Design Results for PPARGC1A

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 1 To Exon 2 (Pair 1)
Forward (49,21)TGCATGAGTGTGTGCTCTGTGAmplicon SizecDNA: 211 bpgenomic: 5,183
Reverse (259,22)CCAAGTCGTTCACATCTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTCA
TTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGAC
ATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTT
GATCTTTCTGAACTAGATGTGAACGACTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21149 - 259
Exon 1 To Exon 2 (Pair 2)
Forward (44,21)TTGCCTGCATGAGTGTGTGCTAmplicon SizecDNA: 193 bpgenomic: 5,165
Reverse (236,23)GAAAGATCAAGTTCAGGAAGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGG
CGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGA
GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTG
AACTTGATCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)19344 - 236
Exon 1 To Exon 2 (Pair 3)
Forward (48,21)CTGCATGAGTGTGTGCTCTGTAmplicon SizecDNA: 289 bpgenomic: 5,261
Reverse (336,24)CTCATTGTTGTACTGATTGGATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.924 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTC
ATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGA
CATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACT
TGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCAA
GTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)28948 - 336
Exon 1 To Exon 2 (Pair 4)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 222 bpgenomic: 5,194
Reverse (262,23)TATCCAAGTCGTTCACATCTAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.214 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)22241 - 262
Exon 1 To Exon 2 (Pair 5)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 295 bpgenomic: 5,267
Reverse (340,23)AAGGCTCATTGTTGTACTGATTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops2.291 kcal/mol
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.837 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTC
AAGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)29546 - 340
Exon 1 To Exon 2 (Pair 6)
Forward (49,21)TGCATGAGTGTGTGCTCTGTGAmplicon SizecDNA: 292 bpgenomic: 5,264
Reverse (340,23)AAGGCTCATTGTTGTACTGATTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops2.291 kcal/mol
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.379 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTCA
TTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGAC
ATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTT
GATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCAAG
TGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)29249 - 340
Exon 1 To Exon 2 (Pair 7)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 233 bpgenomic: 5,205
Reverse (273,22)AAAGCTGTCTGTATCCAAGTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.452 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-0.716 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)23341 - 273
Exon 1 To Exon 2 (Pair 8)
Forward (48,21)CTGCATGAGTGTGTGCTCTGTAmplicon SizecDNA: 214 bpgenomic: 5,186
Reverse (261,23)ATCCAAGTCGTTCACATCTAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTC
ATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGA
CATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACT
TGATCTTTCTGAACTAGATGTGAACGACTTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21448 - 261
Exon 1 To Exon 2 (Pair 9)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 232 bpgenomic: 5,204
Reverse (272,22)AAGCTGTCTGTATCCAAGTCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.452 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-0.716 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)23241 - 272
Exon 1 To Exon 2 (Pair 10)
Forward (44,21)TTGCCTGCATGAGTGTGTGCTAmplicon SizecDNA: 218 bpgenomic: 5,190
Reverse (261,23)ATCCAAGTCGTTCACATCTAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGG
CGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGA
GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTG
AACTTGATCTTTCTGAACTAGATGTGAACGACTTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21844 - 261
Exon 1 To Exon 2 (Pair 11)
Forward (49,21)TGCATGAGTGTGTGCTCTGTGAmplicon SizecDNA: 289 bpgenomic: 5,261
Reverse (337,23)GCTCATTGTTGTACTGATTGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.924 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.301 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTCA
TTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGAC
ATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTT
GATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCAAG
TGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)28949 - 337
Exon 1 To Exon 2 (Pair 12)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 214 bpgenomic: 5,186
Reverse (259,22)CCAAGTCGTTCACATCTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CTTGATCTTTCTGAACTAGATGTGAACGACTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21446 - 259
Exon 1 To Exon 2 (Pair 13)
Forward (48,21)CTGCATGAGTGTGTGCTCTGTAmplicon SizecDNA: 212 bpgenomic: 5,184
Reverse (259,22)CCAAGTCGTTCACATCTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTC
ATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGA
CATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACT
TGATCTTTCTGAACTAGATGTGAACGACTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21248 - 259
Exon 1 To Exon 2 (Pair 14)
Forward (44,21)TTGCCTGCATGAGTGTGTGCTAmplicon SizecDNA: 216 bpgenomic: 5,188
Reverse (259,22)CCAAGTCGTTCACATCTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGG
CGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGA
GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTG
AACTTGATCTTTCTGAACTAGATGTGAACGACTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21644 - 259
Exon 1 To Exon 2 (Pair 15)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 180 bpgenomic: 5,152
Reverse (225,22)TTCAGGAAGATCTGGGCAAAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.987 kcal/mol
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)18046 - 225
Exon 1 To Exon 2 (Pair 16)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 229 bpgenomic: 5,201
Reverse (269,22)CTGTCTGTATCCAAGTCGTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.89 kcal/mol in 3' area
Reverse Dimers0.382 kcal/mol in 3' area
Forward-Reverse Dimers-0.645 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)22941 - 269
Exon 1 To Exon 2 (Pair 17)
Forward (44,21)TTGCCTGCATGAGTGTGTGCTAmplicon SizecDNA: 293 bpgenomic: 5,265
Reverse (336,24)CTCATTGTTGTACTGATTGGATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.924 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGG
CGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGA
GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTG
AACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGAC
TCAAGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)29344 - 336
Exon 1 To Exon 2 (Pair 18)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 234 bpgenomic: 5,206
Reverse (274,22)GAAAGCTGTCTGTATCCAAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.452 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-0.716 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)23441 - 274
Exon 1 To Exon 2 (Pair 19)
Forward (49,21)TGCATGAGTGTGTGCTCTGTGAmplicon SizecDNA: 213 bpgenomic: 5,185
Reverse (261,23)ATCCAAGTCGTTCACATCTAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTCA
TTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGAC
ATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTT
GATCTTTCTGAACTAGATGTGAACGACTTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21349 - 261
Exon 1 To Exon 2 (Pair 20)
Forward (49,21)TGCATGAGTGTGTGCTCTGTGAmplicon SizecDNA: 223 bpgenomic: 5,195
Reverse (271,22)AGCTGTCTGTATCCAAGTCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.993 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-1.339 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTCA
TTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGAC
ATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTT
GATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)22349 - 271
Exon 1 To Exon 2 (Pair 21)
Forward (131,21)ACATGTGCAACCAGGACTCTGAmplicon SizecDNA: 129 bpgenomic: 5,101
Reverse (259,22)CCAAGTCGTTCACATCTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers-2.36 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGACATCGAGTGTGCTGCTCTGGTTG
GTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGATGTGA
ACGACTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)129131 - 259
Exon 1 To Exon 2 (Pair 22)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 234 bpgenomic: 5,206
Reverse (340,23)AAGGCTCATTGTTGTACTGATTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops2.291 kcal/mol
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.216 kcal/mol
Amplicon Folding-1.187 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAAC
TTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCA
AGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)234107 - 340
Exon 1 To Exon 2 (Pair 23)
Forward (48,21)CTGCATGAGTGTGTGCTCTGTAmplicon SizecDNA: 290 bpgenomic: 5,262
Reverse (337,23)GCTCATTGTTGTACTGATTGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.924 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.301 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTC
ATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGA
CATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACT
TGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCAA
GTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)29048 - 337
Exon 1 To Exon 2 (Pair 24)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 122 bpgenomic: 5,094
Reverse (228,22)AAGTTCAGGAAGATCTGGGCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.747 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-0.997 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAAC
TT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)122107 - 228
Exon 1 To Exon 2 (Pair 25)
Forward (131,21)ACATGTGCAACCAGGACTCTGAmplicon SizecDNA: 132 bpgenomic: 5,104
Reverse (262,23)TATCCAAGTCGTTCACATCTAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers-2.36 kcal/mol
Reverse Loops1.214 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGACATCGAGTGTGCTGCTCTGGTTG
GTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGATGTGA
ACGACTTGGATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)132131 - 262
Exon 1 To Exon 2 (Pair 26)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 130 bpgenomic: 5,102
Reverse (236,23)GAAAGATCAAGTTCAGGAAGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-1.251 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAAC
TTGATCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)130107 - 236
Exon 1 To Exon 2 (Pair 27)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 191 bpgenomic: 5,163
Reverse (236,23)GAAAGATCAAGTTCAGGAAGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CTTGATCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)19146 - 236
Exon 1 To Exon 2 (Pair 28)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 165 bpgenomic: 5,137
Reverse (271,22)AGCTGTCTGTATCCAAGTCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.993 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-2.628 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAAC
TTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)165107 - 271
Exon 1 To Exon 2 (Pair 29)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 119 bpgenomic: 5,091
Reverse (225,22)TTCAGGAAGATCTGGGCAAAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.987 kcal/mol
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-0.997 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)119107 - 225
Exon 1 To Exon 2 (Pair 30)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 183 bpgenomic: 5,155
Reverse (228,22)AAGTTCAGGAAGATCTGGGCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.747 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)18346 - 228
Exon 1 To Exon 2 (Pair 31)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 231 bpgenomic: 5,203
Reverse (337,23)GCTCATTGTTGTACTGATTGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.924 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.908 kcal/mol
Amplicon Folding-1.187 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAAC
TTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCA
AGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)231107 - 337
Exon 1 To Exon 2 (Pair 32)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 196 bpgenomic: 5,168
Reverse (236,23)GAAAGATCAAGTTCAGGAAGATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.562 kcal/mol in 3' area
Reverse Dimers-0.806 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)19641 - 236
Exon 1 To Exon 2 (Pair 33)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 216 bpgenomic: 5,188
Reverse (261,23)ATCCAAGTCGTTCACATCTAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CTTGATCTTTCTGAACTAGATGTGAACGACTTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21646 - 261
Exon 1 To Exon 2 (Pair 34)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 292 bpgenomic: 5,264
Reverse (337,23)GCTCATTGTTGTACTGATTGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.924 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.301 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTC
AAGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)29246 - 337
Exon 1 To Exon 2 (Pair 35)
Forward (48,21)CTGCATGAGTGTGTGCTCTGTAmplicon SizecDNA: 293 bpgenomic: 5,265
Reverse (340,23)AAGGCTCATTGTTGTACTGATTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops2.291 kcal/mol
Reverse Dimers-2.633 kcal/mol
Forward-Reverse Dimers-2.379 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTC
ATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGA
CATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACT
TGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCAA
GTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGCCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)29348 - 340
Exon 1 To Exon 2 (Pair 36)
Forward (49,21)TGCATGAGTGTGTGCTCTGTGAmplicon SizecDNA: 226 bpgenomic: 5,198
Reverse (274,22)GAAAGCTGTCTGTATCCAAGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.452 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTCA
TTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGAC
ATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTT
GATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)22649 - 274
Exon 1 To Exon 2 (Pair 37)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 217 bpgenomic: 5,189
Reverse (262,23)TATCCAAGTCGTTCACATCTAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.214 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CTTGATCTTTCTGAACTAGATGTGAACGACTTGGATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21746 - 262
Exon 1 To Exon 2 (Pair 38)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 228 bpgenomic: 5,200
Reverse (268,22)TGTCTGTATCCAAGTCGTTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.89 kcal/mol in 3' area
Reverse Dimers0.25 kcal/mol in 3' area
Forward-Reverse Dimers-0.645 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)22841 - 268
Exon 1 To Exon 2 (Pair 39)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 296 bpgenomic: 5,268
Reverse (336,24)CTCATTGTTGTACTGATTGGATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.924 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTG
GACTCAAGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)29641 - 336
Exon 1 To Exon 2 (Pair 40)
Forward (49,21)TGCATGAGTGTGTGCTCTGTGAmplicon SizecDNA: 224 bpgenomic: 5,196
Reverse (272,22)AAGCTGTCTGTATCCAAGTCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.452 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTCA
TTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGAC
ATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTT
GATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)22449 - 272
Exon 1 To Exon 2 (Pair 41)
Forward (49,21)TGCATGAGTGTGTGCTCTGTGAmplicon SizecDNA: 221 bpgenomic: 5,193
Reverse (269,22)CTGTCTGTATCCAAGTCGTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.89 kcal/mol in 3' area
Reverse Dimers0.382 kcal/mol in 3' area
Forward-Reverse Dimers-0.453 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTCA
TTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGAC
ATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTT
GATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)22149 - 269
Exon 1 To Exon 2 (Pair 42)
Forward (44,21)TTGCCTGCATGAGTGTGTGCTAmplicon SizecDNA: 294 bpgenomic: 5,266
Reverse (337,23)GCTCATTGTTGTACTGATTGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.924 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.301 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGG
CGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGA
GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTG
AACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGAC
TCAAGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)29444 - 337
Exon 1 To Exon 2 (Pair 43)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 291 bpgenomic: 5,263
Reverse (336,24)CTCATTGTTGTACTGATTGGATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.924 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTC
AAGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)29146 - 336
Exon 1 To Exon 2 (Pair 44)
Forward (48,21)CTGCATGAGTGTGTGCTCTGTAmplicon SizecDNA: 215 bpgenomic: 5,187
Reverse (262,23)TATCCAAGTCGTTCACATCTAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.214 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTC
ATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGA
CATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACT
TGATCTTTCTGAACTAGATGTGAACGACTTGGATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21548 - 262
Exon 1 To Exon 2 (Pair 45)
Forward (49,21)TGCATGAGTGTGTGCTCTGTGAmplicon SizecDNA: 225 bpgenomic: 5,197
Reverse (273,22)AAAGCTGTCTGTATCCAAGTCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.452 kcal/mol
Reverse Dimers-2.688 kcal/mol
Forward-Reverse Dimers-1.88 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTCA
TTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGAC
ATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTT
GATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)22549 - 273
Exon 1 To Exon 2 (Pair 46)
Forward (46,20)GCCTGCATGAGTGTGTGCTCAmplicon SizecDNA: 182 bpgenomic: 5,154
Reverse (227,22)AGTTCAGGAAGATCTGGGCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.747 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.588 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCG
TCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGT
GACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAA
CT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)18246 - 227
Exon 1 To Exon 2 (Pair 47)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 230 bpgenomic: 5,202
Reverse (336,24)CTCATTGTTGTACTGATTGGATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.924 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-1.187 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAAC
TTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCA
AGTGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)230107 - 336
Exon 1 To Exon 2 (Pair 48)
Forward (49,21)TGCATGAGTGTGTGCTCTGTGAmplicon SizecDNA: 288 bpgenomic: 5,260
Reverse (336,24)CTCATTGTTGTACTGATTGGATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.924 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-2.532 kcal/mol outside primersite
Amplicon SequenceTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTCA
TTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGAC
ATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTT
GATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCTTTCTGGGTGGACTCAAG
TGGTGCAGTGACCAATCAGAAATAATATCCAATCAGTACAACAATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)28849 - 336
Exon 1 To Exon 2 (Pair 49)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 221 bpgenomic: 5,193
Reverse (261,23)ATCCAAGTCGTTCACATCTAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)22141 - 261
Exon 1 To Exon 2 (Pair 50)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 231 bpgenomic: 5,203
Reverse (271,22)AGCTGTCTGTATCCAAGTCGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.993 kcal/mol
Reverse Dimers-1.606 kcal/mol
Forward-Reverse Dimers-0.716 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATACAGACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)23141 - 271
Exon 1 To Exon 2 (Pair 51)
Forward (49,21)TGCATGAGTGTGTGCTCTGTGAmplicon SizecDNA: 214 bpgenomic: 5,186
Reverse (262,23)TATCCAAGTCGTTCACATCTAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.171 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.214 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGGCGTCA
TTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGAC
ATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTT
GATCTTTCTGAACTAGATGTGAACGACTTGGATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21449 - 262
Exon 1 To Exon 2 (Pair 52)
Forward (44,21)TTGCCTGCATGAGTGTGTGCTAmplicon SizecDNA: 219 bpgenomic: 5,191
Reverse (262,23)TATCCAAGTCGTTCACATCTAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.214 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGACTGG
CGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGA
GTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTG
AACTTGATCTTTCTGAACTAGATGTGAACGACTTGGATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21944 - 262
Exon 1 To Exon 2 (Pair 53)
Forward (41,21)TGGTTGCCTGCATGAGTGTGTAmplicon SizecDNA: 219 bpgenomic: 5,191
Reverse (259,22)CCAAGTCGTTCACATCTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-1.607 kcal/mol
Amplicon Folding-2.304 kcal/mol outside primersite
Amplicon SequenceTGGTTGCCTGCATGAGTGTGTGCTCTGTGTCACTGTGGATTGGAGTTGAAAAAGCTTGAC
TGGCGTCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTAT
GGAGTGACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTC
CTGAACTTGATCTTTCTGAACTAGATGTGAACGACTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)21941 - 259
Exon 1 To Exon 2 (Pair 54)
Forward (107,20)CATTCAGGAGCTGGATGGCGAmplicon SizecDNA: 121 bpgenomic: 5,093
Reverse (227,22)AGTTCAGGAAGATCTGGGCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.747 kcal/mol in 3' area
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-0.997 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceCATTCAGGAGCTGGATGGCGTGGGACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTG
ACATCGAGTGTGCTGCTCTGGTTGGTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAAC
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)121107 - 227
Exon 1 To Exon 2 (Pair 55)
Forward (131,21)ACATGTGCAACCAGGACTCTGAmplicon SizecDNA: 131 bpgenomic: 5,103
Reverse (261,23)ATCCAAGTCGTTCACATCTAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.326 kcal/mol in 3' area
Forward Dimers-2.36 kcal/mol
Reverse Loops0.709 kcal/mol in 3' area
Reverse Dimers-0.172 kcal/mol
Forward-Reverse Dimers-2.534 kcal/mol
Amplicon Folding-0.959 kcal/mol outside primersite
Amplicon SequenceACATGTGCAACCAGGACTCTGAGTCTGTATGGAGTGACATCGAGTGTGCTGCTCTGGTTG
GTGAAGACCAGCCTCTTTGCCCAGATCTTCCTGAACTTGATCTTTCTGAACTAGATGTGA
ACGACTTGGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)131131 - 261
Exon 5 To Exon 6 (Pair 1)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 226 bpgenomic: 1,084
Reverse (1389,22)TTTGTCTCTGCTGCTGTTTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGCA
AAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACCC
TCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)226600 - 825
Exon 5 To Exon 6 (Pair 2)
Forward (1160,22)ATGAATGCAGTGGTCTCAGTACAmplicon SizecDNA: 211 bpgenomic: 1,069
Reverse (1370,21)CTGTTCTCTGTGGGTTTGGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops2.489 kcal/mol
Reverse Dimers1.586 kcal/mol
Forward-Reverse Dimers-0.511 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAA
ACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAAC
AGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATG
ACCCTCCTCACACCAAACCCACAGAGAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)211596 - 806
Exon 5 To Exon 6 (Pair 3)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 108 bpgenomic: 966
Reverse (1271,23)ATACTCTTCGCTTTATTGCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.888 kcal/mol in 3' area
Reverse Dimers0.016 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)108600 - 707
Exon 5 To Exon 6 (Pair 4)
Forward (1160,22)ATGAATGCAGTGGTCTCAGTACAmplicon SizecDNA: 213 bpgenomic: 1,071
Reverse (1372,22)TTCTGTTCTCTGTGGGTTTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops2.489 kcal/mol
Reverse Dimers1.586 kcal/mol
Forward-Reverse Dimers-0.511 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAA
ACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAAC
AGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATG
ACCCTCCTCACACCAAACCCACAGAGAACAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)213596 - 808
Exon 5 To Exon 6 (Pair 5)
Forward (1162,21)GAATGCAGTGGTCTCAGTACCAmplicon SizecDNA: 164 bpgenomic: 1,022
Reverse (1325,22)AGATATTTGAGAAGCTCCGAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops0.934 kcal/mol in 3' area
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-1.588 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAAC
CCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAG
CAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)164598 - 761
Exon 5 To Exon 6 (Pair 6)
Forward (1160,22)ATGAATGCAGTGGTCTCAGTACAmplicon SizecDNA: 209 bpgenomic: 1,067
Reverse (1368,21)GTTCTCTGTGGGTTTGGTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops2.489 kcal/mol
Reverse Dimers1.586 kcal/mol
Forward-Reverse Dimers-0.511 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAA
ACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAAC
AGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATG
ACCCTCCTCACACCAAACCCACAGAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)209596 - 804
Exon 5 To Exon 6 (Pair 7)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 72 bpgenomic: 930
Reverse (1270,23)TACTCTTCGCTTTATTGCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.888 kcal/mol
Reverse Dimers0.016 kcal/mol
Forward-Reverse Dimers-1.206 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)72635 - 706
Exon 5 To Exon 6 (Pair 8)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 228 bpgenomic: 1,086
Reverse (1426,20)ACTGCGACTGTGTGTGGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.349 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCA
GCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)228635 - 862
Exon 5 To Exon 6 (Pair 9)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 162 bpgenomic: 1,020
Reverse (1325,22)AGATATTTGAGAAGCTCCGAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops0.934 kcal/mol in 3' area
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-1.588 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGCA
AAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)162600 - 761
Exon 5 To Exon 6 (Pair 10)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 229 bpgenomic: 1,087
Reverse (1392,22)GCATTTGTCTCTGCTGCTGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGCA
AAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACCC
TCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)229600 - 828
Exon 5 To Exon 6 (Pair 11)
Forward (1163,21)AATGCAGTGGTCTCAGTACCCAmplicon SizecDNA: 221 bpgenomic: 1,079
Reverse (1383,22)TCTGCTGCTGTTTCTGTTCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACC
CTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGC
AAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACC
CTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)221599 - 819
Exon 5 To Exon 6 (Pair 12)
Forward (1160,22)ATGAATGCAGTGGTCTCAGTACAmplicon SizecDNA: 229 bpgenomic: 1,087
Reverse (1388,22)TTGTCTCTGCTGCTGTTTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAA
ACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAAC
AGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATG
ACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)229596 - 824
Exon 5 To Exon 6 (Pair 13)
Forward (1162,21)GAATGCAGTGGTCTCAGTACCAmplicon SizecDNA: 231 bpgenomic: 1,089
Reverse (1392,22)GCATTTGTCTCTGCTGCTGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.841 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAAC
CCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAG
CAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGAC
CCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)231598 - 828
Exon 5 To Exon 6 (Pair 14)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 224 bpgenomic: 1,082
Reverse (1422,21)CGACTGTGTGTGGGACTTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-0.78 kcal/mol
Forward-Reverse Dimers-2.349 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCA
GCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)224635 - 858
Exon 5 To Exon 6 (Pair 15)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 225 bpgenomic: 1,083
Reverse (1388,22)TTGTCTCTGCTGCTGTTTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGCA
AAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACCC
TCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)225600 - 824
Exon 5 To Exon 6 (Pair 16)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 162 bpgenomic: 1,020
Reverse (1360,20)TGGGTTTGGTGTGAGGAGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers1.193 kcal/mol in 3' area
Forward-Reverse Dimers-1.822 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)162635 - 796
Exon 5 To Exon 7 (Pair 1)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 276 bpgenomic: 5,025
Reverse (1474,22)GGGTCAGAGGAAGAGATAAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.9 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-0.885 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCA
GCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAGTCACAACACTTAC
AAGCCAAACCAACAACTTTATCTCTTCCTCTGACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)276635 - 910
Exon 5 To Exon 6 (Pair 17)
Forward (1163,21)AATGCAGTGGTCTCAGTACCCAmplicon SizecDNA: 230 bpgenomic: 1,088
Reverse (1392,22)GCATTTGTCTCTGCTGCTGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.374 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACC
CTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGC
AAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACC
CTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)230599 - 828
Exon 5 To Exon 6 (Pair 18)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 231 bpgenomic: 1,089
Reverse (1429,20)GTGACTGCGACTGTGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.021 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.349 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCA
GCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAGTCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)231635 - 865
Exon 5 To Exon 6 (Pair 19)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 73 bpgenomic: 931
Reverse (1271,23)ATACTCTTCGCTTTATTGCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.888 kcal/mol in 3' area
Reverse Dimers0.016 kcal/mol
Forward-Reverse Dimers-1.206 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)73635 - 707
Exon 5 To Exon 6 (Pair 20)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 218 bpgenomic: 1,076
Reverse (1381,22)TGCTGCTGTTTCTGTTCTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGCA
AAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACCC
TCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)218600 - 817
Exon 5 To Exon 6 (Pair 21)
Forward (1202,22)ATCACAGGATCAGAACAAACCCAmplicon SizecDNA: 176 bpgenomic: 1,034
Reverse (1377,21)GCTGTTTCTGTTCTCTGTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.285 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.489 kcal/mol in 3' area
Reverse Dimers0.612 kcal/mol
Forward-Reverse Dimers-2.889 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAG
CGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAAT
ATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)176638 - 813
Exon 5 To Exon 6 (Pair 22)
Forward (1202,22)ATCACAGGATCAGAACAAACCCAmplicon SizecDNA: 225 bpgenomic: 1,083
Reverse (1426,20)ACTGCGACTGTGTGTGGGACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.285 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.349 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAG
CGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAAT
ATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCA
GAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)225638 - 862
Exon 5 To Exon 6 (Pair 23)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 166 bpgenomic: 1,024
Reverse (1364,21)TCTGTGGGTTTGGTGTGAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.672 kcal/mol
Reverse Dimers0.26 kcal/mol in 3' area
Forward-Reverse Dimers-2.261 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)166635 - 800
Exon 5 To Exon 6 (Pair 24)
Forward (1202,22)ATCACAGGATCAGAACAAACCCAmplicon SizecDNA: 222 bpgenomic: 1,080
Reverse (1423,20)GCGACTGTGTGTGGGACTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.285 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.349 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAG
CGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAAT
ATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCA
GAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)222638 - 859
Exon 5 To Exon 6 (Pair 25)
Forward (1160,22)ATGAATGCAGTGGTCTCAGTACAmplicon SizecDNA: 264 bpgenomic: 1,122
Reverse (1423,20)GCGACTGTGTGTGGGACTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.128 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAA
ACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAAC
AGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATG
ACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCA
AAAAGAAGTCCCACACACAGTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)264596 - 859
Exon 5 To Exon 6 (Pair 26)
Forward (1163,21)AATGCAGTGGTCTCAGTACCCAmplicon SizecDNA: 219 bpgenomic: 1,077
Reverse (1381,22)TGCTGCTGTTTCTGTTCTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACC
CTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGC
AAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACC
CTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)219599 - 817
Exon 5 To Exon 6 (Pair 27)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 161 bpgenomic: 1,019
Reverse (1359,20)GGGTTTGGTGTGAGGAGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers1.193 kcal/mol in 3' area
Forward-Reverse Dimers-1.822 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)161635 - 795
Exon 5 To Exon 6 (Pair 28)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 74 bpgenomic: 932
Reverse (1272,23)AATACTCTTCGCTTTATTGCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.888 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)74635 - 708
Exon 5 To Exon 6 (Pair 29)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 107 bpgenomic: 965
Reverse (1270,23)TACTCTTCGCTTTATTGCTCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.888 kcal/mol
Reverse Dimers0.016 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)107600 - 706
Exon 5 To Exon 6 (Pair 30)
Forward (1163,21)AATGCAGTGGTCTCAGTACCCAmplicon SizecDNA: 223 bpgenomic: 1,081
Reverse (1385,22)TCTCTGCTGCTGTTTCTGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACC
CTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGC
AAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACC
CTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)223599 - 821
Exon 5 To Exon 6 (Pair 31)
Forward (1162,21)GAATGCAGTGGTCTCAGTACCAmplicon SizecDNA: 165 bpgenomic: 1,023
Reverse (1326,22)CAGATATTTGAGAAGCTCCGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.735 kcal/mol
Reverse Dimers-2.912 kcal/mol
Forward-Reverse Dimers-1.588 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAAC
CCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAG
CAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)165598 - 762
Exon 5 To Exon 6 (Pair 32)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 228 bpgenomic: 1,086
Reverse (1391,22)CATTTGTCTCTGCTGCTGTTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGCA
AAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACCC
TCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)228600 - 827
Exon 5 To Exon 6 (Pair 33)
Forward (1160,22)ATGAATGCAGTGGTCTCAGTACAmplicon SizecDNA: 266 bpgenomic: 1,124
Reverse (1425,20)CTGCGACTGTGTGTGGGACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.128 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAA
ACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAAC
AGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATG
ACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCA
AAAAGAAGTCCCACACACAGTCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)266596 - 861
Exon 5 To Exon 6 (Pair 34)
Forward (1160,22)ATGAATGCAGTGGTCTCAGTACAmplicon SizecDNA: 224 bpgenomic: 1,082
Reverse (1383,22)TCTGCTGCTGTTTCTGTTCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAA
ACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAAC
AGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATG
ACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)224596 - 819
Exon 5 To Exon 6 (Pair 35)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 163 bpgenomic: 1,021
Reverse (1361,20)GTGGGTTTGGTGTGAGGAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops2.79 kcal/mol
Reverse Dimers1.193 kcal/mol in 3' area
Forward-Reverse Dimers-1.822 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)163635 - 797
Exon 5 To Exon 6 (Pair 36)
Forward (1160,22)ATGAATGCAGTGGTCTCAGTACAmplicon SizecDNA: 222 bpgenomic: 1,080
Reverse (1381,22)TGCTGCTGTTTCTGTTCTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAA
ACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAAC
AGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATG
ACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)222596 - 817
Exon 5 To Exon 6 (Pair 37)
Forward (1162,21)GAATGCAGTGGTCTCAGTACCAmplicon SizecDNA: 228 bpgenomic: 1,086
Reverse (1389,22)TTTGTCTCTGCTGCTGTTTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAAC
CCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAG
CAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGAC
CCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)228598 - 825
Exon 5 To Exon 6 (Pair 38)
Forward (1202,22)ATCACAGGATCAGAACAAACCCAmplicon SizecDNA: 228 bpgenomic: 1,086
Reverse (1429,20)GTGACTGCGACTGTGTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.285 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.021 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.349 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAG
CGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAAT
ATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCA
GAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAGTCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)228638 - 865
Exon 5 To Exon 6 (Pair 39)
Forward (1163,21)AATGCAGTGGTCTCAGTACCCAmplicon SizecDNA: 226 bpgenomic: 1,084
Reverse (1388,22)TTGTCTCTGCTGCTGTTTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACC
CTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGC
AAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACC
CTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)226599 - 824
Exon 5 To Exon 6 (Pair 40)
Forward (1163,21)AATGCAGTGGTCTCAGTACCCAmplicon SizecDNA: 229 bpgenomic: 1,087
Reverse (1391,22)CATTTGTCTCTGCTGCTGTTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACC
CTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGC
AAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACC
CTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)229599 - 827
Exon 5 To Exon 6 (Pair 41)
Forward (1162,21)GAATGCAGTGGTCTCAGTACCAmplicon SizecDNA: 264 bpgenomic: 1,122
Reverse (1425,20)CTGCGACTGTGTGTGGGACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.021 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.128 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAAC
CCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAG
CAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGAC
CCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACAAATGCACCTCCAAA
AAGAAGTCCCACACACAGTCGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)264598 - 861
Exon 5 To Exon 6 (Pair 42)
Forward (1162,21)GAATGCAGTGGTCTCAGTACCAmplicon SizecDNA: 226 bpgenomic: 1,084
Reverse (1387,22)TGTCTCTGCTGCTGTTTCTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.4 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceGAATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAAC
CCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAG
CAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGAC
CCTCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGAGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)226598 - 823
Exon 5 To Exon 6 (Pair 43)
Forward (1164,21)ATGCAGTGGTCTCAGTACCCAAmplicon SizecDNA: 220 bpgenomic: 1,078
Reverse (1383,22)TCTGCTGCTGTTTCTGTTCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.35 kcal/mol in 3' area
Forward Dimers-1.674 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.236 kcal/mol
Amplicon Folding0.196 kcal/mol outside primersite
Amplicon SequenceATGCAGTGGTCTCAGTACCCAGAACCATGCAAATCACAATCACAGGATCAGAACAAACCC
TGCAATTGTTAAGACTGAGAATTCATGGAGCAATAAAGCGAAGAGTATTTGTCAACAGCA
AAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCAAATATCTGACCACAAACGATGACCC
TCCTCACACCAAACCCACAGAGAACAGAAACAGCAGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)220600 - 819
Exon 5 To Exon 6 (Pair 44)
Forward (1199,23)ACAATCACAGGATCAGAACAAACAmplicon SizecDNA: 239 bpgenomic: 1,097
Reverse (1437,22)TAAGTGTTGTGACTGCGACTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.744 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.297 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.919 kcal/mol
Amplicon Folding0.335 kcal/mol inside primersite
Amplicon SequenceACAATCACAGGATCAGAACAAACCCTGCAATTGTTAAGACTGAGAATTCATGGAGCAATA
AAGCGAAGAGTATTTGTCAACAGCAAAAGCCACAAAGACGTCCCTGCTCGGAGCTTCTCA
AATATCTGACCACAAACGATGACCCTCCTCACACCAAACCCACAGAGAACAGAAACAGCA
GCAGAGACAAATGCACCTCCAAAAAGAAGTCCCACACACAGTCGCAGTCACAACACTTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013261 (PPARGC1A)239635 - 873
 

See below for some more details.

Program Output:

Loading ...