primersite
Amplicon SequenceGAAACTGACTTTGAGCTGTACTTTTGTGGACGCAAGCAATTTTTCAAGTCTAACTATGCA
GACCTAGATTCAAACTCAGATGACTTTGACCCTGCTTCCACCAAGAGCAAGTATGACTCT
CTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)1262347 - 2472
 

See below for some more details.

Program Output:

Loading ...