Design Results for PQBP1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size400
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (464,21)CCTAGGTCTGTCTGCTATCAGAmplicon SizecDNA: 147 bpgenomic: 2,754
Reverse (610,21)CCTCGTAGTCCACAGGATCATNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.31 kcal/mol in 3' area
Forward Dimers-1.74 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCA
AGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACT
ATGACGATGATCCTGTGGACTACGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001032384 (PQBP1)14292 - 233
NM_144495 (PQBP1)143171 - 313
NM_001167989 (PQBP1)14799 - 245
NM_001167990 (PQBP1)14781 - 227
NM_005710 (PQBP1)147232 - 378
NM_001167992 (PQBP1)1421 - 142
NM_001032382 (PQBP1)143171 - 313
NM_001032383 (PQBP1)143182 - 324
NM_001032381 (PQBP1)14799 - 245
Exon 2 To Exon 3 (Pair 2)
Forward (354,23)TTCATTTGAGTAGATCGGAGTCAAmplicon SizecDNA: 249 bpgenomic: 2,856
Reverse (602,22)TCCACAGGATCATCGTCATAGTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.952 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGG
ATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTG
TCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCAT
CCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGA
TCCTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)249122 - 370
Exon 2 To Exon 3 (Pair 3)
Forward (463,21)CCCTAGGTCTGTCTGCTATCAAmplicon SizecDNA: 113 bpgenomic: 2,720
Reverse (575,22)GCAATGATCTCTTCCTCTGGTTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.362 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCC
AAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001032381 (PQBP1)11299 - 210
NM_001032383 (PQBP1)108182 - 289
NM_001032382 (PQBP1)108171 - 278
NM_005710 (PQBP1)113231 - 343
NM_001167992 (PQBP1)1071 - 107
NM_001167990 (PQBP1)11281 - 192
NM_001167989 (PQBP1)11299 - 210
NM_144495 (PQBP1)108171 - 278
Exon 2 To Exon 3 (Pair 4)
Forward (323,21)AGTGCGTATGTTCTGTCCACCAmplicon SizecDNA: 273 bpgenomic: 2,880
Reverse (595,21)GATCATCGTCATAGTCCTCGGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops2.136 kcal/mol in 3' area
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-0.375 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAG
TACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCTGC
TTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTG
CGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGG
AAGAGATCATTGCCGAGGACTATGACGATGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)27391 - 363
Exon 2 To Exon 3 (Pair 5)
Forward (348,23)TACTGGTTCATTTGAGTAGATCGAmplicon SizecDNA: 258 bpgenomic: 2,865
Reverse (605,22)TAGTCCACAGGATCATCGTCATNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.885 kcal/mol
Forward Dimers-0.935 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.126 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGT
TACGGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTA
GGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAG
AGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGA
CGATGATCCTGTGGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)258116 - 373
Exon 2 To Exon 3 (Pair 6)
Forward (323,21)AGTGCGTATGTTCTGTCCACCAmplicon SizecDNA: 282 bpgenomic: 2,889
Reverse (604,22)AGTCCACAGGATCATCGTCATANr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAG
TACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCTGC
TTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTG
CGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGG
AAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)28291 - 372
Exon 2 To Exon 3 (Pair 7)
Forward (323,21)AGTGCGTATGTTCTGTCCACCAmplicon SizecDNA: 288 bpgenomic: 2,895
Reverse (610,21)CCTCGTAGTCCACAGGATCATNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAG
TACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCTGC
TTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTG
CGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGG
AAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTACGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)28891 - 378
Exon 2 To Exon 3 (Pair 8)
Forward (437,22)AGCTGCTTGTCAGTTTGTTCGTAmplicon SizecDNA: 160 bpgenomic: 2,767
Reverse (596,21)GGATCATCGTCATAGTCCTCGNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.769 kcal/mol
Forward Dimers-2.888 kcal/mol
Reverse Loops2.189 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.138 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGC
CCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAAC
CAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)160205 - 364
Exon 2 To Exon 3 (Pair 9)
Forward (364,22)TAGATCGGAGTCAGATGAGTACAmplicon SizecDNA: 216 bpgenomic: 2,823
Reverse (579,21)CTCGGCAATGATCTCTTCCTCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAG
GAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCA
GCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACAT
CTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)216132 - 347
Exon 2 To Exon 3 (Pair 10)
Forward (437,22)AGCTGCTTGTCAGTTTGTTCGTAmplicon SizecDNA: 146 bpgenomic: 2,753
Reverse (582,21)GTCCTCGGCAATGATCTCTTCNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.769 kcal/mol
Forward Dimers-2.888 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.067 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGC
CCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAAC
CAGAGGAAGAGATCATTGCCGAGGAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)146205 - 350
Exon 2 To Exon 3 (Pair 11)
Forward (366,22)GATCGGAGTCAGATGAGTACATAmplicon SizecDNA: 231 bpgenomic: 2,838
Reverse (596,21)GGATCATCGTCATAGTCCTCGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.207 kcal/mol in 3' area
Forward Dimers-1.838 kcal/mol
Reverse Loops2.189 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.497 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGA
ATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGC
TATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCT
GGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)231134 - 364
Exon 2 To Exon 3 (Pair 12)
Forward (354,23)TTCATTTGAGTAGATCGGAGTCAAmplicon SizecDNA: 241 bpgenomic: 2,848
Reverse (594,21)ATCATCGTCATAGTCCTCGGCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops2.121 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.564 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGG
ATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTG
TCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCAT
CCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGA
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)241122 - 362
Exon 2 To Exon 3 (Pair 13)
Forward (412,23)GGATCCAGATAGGAATCTTTATCAmplicon SizecDNA: 196 bpgenomic: 2,803
Reverse (607,21)CGTAGTCCACAGGATCATCGTNr. of Isoforms 4 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.113 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.569 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTC
TGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGC
ATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGAT
GATCCTGTGGACTACG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)196180 - 375
Exon 2 To Exon 3 (Pair 14)
Forward (365,22)AGATCGGAGTCAGATGAGTACAAmplicon SizecDNA: 238 bpgenomic: 2,845
Reverse (602,22)TCCACAGGATCATCGTCATAGTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.497 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGG
AATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAG
CTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATC
TGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)238133 - 370
Exon 2 To Exon 3 (Pair 15)
Forward (295,23)ATATTGCCACCTACCTCTTACATAmplicon SizecDNA: 313 bpgenomic: 2,920
Reverse (607,21)CGTAGTCCACAGGATCATCGTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.531 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceATATTGCCACCTACCTCTTACATCTTTTAGTGCGTATGTTCTGTCCACCCAGCTACTGGT
TCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGA
TCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGT
CTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATC
CTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGAT
CCTGTGGACTACG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001032384 (PQBP1)16863 - 230
NM_005710 (PQBP1)31363 - 375
Exon 2 To Exon 3 (Pair 16)
Forward (356,22)CATTTGAGTAGATCGGAGTCAGAmplicon SizecDNA: 250 bpgenomic: 2,857
Reverse (605,22)TAGTCCACAGGATCATCGTCATNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.952 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGAT
CCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTC
TGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCC
TCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATC
CTGTGGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)250124 - 373
Exon 2 To Exon 3 (Pair 17)
Forward (323,21)AGTGCGTATGTTCTGTCCACCAmplicon SizecDNA: 259 bpgenomic: 2,866
Reverse (581,21)TCCTCGGCAATGATCTCTTCCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-0.899 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAG
TACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCTGC
TTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTG
CGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGG
AAGAGATCATTGCCGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)25991 - 349
Exon 2 To Exon 3 (Pair 18)
Forward (323,21)AGTGCGTATGTTCTGTCCACCAmplicon SizecDNA: 258 bpgenomic: 2,865
Reverse (580,21)CCTCGGCAATGATCTCTTCCTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-0.899 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAG
TACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCTGC
TTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTG
CGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGG
AAGAGATCATTGCCGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)25891 - 348
Exon 2 To Exon 3 (Pair 19)
Forward (295,23)ATATTGCCACCTACCTCTTACATAmplicon SizecDNA: 312 bpgenomic: 2,919
Reverse (606,21)GTAGTCCACAGGATCATCGTCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.531 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceATATTGCCACCTACCTCTTACATCTTTTAGTGCGTATGTTCTGTCCACCCAGCTACTGGT
TCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGA
TCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGT
CTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATC
CTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGAT
CCTGTGGACTAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)31263 - 374
NM_001032384 (PQBP1)16763 - 229
Exon 2 To Exon 3 (Pair 20)
Forward (323,21)AGTGCGTATGTTCTGTCCACCAmplicon SizecDNA: 260 bpgenomic: 2,867
Reverse (582,21)GTCCTCGGCAATGATCTCTTCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-0.899 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAG
TACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCTGC
TTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTG
CGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGG
AAGAGATCATTGCCGAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)26091 - 350
Exon 2 To Exon 3 (Pair 21)
Forward (323,21)AGTGCGTATGTTCTGTCCACCAmplicon SizecDNA: 285 bpgenomic: 2,892
Reverse (607,21)CGTAGTCCACAGGATCATCGTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAG
TACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCTGC
TTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTG
CGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGG
AAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)28591 - 375
Exon 2 To Exon 3 (Pair 22)
Forward (321,22)TTAGTGCGTATGTTCTGTCCACAmplicon SizecDNA: 265 bpgenomic: 2,872
Reverse (585,22)ATAGTCCTCGGCAATGATCTCTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.101 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTTAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATG
AGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCT
GCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGT
TGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGA
GGAAGAGATCATTGCCGAGGACTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)26589 - 353
Exon 2 To Exon 3 (Pair 23)
Forward (363,22)GTAGATCGGAGTCAGATGAGTAAmplicon SizecDNA: 215 bpgenomic: 2,822
Reverse (577,21)CGGCAATGATCTCTTCCTCTGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops0.654 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATA
GGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATC
AGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACA
TCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)215131 - 345
Exon 2 To Exon 3 (Pair 24)
Forward (323,21)AGTGCGTATGTTCTGTCCACCAmplicon SizecDNA: 283 bpgenomic: 2,890
Reverse (605,22)TAGTCCACAGGATCATCGTCATNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAG
TACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCTGC
TTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTG
CGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGG
AAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)28391 - 373
Exon 2 To Exon 3 (Pair 25)
Forward (348,23)TACTGGTTCATTTGAGTAGATCGAmplicon SizecDNA: 228 bpgenomic: 2,835
Reverse (575,22)GCAATGATCTCTTCCTCTGGTTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.885 kcal/mol
Forward Dimers-0.935 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.362 kcal/mol
Forward-Reverse Dimers-1.81 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGT
TACGGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTA
GGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAG
AGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)228116 - 343
Exon 2 To Exon 3 (Pair 26)
Forward (348,23)TACTGGTTCATTTGAGTAGATCGAmplicon SizecDNA: 255 bpgenomic: 2,862
Reverse (602,22)TCCACAGGATCATCGTCATAGTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.885 kcal/mol
Forward Dimers-0.935 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.955 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGT
TACGGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTA
GGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAG
AGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGA
CGATGATCCTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)255116 - 370
Exon 2 To Exon 3 (Pair 27)
Forward (461,21)GTCCCTAGGTCTGTCTGCTATAmplicon SizecDNA: 144 bpgenomic: 2,751
Reverse (604,22)AGTCCACAGGATCATCGTCATANr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.05 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGG
CCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGG
ACTATGACGATGATCCTGTGGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)144229 - 372
Exon 2 To Exon 3 (Pair 28)
Forward (366,22)GATCGGAGTCAGATGAGTACATAmplicon SizecDNA: 214 bpgenomic: 2,821
Reverse (579,21)CTCGGCAATGATCTCTTCCTCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.207 kcal/mol in 3' area
Forward Dimers-1.838 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGA
ATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGC
TATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCT
GGAGCCTGAACCAGAGGAAGAGATCATTGCCGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)214134 - 347
Exon 2 To Exon 3 (Pair 29)
Forward (461,21)GTCCCTAGGTCTGTCTGCTATAmplicon SizecDNA: 150 bpgenomic: 2,757
Reverse (610,21)CCTCGTAGTCCACAGGATCATNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.05 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGG
CCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGG
ACTATGACGATGATCCTGTGGACTACGAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)150229 - 378
Exon 2 To Exon 3 (Pair 30)
Forward (356,22)CATTTGAGTAGATCGGAGTCAGAmplicon SizecDNA: 247 bpgenomic: 2,854
Reverse (602,22)TCCACAGGATCATCGTCATAGTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.952 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGAT
CCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTC
TGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCC
TCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATC
CTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)247124 - 370
Exon 2 To Exon 3 (Pair 31)
Forward (366,22)GATCGGAGTCAGATGAGTACATAmplicon SizecDNA: 230 bpgenomic: 2,837
Reverse (595,21)GATCATCGTCATAGTCCTCGGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.207 kcal/mol in 3' area
Forward Dimers-1.838 kcal/mol
Reverse Loops2.136 kcal/mol in 3' area
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.497 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGA
ATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGC
TATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCT
GGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)230134 - 363
Exon 2 To Exon 3 (Pair 32)
Forward (365,22)AGATCGGAGTCAGATGAGTACAAmplicon SizecDNA: 217 bpgenomic: 2,824
Reverse (581,21)TCCTCGGCAATGATCTCTTCCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGG
AATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAG
CTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATC
TGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)217133 - 349
Exon 2 To Exon 3 (Pair 33)
Forward (323,21)AGTGCGTATGTTCTGTCCACCAmplicon SizecDNA: 280 bpgenomic: 2,887
Reverse (602,22)TCCACAGGATCATCGTCATAGTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAG
TACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCTGC
TTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTG
CGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGG
AAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)28091 - 370
Exon 2 To Exon 3 (Pair 34)
Forward (352,22)GGTTCATTTGAGTAGATCGGAGAmplicon SizecDNA: 254 bpgenomic: 2,861
Reverse (605,22)TAGTCCACAGGATCATCGTCATNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.952 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGGTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACG
GGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTC
TGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGC
ATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGAT
GATCCTGTGGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)254120 - 373
Exon 2 To Exon 3 (Pair 35)
Forward (366,22)GATCGGAGTCAGATGAGTACATAmplicon SizecDNA: 239 bpgenomic: 2,846
Reverse (604,22)AGTCCACAGGATCATCGTCATANr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.207 kcal/mol in 3' area
Forward Dimers-1.838 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.497 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGA
ATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGC
TATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCT
GGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)239134 - 372
Exon 2 To Exon 3 (Pair 36)
Forward (356,22)CATTTGAGTAGATCGGAGTCAGAmplicon SizecDNA: 251 bpgenomic: 2,858
Reverse (606,21)GTAGTCCACAGGATCATCGTCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.952 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGAT
CCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTC
TGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCC
TCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATC
CTGTGGACTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)251124 - 374
Exon 2 To Exon 3 (Pair 37)
Forward (365,22)AGATCGGAGTCAGATGAGTACAAmplicon SizecDNA: 231 bpgenomic: 2,838
Reverse (595,21)GATCATCGTCATAGTCCTCGGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops2.136 kcal/mol in 3' area
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-1.497 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGG
AATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAG
CTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATC
TGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)231133 - 363
Exon 2 To Exon 3 (Pair 38)
Forward (321,22)TTAGTGCGTATGTTCTGTCCACAmplicon SizecDNA: 264 bpgenomic: 2,871
Reverse (584,22)TAGTCCTCGGCAATGATCTCTTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.101 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTTAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATG
AGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCT
GCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGT
TGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGA
GGAAGAGATCATTGCCGAGGACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)26489 - 352
Exon 2 To Exon 3 (Pair 39)
Forward (348,23)TACTGGTTCATTTGAGTAGATCGAmplicon SizecDNA: 265 bpgenomic: 2,872
Reverse (612,20)GGCCTCGTAGTCCACAGGATNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.885 kcal/mol
Forward Dimers-0.935 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-1.126 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGT
TACGGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTA
GGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAG
AGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGA
CGATGATCCTGTGGACTACGAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)265116 - 380
Exon 2 To Exon 3 (Pair 40)
Forward (321,22)TTAGTGCGTATGTTCTGTCCACAmplicon SizecDNA: 255 bpgenomic: 2,862
Reverse (575,22)GCAATGATCTCTTCCTCTGGTTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.362 kcal/mol
Forward-Reverse Dimers-0.81 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTTAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATG
AGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCT
GCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGT
TGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGA
GGAAGAGATCATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)25589 - 343
Exon 2 To Exon 3 (Pair 41)
Forward (354,23)TTCATTTGAGTAGATCGGAGTCAAmplicon SizecDNA: 222 bpgenomic: 2,829
Reverse (575,22)GCAATGATCTCTTCCTCTGGTTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.362 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGG
ATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTG
TCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCAT
CCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)222122 - 343
Exon 2 To Exon 3 (Pair 42)
Forward (364,22)TAGATCGGAGTCAGATGAGTACAmplicon SizecDNA: 212 bpgenomic: 2,819
Reverse (575,22)GCAATGATCTCTTCCTCTGGTTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.362 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAG
GAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCA
GCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACAT
CTGGAGCCTGAACCAGAGGAAGAGATCATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)212132 - 343
Exon 2 To Exon 3 (Pair 43)
Forward (365,22)AGATCGGAGTCAGATGAGTACAAmplicon SizecDNA: 241 bpgenomic: 2,848
Reverse (605,22)TAGTCCACAGGATCATCGTCATNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.497 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGG
AATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAG
CTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATC
TGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACT
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)241133 - 373
Exon 2 To Exon 3 (Pair 44)
Forward (321,22)TTAGTGCGTATGTTCTGTCCACAmplicon SizecDNA: 275 bpgenomic: 2,882
Reverse (595,21)GATCATCGTCATAGTCCTCGGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops2.136 kcal/mol in 3' area
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-0.375 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTTAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATG
AGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCT
GCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGT
TGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGA
GGAAGAGATCATTGCCGAGGACTATGACGATGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)27589 - 363
Exon 2 To Exon 3 (Pair 45)
Forward (463,21)CCCTAGGTCTGTCTGCTATCAAmplicon SizecDNA: 122 bpgenomic: 2,729
Reverse (584,22)TAGTCCTCGGCAATGATCTCTTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCC
AAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGAC
TA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001032382 (PQBP1)117171 - 287
NM_001032381 (PQBP1)12199 - 219
NM_001032383 (PQBP1)117182 - 298
NM_001167992 (PQBP1)1161 - 116
NM_005710 (PQBP1)122231 - 352
NM_001167990 (PQBP1)12181 - 201
NM_001167989 (PQBP1)12199 - 219
NM_144495 (PQBP1)117171 - 287
Exon 2 To Exon 3 (Pair 46)
Forward (363,22)GTAGATCGGAGTCAGATGAGTAAmplicon SizecDNA: 214 bpgenomic: 2,821
Reverse (576,21)GGCAATGATCTCTTCCTCTGGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops2.112 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATA
GGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATC
AGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACA
TCTGGAGCCTGAACCAGAGGAAGAGATCATTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)214131 - 344
Exon 2 To Exon 3 (Pair 47)
Forward (461,21)GTCCCTAGGTCTGTCTGCTATAmplicon SizecDNA: 146 bpgenomic: 2,753
Reverse (606,21)GTAGTCCACAGGATCATCGTCNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.05 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGG
CCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGG
ACTATGACGATGATCCTGTGGACTAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)146229 - 374
Exon 2 To Exon 3 (Pair 48)
Forward (348,23)TACTGGTTCATTTGAGTAGATCGAmplicon SizecDNA: 235 bpgenomic: 2,842
Reverse (582,21)GTCCTCGGCAATGATCTCTTCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.885 kcal/mol
Forward Dimers-0.935 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.81 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGT
TACGGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTA
GGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAG
AGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)235116 - 350
Exon 2 To Exon 3 (Pair 49)
Forward (462,21)TCCCTAGGTCTGTCTGCTATCAmplicon SizecDNA: 144 bpgenomic: 2,751
Reverse (605,22)TAGTCCACAGGATCATCGTCATNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.05 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGC
CAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGA
CTATGACGATGATCCTGTGGACTA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)144230 - 373
NM_144495 (PQBP1)138171 - 308
NM_001032383 (PQBP1)138182 - 319
NM_001032382 (PQBP1)138171 - 308
Exon 2 To Exon 3 (Pair 50)
Forward (356,22)CATTTGAGTAGATCGGAGTCAGAmplicon SizecDNA: 222 bpgenomic: 2,829
Reverse (577,21)CGGCAATGATCTCTTCCTCTGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops0.654 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGAT
CCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTC
TGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCC
TCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)222124 - 345
Exon 2 To Exon 3 (Pair 51)
Forward (366,22)GATCGGAGTCAGATGAGTACATAmplicon SizecDNA: 237 bpgenomic: 2,844
Reverse (602,22)TCCACAGGATCATCGTCATAGTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.207 kcal/mol in 3' area
Forward Dimers-1.838 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.497 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGA
ATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGC
TATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCT
GGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)237134 - 370
Exon 2 To Exon 3 (Pair 52)
Forward (321,22)TTAGTGCGTATGTTCTGTCCACAmplicon SizecDNA: 261 bpgenomic: 2,868
Reverse (581,21)TCCTCGGCAATGATCTCTTCCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.101 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTTAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATG
AGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCT
GCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGT
TGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGA
GGAAGAGATCATTGCCGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)26189 - 349
Exon 2 To Exon 3 (Pair 53)
Forward (462,21)TCCCTAGGTCTGTCTGCTATCAmplicon SizecDNA: 146 bpgenomic: 2,753
Reverse (607,21)CGTAGTCCACAGGATCATCGTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.05 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGC
CAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGA
CTATGACGATGATCCTGTGGACTACG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001032383 (PQBP1)140182 - 321
NM_001032382 (PQBP1)140171 - 310
NM_005710 (PQBP1)146230 - 375
NM_144495 (PQBP1)140171 - 310
Exon 2 To Exon 3 (Pair 54)
Forward (356,22)CATTTGAGTAGATCGGAGTCAGAmplicon SizecDNA: 241 bpgenomic: 2,848
Reverse (596,21)GGATCATCGTCATAGTCCTCGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops2.189 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.952 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGAT
CCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTC
TGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCC
TCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATC
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)241124 - 364
Exon 2 To Exon 3 (Pair 55)
Forward (437,22)AGCTGCTTGTCAGTTTGTTCGTAmplicon SizecDNA: 144 bpgenomic: 2,751
Reverse (580,21)CCTCGGCAATGATCTCTTCCTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.769 kcal/mol
Forward Dimers-2.888 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.067 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGC
CCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAAC
CAGAGGAAGAGATCATTGCCGAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)144205 - 348
Exon 2 To Exon 3 (Pair 56)
Forward (461,21)GTCCCTAGGTCTGTCTGCTATAmplicon SizecDNA: 142 bpgenomic: 2,749
Reverse (602,22)TCCACAGGATCATCGTCATAGTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.05 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGG
CCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGG
ACTATGACGATGATCCTGTGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)142229 - 370
Exon 2 To Exon 3 (Pair 57)
Forward (464,21)CCTAGGTCTGTCTGCTATCAGAmplicon SizecDNA: 141 bpgenomic: 2,748
Reverse (604,22)AGTCCACAGGATCATCGTCATANr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.31 kcal/mol in 3' area
Forward Dimers-1.74 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCA
AGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACT
ATGACGATGATCCTGTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001167990 (PQBP1)14181 - 221
NM_005710 (PQBP1)141232 - 372
NM_001167992 (PQBP1)1361 - 136
NM_144495 (PQBP1)137171 - 307
NM_001167989 (PQBP1)14199 - 239
NM_001032384 (PQBP1)13692 - 227
NM_001032383 (PQBP1)137182 - 318
NM_001032381 (PQBP1)14199 - 239
NM_001032382 (PQBP1)137171 - 307
Exon 2 To Exon 3 (Pair 58)
Forward (464,21)CCTAGGTCTGTCTGCTATCAGAmplicon SizecDNA: 139 bpgenomic: 2,746
Reverse (602,22)TCCACAGGATCATCGTCATAGTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.31 kcal/mol in 3' area
Forward Dimers-1.74 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCA
AGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACT
ATGACGATGATCCTGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001032382 (PQBP1)135171 - 305
NM_001032383 (PQBP1)135182 - 316
NM_001032381 (PQBP1)13999 - 237
NM_001032384 (PQBP1)13492 - 225
NM_001167990 (PQBP1)13981 - 219
NM_001167992 (PQBP1)1341 - 134
NM_005710 (PQBP1)139232 - 370
NM_144495 (PQBP1)135171 - 305
NM_001167989 (PQBP1)13999 - 237
Exon 2 To Exon 3 (Pair 59)
Forward (412,23)GGATCCAGATAGGAATCTTTATCAmplicon SizecDNA: 170 bpgenomic: 2,777
Reverse (581,21)TCCTCGGCAATGATCTCTTCCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.113 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.982 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTC
TGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGC
ATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)170180 - 349
Exon 2 To Exon 3 (Pair 60)
Forward (364,22)TAGATCGGAGTCAGATGAGTACAmplicon SizecDNA: 218 bpgenomic: 2,825
Reverse (581,21)TCCTCGGCAATGATCTCTTCCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAG
GAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCA
GCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACAT
CTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)218132 - 349
Exon 2 To Exon 3 (Pair 61)
Forward (437,22)AGCTGCTTGTCAGTTTGTTCGTAmplicon SizecDNA: 174 bpgenomic: 2,781
Reverse (610,21)CCTCGTAGTCCACAGGATCATNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.769 kcal/mol
Forward Dimers-2.888 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.313 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGC
CCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAAC
CAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTACGAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)174205 - 378
Exon 2 To Exon 3 (Pair 62)
Forward (462,21)TCCCTAGGTCTGTCTGCTATCAmplicon SizecDNA: 149 bpgenomic: 2,756
Reverse (610,21)CCTCGTAGTCCACAGGATCATNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.05 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGC
CAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGA
CTATGACGATGATCCTGTGGACTACGAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)149230 - 378
NM_144495 (PQBP1)143171 - 313
NM_001032383 (PQBP1)143182 - 324
NM_001032382 (PQBP1)143171 - 313
Exon 2 To Exon 3 (Pair 63)
Forward (462,21)TCCCTAGGTCTGTCTGCTATCAmplicon SizecDNA: 124 bpgenomic: 2,731
Reverse (585,22)ATAGTCCTCGGCAATGATCTCTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGC
CAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGA
CTAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_144495 (PQBP1)118171 - 288
NM_005710 (PQBP1)124230 - 353
NM_001032383 (PQBP1)118182 - 299
NM_001032382 (PQBP1)118171 - 288
Exon 2 To Exon 3 (Pair 64)
Forward (365,22)AGATCGGAGTCAGATGAGTACAAmplicon SizecDNA: 215 bpgenomic: 2,822
Reverse (579,21)CTCGGCAATGATCTCTTCCTCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGG
AATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAG
CTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATC
TGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)215133 - 347
Exon 2 To Exon 3 (Pair 65)
Forward (356,22)CATTTGAGTAGATCGGAGTCAGAmplicon SizecDNA: 240 bpgenomic: 2,847
Reverse (595,21)GATCATCGTCATAGTCCTCGGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops2.136 kcal/mol in 3' area
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-0.952 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGAT
CCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTC
TGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCC
TCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)240124 - 363
Exon 2 To Exon 3 (Pair 66)
Forward (363,22)GTAGATCGGAGTCAGATGAGTAAmplicon SizecDNA: 217 bpgenomic: 2,824
Reverse (579,21)CTCGGCAATGATCTCTTCCTCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATA
GGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATC
AGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACA
TCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)217131 - 347
Exon 2 To Exon 3 (Pair 67)
Forward (295,23)ATATTGCCACCTACCTCTTACATAmplicon SizecDNA: 308 bpgenomic: 2,915
Reverse (602,22)TCCACAGGATCATCGTCATAGTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.531 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceATATTGCCACCTACCTCTTACATCTTTTAGTGCGTATGTTCTGTCCACCCAGCTACTGGT
TCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGA
TCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGT
CTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATC
CTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGAT
CCTGTGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001032384 (PQBP1)16363 - 225
NM_005710 (PQBP1)30863 - 370
Exon 2 To Exon 3 (Pair 68)
Forward (356,22)CATTTGAGTAGATCGGAGTCAGAmplicon SizecDNA: 239 bpgenomic: 2,846
Reverse (594,21)ATCATCGTCATAGTCCTCGGCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops2.121 kcal/mol in 3' area
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.564 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGAT
CCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTC
TGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCC
TCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)239124 - 362
Exon 2 To Exon 3 (Pair 69)
Forward (348,23)TACTGGTTCATTTGAGTAGATCGAmplicon SizecDNA: 259 bpgenomic: 2,866
Reverse (606,21)GTAGTCCACAGGATCATCGTCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.885 kcal/mol
Forward Dimers-0.935 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.126 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGT
TACGGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTA
GGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAG
AGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGA
CGATGATCCTGTGGACTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)259116 - 374
Exon 2 To Exon 3 (Pair 70)
Forward (463,21)CCCTAGGTCTGTCTGCTATCAAmplicon SizecDNA: 119 bpgenomic: 2,726
Reverse (581,21)TCCTCGGCAATGATCTCTTCCNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCC
AAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001167989 (PQBP1)11899 - 216
NM_144495 (PQBP1)114171 - 284
NM_001167992 (PQBP1)1131 - 113
NM_005710 (PQBP1)119231 - 349
NM_001167990 (PQBP1)11881 - 198
NM_001032382 (PQBP1)114171 - 284
NM_001032381 (PQBP1)11899 - 216
NM_001032383 (PQBP1)114182 - 295
Exon 2 To Exon 3 (Pair 71)
Forward (354,23)TTCATTTGAGTAGATCGGAGTCAAmplicon SizecDNA: 253 bpgenomic: 2,860
Reverse (606,21)GTAGTCCACAGGATCATCGTCNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.952 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGG
ATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTG
TCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCAT
CCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGA
TCCTGTGGACTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)253122 - 374
Exon 2 To Exon 3 (Pair 72)
Forward (462,21)TCCCTAGGTCTGTCTGCTATCAmplicon SizecDNA: 145 bpgenomic: 2,752
Reverse (606,21)GTAGTCCACAGGATCATCGTCNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.05 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGC
CAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGA
CTATGACGATGATCCTGTGGACTAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)145230 - 374
NM_144495 (PQBP1)139171 - 309
NM_001032382 (PQBP1)139171 - 309
NM_001032383 (PQBP1)139182 - 320
Exon 2 To Exon 3 (Pair 73)
Forward (295,23)ATATTGCCACCTACCTCTTACATAmplicon SizecDNA: 281 bpgenomic: 2,888
Reverse (575,22)GCAATGATCTCTTCCTCTGGTTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.531 kcal/mol in 3' area
Forward Dimers0.136 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.362 kcal/mol
Forward-Reverse Dimers-2.096 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceATATTGCCACCTACCTCTTACATCTTTTAGTGCGTATGTTCTGTCCACCCAGCTACTGGT
TCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGA
TCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGT
CTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATC
CTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001032384 (PQBP1)13663 - 198
NM_005710 (PQBP1)28163 - 343
Exon 2 To Exon 3 (Pair 74)
Forward (463,21)CCCTAGGTCTGTCTGCTATCAAmplicon SizecDNA: 140 bpgenomic: 2,747
Reverse (602,22)TCCACAGGATCATCGTCATAGTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.05 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCC
AAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGAC
TATGACGATGATCCTGTGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001167990 (PQBP1)13981 - 219
NM_005710 (PQBP1)140231 - 370
NM_001167992 (PQBP1)1341 - 134
NM_144495 (PQBP1)135171 - 305
NM_001167989 (PQBP1)13999 - 237
NM_001032382 (PQBP1)135171 - 305
NM_001032383 (PQBP1)135182 - 316
NM_001032381 (PQBP1)13999 - 237
Exon 2 To Exon 3 (Pair 75)
Forward (437,22)AGCTGCTTGTCAGTTTGTTCGTAmplicon SizecDNA: 139 bpgenomic: 2,746
Reverse (575,22)GCAATGATCTCTTCCTCTGGTTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.769 kcal/mol
Forward Dimers-2.888 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.362 kcal/mol
Forward-Reverse Dimers-0.759 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGC
CCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAAC
CAGAGGAAGAGATCATTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)139205 - 343
Exon 2 To Exon 3 (Pair 76)
Forward (462,21)TCCCTAGGTCTGTCTGCTATCAmplicon SizecDNA: 121 bpgenomic: 2,728
Reverse (582,21)GTCCTCGGCAATGATCTCTTCNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGC
CAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGA
C
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001032383 (PQBP1)115182 - 296
NM_001032382 (PQBP1)115171 - 285
NM_144495 (PQBP1)115171 - 285
NM_005710 (PQBP1)121230 - 350
Exon 2 To Exon 3 (Pair 77)
Forward (365,22)AGATCGGAGTCAGATGAGTACAAmplicon SizecDNA: 232 bpgenomic: 2,839
Reverse (596,21)GGATCATCGTCATAGTCCTCGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops2.189 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.497 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGG
AATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAG
CTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATC
TGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)232133 - 364
Exon 2 To Exon 3 (Pair 78)
Forward (437,22)AGCTGCTTGTCAGTTTGTTCGTAmplicon SizecDNA: 170 bpgenomic: 2,777
Reverse (606,21)GTAGTCCACAGGATCATCGTCNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.769 kcal/mol
Forward Dimers-2.888 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.313 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGC
CCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAAC
CAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)170205 - 374
Exon 2 To Exon 3 (Pair 79)
Forward (348,23)TACTGGTTCATTTGAGTAGATCGAmplicon SizecDNA: 233 bpgenomic: 2,840
Reverse (580,21)CCTCGGCAATGATCTCTTCCTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.885 kcal/mol
Forward Dimers-0.935 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.81 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGT
TACGGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTA
GGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAG
AGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)233116 - 348
Exon 2 To Exon 3 (Pair 80)
Forward (354,23)TTCATTTGAGTAGATCGGAGTCAAmplicon SizecDNA: 254 bpgenomic: 2,861
Reverse (607,21)CGTAGTCCACAGGATCATCGTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.952 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGG
ATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTG
TCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCAT
CCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGA
TCCTGTGGACTACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)254122 - 375
Exon 2 To Exon 3 (Pair 81)
Forward (461,21)GTCCCTAGGTCTGTCTGCTATAmplicon SizecDNA: 115 bpgenomic: 2,722
Reverse (575,22)GCAATGATCTCTTCCTCTGGTTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.362 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGG
CCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)115229 - 343
Exon 2 To Exon 3 (Pair 82)
Forward (356,22)CATTTGAGTAGATCGGAGTCAGAmplicon SizecDNA: 249 bpgenomic: 2,856
Reverse (604,22)AGTCCACAGGATCATCGTCATANr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.952 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGAT
CCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTC
TGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCC
TCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATC
CTGTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)249124 - 372
Exon 2 To Exon 3 (Pair 83)
Forward (412,23)GGATCCAGATAGGAATCTTTATCAmplicon SizecDNA: 185 bpgenomic: 2,792
Reverse (596,21)GGATCATCGTCATAGTCCTCGNr. of Isoforms 4 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.113 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops2.189 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.242 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTC
TGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGC
ATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGAT
GATCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)185180 - 364
Exon 2 To Exon 3 (Pair 84)
Forward (461,21)GTCCCTAGGTCTGTCTGCTATAmplicon SizecDNA: 147 bpgenomic: 2,754
Reverse (607,21)CGTAGTCCACAGGATCATCGTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.05 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGG
CCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGG
ACTATGACGATGATCCTGTGGACTACG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)147229 - 375
Exon 2 To Exon 3 (Pair 85)
Forward (356,22)CATTTGAGTAGATCGGAGTCAGAmplicon SizecDNA: 220 bpgenomic: 2,827
Reverse (575,22)GCAATGATCTCTTCCTCTGGTTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.362 kcal/mol
Forward-Reverse Dimers-1.892 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGAT
CCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTC
TGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCC
TCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)220124 - 343
Exon 2 To Exon 3 (Pair 86)
Forward (437,22)AGCTGCTTGTCAGTTTGTTCGTAmplicon SizecDNA: 171 bpgenomic: 2,778
Reverse (607,21)CGTAGTCCACAGGATCATCGTNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.769 kcal/mol
Forward Dimers-2.888 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.313 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGC
CCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAAC
CAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTACG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)171205 - 375
Exon 2 To Exon 3 (Pair 87)
Forward (437,22)AGCTGCTTGTCAGTTTGTTCGTAmplicon SizecDNA: 145 bpgenomic: 2,752
Reverse (581,21)TCCTCGGCAATGATCTCTTCCNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.769 kcal/mol
Forward Dimers-2.888 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.067 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGC
CCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAAC
CAGAGGAAGAGATCATTGCCGAGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)145205 - 349
Exon 2 To Exon 3 (Pair 88)
Forward (363,22)GTAGATCGGAGTCAGATGAGTAAmplicon SizecDNA: 213 bpgenomic: 2,820
Reverse (575,22)GCAATGATCTCTTCCTCTGGTTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops2.087 kcal/mol in 3' area
Reverse Dimers-0.362 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATA
GGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATC
AGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACA
TCTGGAGCCTGAACCAGAGGAAGAGATCATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)213131 - 343
Exon 2 To Exon 3 (Pair 89)
Forward (464,21)CCTAGGTCTGTCTGCTATCAGAmplicon SizecDNA: 143 bpgenomic: 2,750
Reverse (606,21)GTAGTCCACAGGATCATCGTCNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.31 kcal/mol in 3' area
Forward Dimers-1.74 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCA
AGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACT
ATGACGATGATCCTGTGGACTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001032383 (PQBP1)139182 - 320
NM_001032382 (PQBP1)139171 - 309
NM_144495 (PQBP1)139171 - 309
NM_001167990 (PQBP1)14381 - 223
NM_001032381 (PQBP1)14399 - 241
NM_001167989 (PQBP1)14399 - 241
NM_005710 (PQBP1)143232 - 374
NM_001167992 (PQBP1)1381 - 138
NM_001032384 (PQBP1)13892 - 229
Exon 2 To Exon 3 (Pair 90)
Forward (412,23)GGATCCAGATAGGAATCTTTATCAmplicon SizecDNA: 191 bpgenomic: 2,798
Reverse (602,22)TCCACAGGATCATCGTCATAGTNr. of Isoforms 4 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.113 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.569 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTC
TGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGC
ATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGAT
GATCCTGTGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)191180 - 370
Exon 2 To Exon 3 (Pair 91)
Forward (437,22)AGCTGCTTGTCAGTTTGTTCGTAmplicon SizecDNA: 141 bpgenomic: 2,748
Reverse (577,21)CGGCAATGATCTCTTCCTCTGNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.769 kcal/mol
Forward Dimers-2.888 kcal/mol
Reverse Loops0.654 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.067 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGC
CCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAAC
CAGAGGAAGAGATCATTGCCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)141205 - 345
Exon 2 To Exon 3 (Pair 92)
Forward (412,23)GGATCCAGATAGGAATCTTTATCAmplicon SizecDNA: 169 bpgenomic: 2,776
Reverse (580,21)CCTCGGCAATGATCTCTTCCTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.113 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.982 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTC
TGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGC
ATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)169180 - 348
Exon 2 To Exon 3 (Pair 93)
Forward (412,23)GGATCCAGATAGGAATCTTTATCAmplicon SizecDNA: 193 bpgenomic: 2,800
Reverse (604,22)AGTCCACAGGATCATCGTCATANr. of Isoforms 4 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops0.113 kcal/mol
Forward Dimers-2.832 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.569 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTC
TGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGC
ATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGAT
GATCCTGTGGACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)193180 - 372
Exon 2 To Exon 3 (Pair 94)
Forward (323,21)AGTGCGTATGTTCTGTCCACCAmplicon SizecDNA: 263 bpgenomic: 2,870
Reverse (585,22)ATAGTCCTCGGCAATGATCTCTNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-0.899 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATGAG
TACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCTGC
TTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTG
CGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGG
AAGAGATCATTGCCGAGGACTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)26391 - 353
Exon 2 To Exon 3 (Pair 95)
Forward (366,22)GATCGGAGTCAGATGAGTACATAmplicon SizecDNA: 212 bpgenomic: 2,819
Reverse (577,21)CGGCAATGATCTCTTCCTCTGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.207 kcal/mol in 3' area
Forward Dimers-1.838 kcal/mol
Reverse Loops0.654 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGA
ATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGC
TATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCT
GGAGCCTGAACCAGAGGAAGAGATCATTGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)212134 - 345
Exon 2 To Exon 3 (Pair 96)
Forward (461,21)GTCCCTAGGTCTGTCTGCTATAmplicon SizecDNA: 122 bpgenomic: 2,729
Reverse (582,21)GTCCTCGGCAATGATCTCTTCNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.766 kcal/mol
Forward Dimers-2.162 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGG
CCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGG
AC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005710 (PQBP1)122229 - 350
Exon 2 To Exon 3 (Pair 97)
Forward (364,22)TAGATCGGAGTCAGATGAGTACAmplicon SizecDNA: 213 bpgenomic: 2,820
Reverse (576,21)GGCAATGATCTCTTCCTCTGGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.741 kcal/mol
Forward Dimers-1.838 kcal/mol
Reverse Loops2.112 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.937 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAG
GAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCA
GCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACAT
CTGGAGCCTGAACCAGAGGAAGAGATCATTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)213132 - 344
Exon 2 To Exon 3 (Pair 98)
Forward (321,22)TTAGTGCGTATGTTCTGTCCACAmplicon SizecDNA: 256 bpgenomic: 2,863
Reverse (576,21)GGCAATGATCTCTTCCTCTGGNr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops2.27 kcal/mol
Forward Dimers-0.214 kcal/mol
Reverse Loops2.112 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.101 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceTTAGTGCGTATGTTCTGTCCACCCAGCTACTGGTTCATTTGAGTAGATCGGAGTCAGATG
AGTACATGTTTACGGGAGGCGCTTGGTTACGGGATCCAGATAGGAATCTTTATCTGAGCT
GCTTGTCAGTTTGTTCGTCTGTCCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGT
TGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGA
GGAAGAGATCATTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)25689 - 344
Exon 2 To Exon 3 (Pair 99)
Forward (352,22)GGTTCATTTGAGTAGATCGGAGAmplicon SizecDNA: 253 bpgenomic: 2,860
Reverse (604,22)AGTCCACAGGATCATCGTCATANr. of Isoforms 1 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.832 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops1.304 kcal/mol
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-0.952 kcal/mol
Amplicon Folding-1.07 kcal/mol outside primersite
Amplicon SequenceGGTTCATTTGAGTAGATCGGAGTCAGATGAGTACATGTTTACGGGAGGCGCTTGGTTACG
GGATCCAGATAGGAATCTTTATCTGAGCTGCTTGTCAGTTTGTTCGTCTGTCCCTAGGTC
TGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGC
ATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGAT
GATCCTGTGGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005710 (PQBP1)253120 - 372
Exon 2 To Exon 3 (Pair 100)
Forward (464,21)CCTAGGTCTGTCTGCTATCAGAmplicon SizecDNA: 119 bpgenomic: 2,726
Reverse (582,21)GTCCTCGGCAATGATCTCTTCNr. of Isoforms 9 out of 9 (by amplicon BlastN)
Folding EnergiesForward Loops1.31 kcal/mol in 3' area
Forward Dimers-1.74 kcal/mol
Reverse Loops0.349 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.183 kcal/mol
Amplicon Folding-0.817 kcal/mol outside primersite
Amplicon SequenceCCTAGGTCTGTCTGCTATCAGCTATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCA
AGAGAGGCATCCTCAAACATCTGGAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001032384 (PQBP1)11492 - 205
NM_001167989 (PQBP1)11999 - 217
NM_005710 (PQBP1)119232 - 350
NM_001167992 (PQBP1)1141 - 114
NM_001032381 (PQBP1)11999 - 217
NM_144495 (PQBP1)115171 - 285
NM_001167990 (PQBP1)11981 - 199
NM_001032382 (PQBP1)115171 - 285
NM_001032383 (PQBP1)115182 - 296
 

See below for some more details.

Program Output:

Loading ...