Design Results for PRDM1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 4 (Pair 39)
Forward (402,23)GAAGTGTACATACATTGTGAACGAmplicon SizecDNA: 293 bpgenomic: 10,585
Reverse (694,22)TGCTTTGAGTCACTGGGTAGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol
Forward Dimers-1.244 kcal/mol
Reverse Loops1.285 kcal/mol in 3' area
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTACTTC
GGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAGTGA
AGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACCCCT
AATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTG
GAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 38)
Forward (399,24)AGAGAAGTGTACATACATTGTGAAAmplicon SizecDNA: 299 bpgenomic: 10,591
Reverse (697,22)TAGTGCTTTGAGTCACTGGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol in 3' area
Forward Dimers-1.244 kcal/mol
Reverse Loops0.858 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceAGAGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTAC
TTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAG
TGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACC
CCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTT
TTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAGCACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 37)
Forward (402,23)GAAGTGTACATACATTGTGAACGAmplicon SizecDNA: 291 bpgenomic: 10,583
Reverse (692,22)CTTTGAGTCACTGGGTAGAAGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol
Forward Dimers-1.244 kcal/mol
Reverse Loops1.285 kcal/mol in 3' area
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTACTTC
GGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAGTGA
AGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACCCCT
AATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTG
GAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 36)
Forward (447,21)TGATGGCGGTACTTCGGTTCAAmplicon SizecDNA: 251 bpgenomic: 10,543
Reverse (697,22)TAGTGCTTTGAGTCACTGGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.306 kcal/mol in 3' area
Forward Dimers-2.134 kcal/mol
Reverse Loops0.858 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTA
TGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCAC
ACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAA
CAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGAC
TCAAAGCACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 33)
Forward (402,23)GAAGTGTACATACATTGTGAACGAmplicon SizecDNA: 294 bpgenomic: 10,586
Reverse (695,21)GTGCTTTGAGTCACTGGGTAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol
Forward Dimers-1.244 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTACTTC
GGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAGTGA
AGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACCCCT
AATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTG
GAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 32)
Forward (434,20)GGGATTCTGGTGCTGATGGCAmplicon SizecDNA: 264 bpgenomic: 10,556
Reverse (697,22)TAGTGCTTTGAGTCACTGGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.11 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops0.858 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-0.649 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGGGATTCTGGTGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATC
TGCTTTTCAAGTATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACA
TACCAAAGGGCACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTC
CTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCT
TCTACCCAGTGACTCAAAGCACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 31)
Forward (435,20)GGATTCTGGTGCTGATGGCGAmplicon SizecDNA: 248 bpgenomic: 10,540
Reverse (682,20)CTGGGTAGAAGACCAAGCCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops0.252 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-2.262 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGGATTCTGGTGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCT
GCTTTTCAAGTATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACAT
ACCAAAGGGCACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCC
TAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTT
CTACCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 30)
Forward (450,20)TGGCGGTACTTCGGTTCAGGAmplicon SizecDNA: 233 bpgenomic: 10,525
Reverse (682,20)CTGGGTAGAAGACCAAGCCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.306 kcal/mol
Forward Dimers-2.134 kcal/mol
Reverse Loops0.252 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceTGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGC
CACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACG
TTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAG
GAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 29)
Forward (399,24)AGAGAAGTGTACATACATTGTGAAAmplicon SizecDNA: 294 bpgenomic: 10,586
Reverse (692,22)CTTTGAGTCACTGGGTAGAAGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol in 3' area
Forward Dimers-1.244 kcal/mol
Reverse Loops1.285 kcal/mol in 3' area
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceAGAGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTAC
TTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAG
TGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACC
CCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTT
TTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 28)
Forward (436,20)GATTCTGGTGCTGATGGCGGAmplicon SizecDNA: 262 bpgenomic: 10,554
Reverse (697,22)TAGTGCTTTGAGTCACTGGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.856 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops0.858 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-0.649 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGATTCTGGTGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTG
CTTTTCAAGTATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATA
CCAAAGGGCACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCT
AAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTC
TACCCAGTGACTCAAAGCACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 27)
Forward (399,24)AGAGAAGTGTACATACATTGTGAAAmplicon SizecDNA: 284 bpgenomic: 10,576
Reverse (682,20)CTGGGTAGAAGACCAAGCCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol in 3' area
Forward Dimers-1.244 kcal/mol
Reverse Loops0.252 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-0.543 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceAGAGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTAC
TTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAG
TGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACC
CCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTT
TTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 26)
Forward (399,24)AGAGAAGTGTACATACATTGTGAAAmplicon SizecDNA: 297 bpgenomic: 10,589
Reverse (695,21)GTGCTTTGAGTCACTGGGTAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol in 3' area
Forward Dimers-1.244 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceAGAGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTAC
TTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAG
TGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACC
CCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTT
TTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 24)
Forward (445,20)GCTGATGGCGGTACTTCGGTAmplicon SizecDNA: 250 bpgenomic: 10,542
Reverse (694,22)TGCTTTGAGTCACTGGGTAGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.38 kcal/mol
Forward Dimers-2.134 kcal/mol
Reverse Loops1.285 kcal/mol in 3' area
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAG
TATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGC
ACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCC
AACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTG
ACTCAAAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 23)
Forward (434,20)GGGATTCTGGTGCTGATGGCAmplicon SizecDNA: 249 bpgenomic: 10,541
Reverse (682,20)CTGGGTAGAAGACCAAGCCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.11 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops0.252 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-2.262 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGGGATTCTGGTGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATC
TGCTTTTCAAGTATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACA
TACCAAAGGGCACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTC
CTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCT
TCTACCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 21)
Forward (450,20)TGGCGGTACTTCGGTTCAGGAmplicon SizecDNA: 245 bpgenomic: 10,537
Reverse (694,22)TGCTTTGAGTCACTGGGTAGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.306 kcal/mol
Forward Dimers-2.134 kcal/mol
Reverse Loops1.285 kcal/mol in 3' area
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceTGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGC
CACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACG
TTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAG
GAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCA
AAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 20)
Forward (399,24)AGAGAAGTGTACATACATTGTGAAAmplicon SizecDNA: 296 bpgenomic: 10,588
Reverse (694,22)TGCTTTGAGTCACTGGGTAGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol in 3' area
Forward Dimers-1.244 kcal/mol
Reverse Loops1.285 kcal/mol in 3' area
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceAGAGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTAC
TTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAG
TGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACC
CCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTT
TTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 19)
Forward (402,23)GAAGTGTACATACATTGTGAACGAmplicon SizecDNA: 290 bpgenomic: 10,582
Reverse (691,22)TTTGAGTCACTGGGTAGAAGACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol
Forward Dimers-1.244 kcal/mol
Reverse Loops1.285 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTACTTC
GGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAGTGA
AGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACCCCT
AATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTG
GAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 18)
Forward (434,20)GGGATTCTGGTGCTGATGGCAmplicon SizecDNA: 262 bpgenomic: 10,554
Reverse (695,21)GTGCTTTGAGTCACTGGGTAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.11 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-0.649 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGGGATTCTGGTGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATC
TGCTTTTCAAGTATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACA
TACCAAAGGGCACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTC
CTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCT
TCTACCCAGTGACTCAAAGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 17)
Forward (436,20)GATTCTGGTGCTGATGGCGGAmplicon SizecDNA: 260 bpgenomic: 10,552
Reverse (695,21)GTGCTTTGAGTCACTGGGTAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.856 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-0.649 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGATTCTGGTGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTG
CTTTTCAAGTATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATA
CCAAAGGGCACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCT
AAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTC
TACCCAGTGACTCAAAGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 16)
Forward (402,23)GAAGTGTACATACATTGTGAACGAmplicon SizecDNA: 281 bpgenomic: 10,573
Reverse (682,20)CTGGGTAGAAGACCAAGCCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol
Forward Dimers-1.244 kcal/mol
Reverse Loops0.252 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-0.305 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTACTTC
GGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAGTGA
AGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACCCCT
AATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTG
GAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 15)
Forward (445,20)GCTGATGGCGGTACTTCGGTAmplicon SizecDNA: 253 bpgenomic: 10,545
Reverse (697,22)TAGTGCTTTGAGTCACTGGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.38 kcal/mol
Forward Dimers-2.134 kcal/mol
Reverse Loops0.858 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAG
TATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGC
ACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCC
AACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTG
ACTCAAAGCACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 14)
Forward (399,24)AGAGAAGTGTACATACATTGTGAAAmplicon SizecDNA: 291 bpgenomic: 10,583
Reverse (689,21)TGAGTCACTGGGTAGAAGACCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol in 3' area
Forward Dimers-1.244 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceAGAGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTAC
TTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAG
TGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACC
CCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTT
TTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 12)
Forward (399,24)AGAGAAGTGTACATACATTGTGAAAmplicon SizecDNA: 293 bpgenomic: 10,585
Reverse (691,22)TTTGAGTCACTGGGTAGAAGACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol in 3' area
Forward Dimers-1.244 kcal/mol
Reverse Loops1.285 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceAGAGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTAC
TTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAG
TGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACC
CCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTT
TTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 11)
Forward (450,20)TGGCGGTACTTCGGTTCAGGAmplicon SizecDNA: 246 bpgenomic: 10,538
Reverse (695,21)GTGCTTTGAGTCACTGGGTAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.306 kcal/mol
Forward Dimers-2.134 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceTGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGC
CACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACG
TTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAG
GAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCA
AAGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 10)
Forward (435,20)GGATTCTGGTGCTGATGGCGAmplicon SizecDNA: 261 bpgenomic: 10,553
Reverse (695,21)GTGCTTTGAGTCACTGGGTAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-0.649 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGGATTCTGGTGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCT
GCTTTTCAAGTATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACAT
ACCAAAGGGCACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCC
TAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTT
CTACCCAGTGACTCAAAGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 9)
Forward (402,23)GAAGTGTACATACATTGTGAACGAmplicon SizecDNA: 288 bpgenomic: 10,580
Reverse (689,21)TGAGTCACTGGGTAGAAGACCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol
Forward Dimers-1.244 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTACTTC
GGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAGTGA
AGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACCCCT
AATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTG
GAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 8)
Forward (450,20)TGGCGGTACTTCGGTTCAGGAmplicon SizecDNA: 248 bpgenomic: 10,540
Reverse (697,22)TAGTGCTTTGAGTCACTGGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.306 kcal/mol
Forward Dimers-2.134 kcal/mol
Reverse Loops0.858 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceTGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGC
CACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACG
TTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAG
GAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCA
AAGCACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 7)
Forward (436,20)GATTCTGGTGCTGATGGCGGAmplicon SizecDNA: 247 bpgenomic: 10,539
Reverse (682,20)CTGGGTAGAAGACCAAGCCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.856 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops0.252 kcal/mol
Reverse Dimers-1.498 kcal/mol
Forward-Reverse Dimers-2.262 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGATTCTGGTGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTG
CTTTTCAAGTATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATA
CCAAAGGGCACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCT
AAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTC
TACCCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 5)
Forward (447,21)TGATGGCGGTACTTCGGTTCAAmplicon SizecDNA: 249 bpgenomic: 10,541
Reverse (695,21)GTGCTTTGAGTCACTGGGTAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.306 kcal/mol in 3' area
Forward Dimers-2.134 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTA
TGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCAC
ACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAA
CAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGAC
TCAAAGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 4)
Forward (447,21)TGATGGCGGTACTTCGGTTCAAmplicon SizecDNA: 248 bpgenomic: 10,540
Reverse (694,22)TGCTTTGAGTCACTGGGTAGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.306 kcal/mol in 3' area
Forward Dimers-2.134 kcal/mol
Reverse Loops1.285 kcal/mol in 3' area
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTA
TGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCAC
ACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAA
CAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGAC
TCAAAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 3)
Forward (402,23)GAAGTGTACATACATTGTGAACGAmplicon SizecDNA: 296 bpgenomic: 10,588
Reverse (697,22)TAGTGCTTTGAGTCACTGGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.793 kcal/mol
Forward Dimers-1.244 kcal/mol
Reverse Loops0.858 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.808 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGAAGTGTACATACATTGTGAACGACCACCCCTGGGATTCTGGTGCTGATGGCGGTACTTC
GGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAGTATGCCACCAACAGTGA
AGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGCACACGTTTTGGACCCCT
AATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTG
GAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAGCACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 2)
Forward (445,20)GCTGATGGCGGTACTTCGGTAmplicon SizecDNA: 251 bpgenomic: 10,543
Reverse (695,21)GTGCTTTGAGTCACTGGGTAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.38 kcal/mol
Forward Dimers-2.134 kcal/mol
Reverse Loops1.847 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-1.568 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCTGCTTTTCAAG
TATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACATACCAAAGGGC
ACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCCTAAGAACGCC
AACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTTCTACCCAGTG
ACTCAAAGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 2 To Exon 4 (Pair 40)
Forward (435,20)GGATTCTGGTGCTGATGGCGAmplicon SizecDNA: 263 bpgenomic: 10,555
Reverse (697,22)TAGTGCTTTGAGTCACTGGGTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol in 3' area
Forward Dimers-0.172 kcal/mol
Reverse Loops0.858 kcal/mol
Reverse Dimers-1.482 kcal/mol
Forward-Reverse Dimers-0.649 kcal/mol
Amplicon Folding-0.434 kcal/mol outside primersite
Amplicon SequenceGGATTCTGGTGCTGATGGCGGTACTTCGGTTCAGGCGGAGGCATCCTTACCAAGGAATCT
GCTTTTCAAGTATGCCACCAACAGTGAAGAGGTTATTGGAGTGATGAGTAAAGAATACAT
ACCAAAGGGCACACGTTTTGGACCCCTAATAGGTGAAATCTACACCAATGACACAGTTCC
TAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCTT
CTACCCAGTGACTCAAAGCACTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 94)
Forward (614,23)CTAAGAACGCCAACAGGAAATATAmplicon SizecDNA: 179 bpgenomic: 3,306
Reverse (792,22)AAACCGATTAACCCACCACAGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.368 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops1.742 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.886 kcal/mol outside primersite
Amplicon SequenceCTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCT
TCTACCCAGTGACTCAAAGCACTAAAAGTCAGCATAATCGGAACTGAAGTCAGTAGCATC
GCCCATTTGCCATTCACTGCAGTAGCAAAAGTAGTACTCTGTGGTGGGTTAATCGGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 91)
Forward (614,23)CTAAGAACGCCAACAGGAAATATAmplicon SizecDNA: 183 bpgenomic: 3,310
Reverse (796,21)CCTCAAACCGATTAACCCACCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.368 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops1.56 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.906 kcal/mol
Amplicon Folding-0.886 kcal/mol outside primersite
Amplicon SequenceCTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCT
TCTACCCAGTGACTCAAAGCACTAAAAGTCAGCATAATCGGAACTGAAGTCAGTAGCATC
GCCCATTTGCCATTCACTGCAGTAGCAAAAGTAGTACTCTGTGGTGGGTTAATCGGTTTG
AGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 85)
Forward (597,22)CACCAATGACACAGTTCCTAAGAmplicon SizecDNA: 198 bpgenomic: 3,325
Reverse (794,22)TCAAACCGATTAACCCACCACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.584 kcal/mol
Forward Dimers-0.257 kcal/mol
Reverse Loops1.56 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.84 kcal/mol
Amplicon Folding-0.886 kcal/mol outside primersite
Amplicon SequenceCACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTC
GTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAGCACTAAAAGTCAGCATAATCGGAA
CTGAAGTCAGTAGCATCGCCCATTTGCCATTCACTGCAGTAGCAAAAGTAGTACTCTGTG
GTGGGTTAATCGGTTTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 73)
Forward (614,23)CTAAGAACGCCAACAGGAAATATAmplicon SizecDNA: 177 bpgenomic: 3,304
Reverse (790,21)ACCGATTAACCCACCACAGAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.368 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops3.823 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.886 kcal/mol outside primersite
Amplicon SequenceCTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCT
TCTACCCAGTGACTCAAAGCACTAAAAGTCAGCATAATCGGAACTGAAGTCAGTAGCATC
GCCCATTTGCCATTCACTGCAGTAGCAAAAGTAGTACTCTGTGGTGGGTTAATCGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 67)
Forward (614,23)CTAAGAACGCCAACAGGAAATATAmplicon SizecDNA: 141 bpgenomic: 3,268
Reverse (754,21)TGCAGTGAATGGCAAATGGGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.368 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops1.176 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-2.718 kcal/mol
Amplicon Folding-0.48 kcal/mol outside primersite
Amplicon SequenceCTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCT
TCTACCCAGTGACTCAAAGCACTAAAAGTCAGCATAATCGGAACTGAAGTCAGTAGCATC
GCCCATTTGCCATTCACTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 65)
Forward (614,23)CTAAGAACGCCAACAGGAAATATAmplicon SizecDNA: 176 bpgenomic: 3,303
Reverse (789,21)CCGATTAACCCACCACAGAGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.368 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops2.152 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.886 kcal/mol outside primersite
Amplicon SequenceCTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCT
TCTACCCAGTGACTCAAAGCACTAAAAGTCAGCATAATCGGAACTGAAGTCAGTAGCATC
GCCCATTTGCCATTCACTGCAGTAGCAAAAGTAGTACTCTGTGGTGGGTTAATCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 64)
Forward (614,23)CTAAGAACGCCAACAGGAAATATAmplicon SizecDNA: 184 bpgenomic: 3,311
Reverse (797,21)GCCTCAAACCGATTAACCCACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.368 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops1.56 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.28 kcal/mol
Amplicon Folding-0.886 kcal/mol outside primersite
Amplicon SequenceCTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCT
TCTACCCAGTGACTCAAAGCACTAAAAGTCAGCATAATCGGAACTGAAGTCAGTAGCATC
GCCCATTTGCCATTCACTGCAGTAGCAAAAGTAGTACTCTGTGGTGGGTTAATCGGTTTG
AGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 61)
Forward (597,22)CACCAATGACACAGTTCCTAAGAmplicon SizecDNA: 196 bpgenomic: 3,323
Reverse (792,22)AAACCGATTAACCCACCACAGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.584 kcal/mol
Forward Dimers-0.257 kcal/mol
Reverse Loops1.742 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.84 kcal/mol
Amplicon Folding-0.886 kcal/mol outside primersite
Amplicon SequenceCACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTC
GTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAGCACTAAAAGTCAGCATAATCGGAA
CTGAAGTCAGTAGCATCGCCCATTTGCCATTCACTGCAGTAGCAAAAGTAGTACTCTGTG
GTGGGTTAATCGGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 60)
Forward (614,23)CTAAGAACGCCAACAGGAAATATAmplicon SizecDNA: 169 bpgenomic: 3,296
Reverse (782,22)ACCCACCACAGAGTACTACTTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.368 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.839 kcal/mol in 3' area
Reverse Dimers-2.994 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-0.886 kcal/mol outside primersite
Amplicon SequenceCTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTCGTCAGCCGGCTTGGTCT
TCTACCCAGTGACTCAAAGCACTAAAAGTCAGCATAATCGGAACTGAAGTCAGTAGCATC
GCCCATTTGCCATTCACTGCAGTAGCAAAAGTAGTACTCTGTGGTGGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 46)
Forward (597,22)CACCAATGACACAGTTCCTAAGAmplicon SizecDNA: 201 bpgenomic: 3,328
Reverse (797,21)GCCTCAAACCGATTAACCCACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.584 kcal/mol
Forward Dimers-0.257 kcal/mol
Reverse Loops1.56 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.84 kcal/mol
Amplicon Folding-0.886 kcal/mol outside primersite
Amplicon SequenceCACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTC
GTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAGCACTAAAAGTCAGCATAATCGGAA
CTGAAGTCAGTAGCATCGCCCATTTGCCATTCACTGCAGTAGCAAAAGTAGTACTCTGTG
GTGGGTTAATCGGTTTGAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 44)
Forward (597,22)CACCAATGACACAGTTCCTAAGAmplicon SizecDNA: 200 bpgenomic: 3,327
Reverse (796,21)CCTCAAACCGATTAACCCACCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.584 kcal/mol
Forward Dimers-0.257 kcal/mol
Reverse Loops1.56 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-0.84 kcal/mol
Amplicon Folding-0.886 kcal/mol outside primersite
Amplicon SequenceCACCAATGACACAGTTCCTAAGAACGCCAACAGGAAATATTTTTGGAGGAGTTTGACGTC
GTCAGCCGGCTTGGTCTTCTACCCAGTGACTCAAAGCACTAAAAGTCAGCATAATCGGAA
CTGAAGTCAGTAGCATCGCCCATTTGCCATTCACTGCAGTAGCAAAAGTAGTACTCTGTG
GTGGGTTAATCGGTTTGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 513)
Forward (1086,21)AGGCTTCACTACCCTTATCCCAmplicon SizecDNA: 120 bpgenomic: 5,392
Reverse (1205,22)TCTCTTTGGGACATTCTTTGGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.452 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.365 kcal/mol
Amplicon Folding0.666 kcal/mol outside primersite
Amplicon SequenceAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAATCTCACACAAACACAGAGC
AGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)120853 - 972
NM_182907 (PRDM1)120441 - 560
Exon 5 To Exon 6 (Pair 512)
Forward (1007,24)GAACATCTACTTCTACACCATTAAAmplicon SizecDNA: 213 bpgenomic: 5,485
Reverse (1219,22)TTCACGCTGTACTCTCTCTTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-0.875 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGGTA
TTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAA
TCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCCC
AAAGAATGTCCCAAAGAGAGAGTACAGCGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)213774 - 986
NM_182907 (PRDM1)213362 - 574
Exon 5 To Exon 6 (Pair 511)
Forward (1058,22)TGTGTGGTATTGTCGGGACTTTAmplicon SizecDNA: 153 bpgenomic: 5,425
Reverse (1210,23)TACTCTCTCTTTGGGACATTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol in 3' area
Forward Dimers0.066 kcal/mol in 3' area
Reverse Loops0.696 kcal/mol
Reverse Dimers0.006 kcal/mol in 3' area
Forward-Reverse Dimers-1.035 kcal/mol
Amplicon Folding0.448 kcal/mol inside primersite
Amplicon SequenceTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGAC
AATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGA
ACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)153825 - 977
NM_182907 (PRDM1)153413 - 565
Exon 5 To Exon 6 (Pair 510)
Forward (1086,21)AGGCTTCACTACCCTTATCCCAmplicon SizecDNA: 84 bpgenomic: 5,356
Reverse (1169,21)CTCAGTGCTCGGTTGCTTTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.452 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops1.665 kcal/mol
Reverse Dimers-0.967 kcal/mol
Forward-Reverse Dimers-1.969 kcal/mol
Amplicon Folding0.666 kcal/mol inside primersite
Amplicon SequenceAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAATCTCACACAAACACAGAGC
AGTCTAAAGCAACCGAGCACTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)84441 - 524
NM_001198 (PRDM1)84853 - 936
Exon 5 To Exon 6 (Pair 509)
Forward (1001,22)CGGGATGAACATCTACTTCTACAmplicon SizecDNA: 217 bpgenomic: 5,489
Reverse (1217,21)CACGCTGTACTCTCTCTTTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-1.26 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-0.875 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceCGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGT
GTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAAT
GATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACT
CTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)217768 - 984
NM_182907 (PRDM1)217356 - 572
Exon 5 To Exon 6 (Pair 508)
Forward (948,22)TATGTGAATCCAGCACACTCTCAmplicon SizecDNA: 262 bpgenomic: 5,534
Reverse (1209,23)ACTCTCTCTTTGGGACATTCTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.927 kcal/mol
Forward Dimers-1.72 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.955 kcal/mol
Amplicon Folding-0.984 kcal/mol outside primersite
Amplicon SequenceTATGTGAATCCAGCACACTCTCCCCGGGAGCAAAACCTGGCTGCGTGTCAGAACGGGATG
AACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGGTAT
TGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAAT
CTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCCCA
AAGAATGTCCCAAAGAGAGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)262303 - 564
NM_001198 (PRDM1)262715 - 976
Exon 5 To Exon 6 (Pair 507)
Forward (1109,23)AGAGCTGACAATGATGAATCTCAAmplicon SizecDNA: 107 bpgenomic: 5,379
Reverse (1215,21)CGCTGTACTCTCTCTTTGGGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.646 kcal/mol in 3' area
Reverse Dimers-0.102 kcal/mol
Forward-Reverse Dimers-1.567 kcal/mol
Amplicon Folding0.666 kcal/mol outside primersite
Amplicon SequenceAGAGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGA
GAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)107876 - 982
NM_182907 (PRDM1)107464 - 570
Exon 5 To Exon 6 (Pair 506)
Forward (999,23)AACGGGATGAACATCTACTTCTAAmplicon SizecDNA: 169 bpgenomic: 5,441
Reverse (1167,21)CAGTGCTCGGTTGCTTTAGACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-1.26 kcal/mol
Reverse Loops1.665 kcal/mol
Reverse Dimers-0.967 kcal/mol
Forward-Reverse Dimers-1.509 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTT
GTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACA
ATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)169766 - 934
NM_182907 (PRDM1)169354 - 522
Exon 5 To Exon 6 (Pair 505)
Forward (1107,22)GGAGAGCTGACAATGATGAATCAmplicon SizecDNA: 123 bpgenomic: 5,395
Reverse (1229,23)TAGGATTTCTTTCACGCTGTACTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.362 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.567 kcal/mol
Amplicon Folding0.666 kcal/mol outside primersite
Amplicon SequenceGGAGAGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACT
GAGAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATC
CTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)123874 - 996
NM_182907 (PRDM1)123462 - 584
Exon 5 To Exon 6 (Pair 504)
Forward (948,22)TATGTGAATCCAGCACACTCTCAmplicon SizecDNA: 208 bpgenomic: 5,480
Reverse (1155,22)GCTTTAGACTGCTCTGTGTTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.927 kcal/mol
Forward Dimers-1.72 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.293 kcal/mol
Forward-Reverse Dimers-2.41 kcal/mol
Amplicon Folding-0.984 kcal/mol outside primersite
Amplicon SequenceTATGTGAATCCAGCACACTCTCCCCGGGAGCAAAACCTGGCTGCGTGTCAGAACGGGATG
AACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGGTAT
TGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAAT
CTCACACAAACACAGAGCAGTCTAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)208303 - 510
NM_001198 (PRDM1)208715 - 922
Exon 5 To Exon 6 (Pair 503)
Forward (1005,24)ATGAACATCTACTTCTACACCATTAmplicon SizecDNA: 276 bpgenomic: 5,548
Reverse (1280,22)AATGTTAGAACGGTAGAGGTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.145 kcal/mol
Forward Dimers-0.674 kcal/mol
Reverse Loops1.827 kcal/mol in 3' area
Reverse Dimers-0.864 kcal/mol
Forward-Reverse Dimers-2.76 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGG
TATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATG
AATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGC
CCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCTAAAATTGGACTCCAAC
CCCTCCAAAGGAAAGGACCTCTACCGTTCTAACATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)276360 - 635
NM_001198 (PRDM1)276772 - 1047
Exon 5 To Exon 6 (Pair 502)
Forward (1058,22)TGTGTGGTATTGTCGGGACTTTAmplicon SizecDNA: 164 bpgenomic: 5,436
Reverse (1221,22)CTTTCACGCTGTACTCTCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol in 3' area
Forward Dimers0.066 kcal/mol in 3' area
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.469 kcal/mol
Amplicon Folding0.448 kcal/mol inside primersite
Amplicon SequenceTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGAC
AATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGA
ACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)164825 - 988
NM_182907 (PRDM1)164413 - 576
Exon 5 To Exon 6 (Pair 501)
Forward (944,21)GCGCTATGTGAATCCAGCACAAmplicon SizecDNA: 284 bpgenomic: 5,556
Reverse (1227,22)GGATTTCTTTCACGCTGTACTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.941 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops1.854 kcal/mol in 3' area
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.406 kcal/mol
Amplicon Folding-0.984 kcal/mol outside primersite
Amplicon SequenceGCGCTATGTGAATCCAGCACACTCTCCCCGGGAGCAAAACCTGGCTGCGTGTCAGAACGG
GATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTG
GTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGAT
GAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTG
CCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)284299 - 582
NM_001198 (PRDM1)284711 - 994
Exon 5 To Exon 6 (Pair 500)
Forward (989,21)TGCGTGTCAGAACGGGATGAAAmplicon SizecDNA: 226 bpgenomic: 5,498
Reverse (1214,21)GCTGTACTCTCTCTTTGGGACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.416 kcal/mol
Reverse Loops1.646 kcal/mol in 3' area
Reverse Dimers-0.102 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceTGCGTGTCAGAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCA
GGAACTTCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGG
AGAGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGA
GAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)226344 - 569
NM_001198 (PRDM1)226756 - 981
Exon 5 To Exon 6 (Pair 499)
Forward (989,21)TGCGTGTCAGAACGGGATGAAAmplicon SizecDNA: 284 bpgenomic: 5,556
Reverse (1272,22)AACGGTAGAGGTCCTTTCCTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.416 kcal/mol
Reverse Loops0.512 kcal/mol in 3' area
Reverse Dimers-2.62 kcal/mol
Forward-Reverse Dimers-1.875 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceTGCGTGTCAGAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCA
GGAACTTCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGG
AGAGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGA
GAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCT
AAAATTGGACTCCAACCCCTCCAAAGGAAAGGACCTCTACCGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)284756 - 1039
NM_182907 (PRDM1)284344 - 627
Exon 5 To Exon 6 (Pair 498)
Forward (1066,22)ATTGTCGGGACTTTGCAGAAAGAmplicon SizecDNA: 261 bpgenomic: 5,533
Reverse (1326,22)CACGTCTTCTAAAGTCATCGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.571 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-2.627 kcal/mol
Amplicon Folding0.3 kcal/mol outside primersite
Amplicon SequenceATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGA
ATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCC
CAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCTAAAATTGGACTCCAACC
CCTCCAAAGGAAAGGACCTCTACCGTTCTAACATTTCACCCCTCACATCAGAAAAGGACC
TCGATGACTTTAGAAGACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)261833 - 1093
NM_182907 (PRDM1)261421 - 681
Exon 5 To Exon 6 (Pair 497)
Forward (999,23)AACGGGATGAACATCTACTTCTAAmplicon SizecDNA: 216 bpgenomic: 5,488
Reverse (1214,21)GCTGTACTCTCTCTTTGGGACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-1.26 kcal/mol
Reverse Loops1.646 kcal/mol in 3' area
Reverse Dimers-0.102 kcal/mol
Forward-Reverse Dimers-0.875 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTT
GTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACA
ATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAA
CTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)216354 - 569
NM_001198 (PRDM1)216766 - 981
Exon 5 To Exon 6 (Pair 496)
Forward (1068,21)TGTCGGGACTTTGCAGAAAGGAmplicon SizecDNA: 88 bpgenomic: 5,360
Reverse (1155,22)GCTTTAGACTGCTCTGTGTTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.094 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.293 kcal/mol
Forward-Reverse Dimers-2.959 kcal/mol
Amplicon Folding0.448 kcal/mol inside primersite
Amplicon SequenceTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAAT
CTCACACAAACACAGAGCAGTCTAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)88423 - 510
NM_001198 (PRDM1)88835 - 922
Exon 5 To Exon 6 (Pair 495)
Forward (1014,23)TACTTCTACACCATTAAGCCCATAmplicon SizecDNA: 253 bpgenomic: 5,525
Reverse (1266,21)AGAGGTCCTTTCCTTTGGAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.33 kcal/mol
Forward Dimers-0.249 kcal/mol
Reverse Loops0.512 kcal/mol
Reverse Dimers-2.62 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGGTATTGTCGG
GACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAATCTCACA
CAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCCCAAAGAAT
GTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCTAAAATTGGACTCCAACCCCTCCAAA
GGAAAGGACCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)253369 - 621
NM_001198 (PRDM1)253781 - 1033
Exon 5 To Exon 6 (Pair 494)
Forward (1048,23)AGGAACTTCTTGTGTGGTATTGTAmplicon SizecDNA: 169 bpgenomic: 5,441
Reverse (1216,21)ACGCTGTACTCTCTCTTTGGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.392 kcal/mol
Forward Dimers0.118 kcal/mol
Reverse Loops2.328 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-0.304 kcal/mol
Amplicon Folding0.392 kcal/mol inside primersite
Amplicon SequenceAGGAACTTCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCG
GAGAGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTG
AGAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)169403 - 571
NM_001198 (PRDM1)169815 - 983
Exon 5 To Exon 6 (Pair 493)
Forward (1086,21)AGGCTTCACTACCCTTATCCCAmplicon SizecDNA: 73 bpgenomic: 5,345
Reverse (1158,22)GTTGCTTTAGACTGCTCTGTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.452 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops1.348 kcal/mol in 3' area
Reverse Dimers-0.293 kcal/mol
Forward-Reverse Dimers-1.512 kcal/mol
Amplicon Folding0.903 kcal/mol inside primersite
Amplicon SequenceAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAATCTCACACAAACACAGAGC
AGTCTAAAGCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)73441 - 513
NM_001198 (PRDM1)73853 - 925
Exon 5 To Exon 6 (Pair 492)
Forward (1005,24)ATGAACATCTACTTCTACACCATTAmplicon SizecDNA: 218 bpgenomic: 5,490
Reverse (1222,22)TCTTTCACGCTGTACTCTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.145 kcal/mol
Forward Dimers-0.674 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-0.875 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGG
TATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATG
AATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGC
CCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)218360 - 577
NM_001198 (PRDM1)218772 - 989
Exon 5 To Exon 6 (Pair 491)
Forward (1086,21)AGGCTTCACTACCCTTATCCCAmplicon SizecDNA: 72 bpgenomic: 5,344
Reverse (1157,23)TTGCTTTAGACTGCTCTGTGTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.452 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops1.348 kcal/mol
Reverse Dimers-0.293 kcal/mol
Forward-Reverse Dimers-1.512 kcal/mol
Amplicon Folding0.903 kcal/mol inside primersite
Amplicon SequenceAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAATCTCACACAAACACAGAGC
AGTCTAAAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)72853 - 924
NM_182907 (PRDM1)72441 - 512
Exon 5 To Exon 6 (Pair 490)
Forward (1005,24)ATGAACATCTACTTCTACACCATTAmplicon SizecDNA: 215 bpgenomic: 5,487
Reverse (1219,22)TTCACGCTGTACTCTCTCTTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.145 kcal/mol
Forward Dimers-0.674 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-0.875 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGG
TATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATG
AATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGC
CCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)215360 - 574
NM_001198 (PRDM1)215772 - 986
Exon 5 To Exon 6 (Pair 489)
Forward (1061,21)GTGGTATTGTCGGGACTTTGCAmplicon SizecDNA: 159 bpgenomic: 5,431
Reverse (1219,22)TTCACGCTGTACTCTCTCTTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers0.066 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.469 kcal/mol
Amplicon Folding0.448 kcal/mol inside primersite
Amplicon SequenceGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAAT
GATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACT
CTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)159416 - 574
NM_001198 (PRDM1)159828 - 986
Exon 5 To Exon 6 (Pair 488)
Forward (1052,22)ACTTCTTGTGTGGTATTGTCGGAmplicon SizecDNA: 168 bpgenomic: 5,440
Reverse (1219,22)TTCACGCTGTACTCTCTCTTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.584 kcal/mol
Forward Dimers0.114 kcal/mol in 3' area
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding0.448 kcal/mol inside primersite
Amplicon SequenceACTTCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGA
GCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAA
AAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)168407 - 574
NM_001198 (PRDM1)168819 - 986
Exon 5 To Exon 6 (Pair 487)
Forward (948,22)TATGTGAATCCAGCACACTCTCAmplicon SizecDNA: 275 bpgenomic: 5,547
Reverse (1222,22)TCTTTCACGCTGTACTCTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.927 kcal/mol
Forward Dimers-1.72 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.891 kcal/mol
Amplicon Folding-0.984 kcal/mol outside primersite
Amplicon SequenceTATGTGAATCCAGCACACTCTCCCCGGGAGCAAAACCTGGCTGCGTGTCAGAACGGGATG
AACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGGTAT
TGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAAT
CTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCCCA
AAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)275303 - 577
NM_001198 (PRDM1)275715 - 989
Exon 5 To Exon 6 (Pair 486)
Forward (991,21)CGTGTCAGAACGGGATGAACAAmplicon SizecDNA: 237 bpgenomic: 5,509
Reverse (1227,22)GGATTTCTTTCACGCTGTACTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.248 kcal/mol
Forward Dimers-1.042 kcal/mol
Reverse Loops1.854 kcal/mol in 3' area
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceCGTGTCAGAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGG
AACTTCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAG
AGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGA
AAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)237346 - 582
NM_001198 (PRDM1)237758 - 994
Exon 5 To Exon 6 (Pair 485)
Forward (1058,22)TGTGTGGTATTGTCGGGACTTTAmplicon SizecDNA: 160 bpgenomic: 5,432
Reverse (1217,21)CACGCTGTACTCTCTCTTTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol in 3' area
Forward Dimers0.066 kcal/mol in 3' area
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-0.681 kcal/mol
Amplicon Folding0.448 kcal/mol inside primersite
Amplicon SequenceTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGAC
AATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGA
ACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)160825 - 984
NM_182907 (PRDM1)160413 - 572
Exon 5 To Exon 6 (Pair 484)
Forward (1056,21)CTTGTGTGGTATTGTCGGGACAmplicon SizecDNA: 141 bpgenomic: 5,413
Reverse (1196,22)GACATTCTTTGGGCAGAGTTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.98 kcal/mol in 3' area
Forward Dimers0.084 kcal/mol in 3' area
Reverse Loops1.705 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.035 kcal/mol
Amplicon Folding0.448 kcal/mol inside primersite
Amplicon SequenceCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTG
ACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAAT
GAACTCTGCCCAAAGAATGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)141411 - 551
NM_001198 (PRDM1)141823 - 963
Exon 5 To Exon 6 (Pair 483)
Forward (1001,22)CGGGATGAACATCTACTTCTACAmplicon SizecDNA: 225 bpgenomic: 5,497
Reverse (1225,23)ATTTCTTTCACGCTGTACTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-1.26 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.164 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceCGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGT
GTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAAT
GATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACT
CTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)225768 - 992
NM_182907 (PRDM1)225356 - 580
Exon 5 To Exon 6 (Pair 481)
Forward (1107,22)GGAGAGCTGACAATGATGAATCAmplicon SizecDNA: 100 bpgenomic: 5,372
Reverse (1206,22)CTCTCTTTGGGACATTCTTTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.052 kcal/mol
Amplicon Folding0.666 kcal/mol outside primersite
Amplicon SequenceGGAGAGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACT
GAGAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)100874 - 973
NM_182907 (PRDM1)100462 - 561
Exon 5 To Exon 6 (Pair 482)
Forward (999,23)AACGGGATGAACATCTACTTCTAAmplicon SizecDNA: 174 bpgenomic: 5,446
Reverse (1172,22)TTTCTCAGTGCTCGGTTGCTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-1.26 kcal/mol
Reverse Loops1.665 kcal/mol in 3' area
Reverse Dimers-0.967 kcal/mol
Forward-Reverse Dimers-1.509 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTT
GTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACA
ATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)174354 - 527
NM_001198 (PRDM1)174766 - 939
Exon 5 To Exon 6 (Pair 480)
Forward (998,22)GAACGGGATGAACATCTACTTCAmplicon SizecDNA: 222 bpgenomic: 5,494
Reverse (1219,22)TTCACGCTGTACTCTCTCTTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-1.26 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.706 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceGAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCT
TGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGAC
AATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGA
ACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)222765 - 986
NM_182907 (PRDM1)222353 - 574
Exon 5 To Exon 6 (Pair 479)
Forward (944,21)GCGCTATGTGAATCCAGCACAAmplicon SizecDNA: 280 bpgenomic: 5,552
Reverse (1223,22)TTCTTTCACGCTGTACTCTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.941 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.951 kcal/mol
Amplicon Folding-0.984 kcal/mol outside primersite
Amplicon SequenceGCGCTATGTGAATCCAGCACACTCTCCCCGGGAGCAAAACCTGGCTGCGTGTCAGAACGG
GATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTG
GTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGAT
GAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTG
CCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)280299 - 578
NM_001198 (PRDM1)280711 - 990
Exon 5 To Exon 6 (Pair 478)
Forward (1061,21)GTGGTATTGTCGGGACTTTGCAmplicon SizecDNA: 161 bpgenomic: 5,433
Reverse (1221,22)CTTTCACGCTGTACTCTCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.828 kcal/mol
Forward Dimers0.066 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.469 kcal/mol
Amplicon Folding0.448 kcal/mol inside primersite
Amplicon SequenceGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAAT
GATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACT
CTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)161828 - 988
NM_182907 (PRDM1)161416 - 576
Exon 5 To Exon 6 (Pair 477)
Forward (998,22)GAACGGGATGAACATCTACTTCAmplicon SizecDNA: 163 bpgenomic: 5,435
Reverse (1160,21)CGGTTGCTTTAGACTGCTCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-1.26 kcal/mol
Reverse Loops1.348 kcal/mol in 3' area
Reverse Dimers-0.293 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceGAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCT
TGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGAC
AATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)163765 - 927
NM_182907 (PRDM1)163353 - 515
Exon 5 To Exon 6 (Pair 476)
Forward (1086,21)AGGCTTCACTACCCTTATCCCAmplicon SizecDNA: 145 bpgenomic: 5,417
Reverse (1230,23)TTAGGATTTCTTTCACGCTGTACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.452 kcal/mol
Forward Dimers-1.543 kcal/mol
Reverse Loops1.362 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.869 kcal/mol
Amplicon Folding0.666 kcal/mol outside primersite
Amplicon SequenceAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAATCTCACACAAACACAGAGC
AGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGA
GAGTACAGCGTGAAAGAAATCCTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)145853 - 997
NM_182907 (PRDM1)145441 - 585
Exon 5 To Exon 6 (Pair 475)
Forward (944,21)GCGCTATGTGAATCCAGCACAAmplicon SizecDNA: 266 bpgenomic: 5,538
Reverse (1209,23)ACTCTCTCTTTGGGACATTCTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.941 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.955 kcal/mol
Amplicon Folding-0.984 kcal/mol outside primersite
Amplicon SequenceGCGCTATGTGAATCCAGCACACTCTCCCCGGGAGCAAAACCTGGCTGCGTGTCAGAACGG
GATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTG
GTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGAT
GAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTG
CCCAAAGAATGTCCCAAAGAGAGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)266299 - 564
NM_001198 (PRDM1)266711 - 976
Exon 5 To Exon 6 (Pair 474)
Forward (998,22)GAACGGGATGAACATCTACTTCAmplicon SizecDNA: 219 bpgenomic: 5,491
Reverse (1216,21)ACGCTGTACTCTCTCTTTGGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.332 kcal/mol
Forward Dimers-1.26 kcal/mol
Reverse Loops2.328 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-0.875 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceGAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCT
TGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGAC
AATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGA
ACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)219765 - 983
NM_182907 (PRDM1)219353 - 571
Exon 5 To Exon 6 (Pair 473)
Forward (1007,24)GAACATCTACTTCTACACCATTAAAmplicon SizecDNA: 263 bpgenomic: 5,535
Reverse (1269,21)GGTAGAGGTCCTTTCCTTTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops0.512 kcal/mol in 3' area
Reverse Dimers-2.62 kcal/mol
Forward-Reverse Dimers-2.574 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGGTA
TTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAA
TCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCCC
AAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCTAAAATTGGACTCCAACCC
CTCCAAAGGAAAGGACCTCTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)263362 - 624
NM_001198 (PRDM1)263774 - 1036
Exon 5 To Exon 6 (Pair 472)
Forward (948,22)TATGTGAATCCAGCACACTCTCAmplicon SizecDNA: 283 bpgenomic: 5,555
Reverse (1230,23)TTAGGATTTCTTTCACGCTGTACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.927 kcal/mol
Forward Dimers-1.72 kcal/mol
Reverse Loops1.362 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.733 kcal/mol
Amplicon Folding-0.984 kcal/mol outside primersite
Amplicon SequenceTATGTGAATCCAGCACACTCTCCCCGGGAGCAAAACCTGGCTGCGTGTCAGAACGGGATG
AACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGGTAT
TGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAAT
CTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCCCA
AAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCTAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)283303 - 585
NM_001198 (PRDM1)283715 - 997
Exon 5 To Exon 6 (Pair 471)
Forward (1007,24)GAACATCTACTTCTACACCATTAAAmplicon SizecDNA: 189 bpgenomic: 5,461
Reverse (1195,23)ACATTCTTTGGGCAGAGTTCATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.705 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGGTA
TTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGAA
TCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCCC
AAAGAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)189362 - 550
NM_001198 (PRDM1)189774 - 962
Exon 5 To Exon 6 (Pair 470)
Forward (989,21)TGCGTGTCAGAACGGGATGAAAmplicon SizecDNA: 285 bpgenomic: 5,557
Reverse (1273,21)GAACGGTAGAGGTCCTTTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.416 kcal/mol
Reverse Loops1.017 kcal/mol in 3' area
Reverse Dimers-2.62 kcal/mol
Forward-Reverse Dimers-1.875 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceTGCGTGTCAGAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCA
GGAACTTCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGG
AGAGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGA
GAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCT
AAAATTGGACTCCAACCCCTCCAAAGGAAAGGACCTCTACCGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)285756 - 1040
NM_182907 (PRDM1)285344 - 628
Exon 5 To Exon 6 (Pair 469)
Forward (1066,22)ATTGTCGGGACTTTGCAGAAAGAmplicon SizecDNA: 267 bpgenomic: 5,539
Reverse (1332,21)GGCTCCCACGTCTTCTAAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.255 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.969 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-2.174 kcal/mol
Amplicon Folding0.3 kcal/mol outside primersite
Amplicon SequenceATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGA
ATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCC
CAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCTAAAATTGGACTCCAACC
CCTCCAAAGGAAAGGACCTCTACCGTTCTAACATTTCACCCCTCACATCAGAAAAGGACC
TCGATGACTTTAGAAGACGTGGGAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)267421 - 687
NM_001198 (PRDM1)267833 - 1099
Exon 5 To Exon 6 (Pair 468)
Forward (1004,23)GATGAACATCTACTTCTACACCAAmplicon SizecDNA: 203 bpgenomic: 5,475
Reverse (1206,22)CTCTCTTTGGGACATTCTTTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.582 kcal/mol
Forward Dimers-1.237 kcal/mol
Reverse Loops0.696 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.692 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTG
GTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGAT
GAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTG
CCCAAAGAATGTCCCAAAGAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)203359 - 561
NM_001198 (PRDM1)203771 - 973
Exon 5 To Exon 6 (Pair 467)
Forward (989,21)TGCGTGTCAGAACGGGATGAAAmplicon SizecDNA: 278 bpgenomic: 5,550
Reverse (1266,21)AGAGGTCCTTTCCTTTGGAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.874 kcal/mol
Forward Dimers-1.416 kcal/mol
Reverse Loops0.512 kcal/mol
Reverse Dimers-2.62 kcal/mol
Forward-Reverse Dimers-0.824 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceTGCGTGTCAGAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCA
GGAACTTCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGG
AGAGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGA
GAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCT
AAAATTGGACTCCAACCCCTCCAAAGGAAAGGACCTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)278344 - 621
NM_001198 (PRDM1)278756 - 1033
Exon 5 To Exon 6 (Pair 466)
Forward (1006,24)TGAACATCTACTTCTACACCATTAAmplicon SizecDNA: 218 bpgenomic: 5,490
Reverse (1223,22)TTCTTTCACGCTGTACTCTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-0.875 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceTGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGGT
ATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATGA
ATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGCC
CAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)218773 - 990
NM_182907 (PRDM1)218361 - 578
Exon 5 To Exon 6 (Pair 465)
Forward (1001,22)CGGGATGAACATCTACTTCTACAmplicon SizecDNA: 273 bpgenomic: 5,545
Reverse (1273,21)GAACGGTAGAGGTCCTTTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.559 kcal/mol
Forward Dimers-1.26 kcal/mol
Reverse Loops1.017 kcal/mol in 3' area
Reverse Dimers-2.62 kcal/mol
Forward-Reverse Dimers-2.591 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceCGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGT
GTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAAT
GATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACT
CTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCTAAAATTGGACTC
CAACCCCTCCAAAGGAAAGGACCTCTACCGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)273356 - 628
NM_001198 (PRDM1)273768 - 1040
Exon 5 To Exon 6 (Pair 464)
Forward (1005,24)ATGAACATCTACTTCTACACCATTAmplicon SizecDNA: 266 bpgenomic: 5,538
Reverse (1270,21)CGGTAGAGGTCCTTTCCTTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.145 kcal/mol
Forward Dimers-0.674 kcal/mol
Reverse Loops0.512 kcal/mol in 3' area
Reverse Dimers-2.62 kcal/mol
Forward-Reverse Dimers-2.591 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGGAACTTCTTGTGTGG
TATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGAGCTGACAATGATG
AATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAAAAATGAACTCTGC
CCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCTAAAATTGGACTCCAAC
CCCTCCAAAGGAAAGGACCTCTACCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)266772 - 1037
NM_182907 (PRDM1)266360 - 625
Exon 5 To Exon 6 (Pair 463)
Forward (1109,23)AGAGCTGACAATGATGAATCTCAAmplicon SizecDNA: 164 bpgenomic: 5,436
Reverse (1272,22)AACGGTAGAGGTCCTTTCCTTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.512 kcal/mol in 3' area
Reverse Dimers-2.62 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding0.3 kcal/mol inside primersite
Amplicon SequenceAGAGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGA
GAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCT
AAAATTGGACTCCAACCCCTCCAAAGGAAAGGACCTCTACCGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)164876 - 1039
NM_182907 (PRDM1)164464 - 627
Exon 5 To Exon 6 (Pair 462)
Forward (1109,23)AGAGCTGACAATGATGAATCTCAAmplicon SizecDNA: 165 bpgenomic: 5,437
Reverse (1273,21)GAACGGTAGAGGTCCTTTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.017 kcal/mol in 3' area
Reverse Dimers-2.62 kcal/mol
Forward-Reverse Dimers-1.45 kcal/mol
Amplicon Folding0.3 kcal/mol inside primersite
Amplicon SequenceAGAGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGA
GAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATCCT
AAAATTGGACTCCAACCCCTCCAAAGGAAAGGACCTCTACCGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)165464 - 628
NM_001198 (PRDM1)165876 - 1040
Exon 5 To Exon 6 (Pair 461)
Forward (991,21)CGTGTCAGAACGGGATGAACAAmplicon SizecDNA: 235 bpgenomic: 5,507
Reverse (1225,23)ATTTCTTTCACGCTGTACTCTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.248 kcal/mol
Forward Dimers-1.042 kcal/mol
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.914 kcal/mol outside primersite
Amplicon SequenceCGTGTCAGAACGGGATGAACATCTACTTCTACACCATTAAGCCCATCCCTGCCAACCAGG
AACTTCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAG
AGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGA
AAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)235346 - 580
NM_001198 (PRDM1)235758 - 992
Exon 5 To Exon 6 (Pair 460)
Forward (1052,22)ACTTCTTGTGTGGTATTGTCGGAmplicon SizecDNA: 172 bpgenomic: 5,444
Reverse (1223,22)TTCTTTCACGCTGTACTCTCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.584 kcal/mol
Forward Dimers0.114 kcal/mol in 3' area
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-1.001 kcal/mol
Amplicon Folding0.448 kcal/mol inside primersite
Amplicon SequenceACTTCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGA
GCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAA
AAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)172407 - 578
NM_001198 (PRDM1)172819 - 990
Exon 5 To Exon 6 (Pair 459)
Forward (1052,22)ACTTCTTGTGTGGTATTGTCGGAmplicon SizecDNA: 166 bpgenomic: 5,438
Reverse (1217,21)CACGCTGTACTCTCTCTTTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.584 kcal/mol
Forward Dimers0.114 kcal/mol in 3' area
Reverse Loops1.854 kcal/mol
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-0.681 kcal/mol
Amplicon Folding0.448 kcal/mol inside primersite
Amplicon SequenceACTTCTTGTGTGGTATTGTCGGGACTTTGCAGAAAGGCTTCACTACCCTTATCCCGGAGA
GCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACTGAGAA
AAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_182907 (PRDM1)166407 - 572
NM_001198 (PRDM1)166819 - 984
Exon 5 To Exon 6 (Pair 458)
Forward (1107,22)GGAGAGCTGACAATGATGAATCAmplicon SizecDNA: 224 bpgenomic: 5,496
Reverse (1330,22)CTCCCACGTCTTCTAAAGTCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.95 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.678 kcal/mol
Amplicon Folding0.3 kcal/mol outside primersite
Amplicon SequenceGGAGAGCTGACAATGATGAATCTCACACAAACACAGAGCAGTCTAAAGCAACCGAGCACT
GAGAAAAATGAACTCTGCCCAAAGAATGTCCCAAAGAGAGAGTACAGCGTGAAAGAAATC
CTAAAATTGGACTCCAACCCCTCCAAAGGAAAGGACCTCTACCGTTCTAACATTTCACCC
CTCACATCAGAAAAGGACCTCGATGACTTTAGAAGACGTGGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001198 (PRDM1)224874 - 1097
NM_182907 (PRDM1)224462 - 685
 

See below for some more details.

Program Output:

Loading ...