Design Results for PTBP1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size400
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 13 To Exon 15 (Pair 1)
Forward (1572,23)CTCCAAGAACTTCCAGAACATATAmplicon SizecDNA: 164 bpgenomic: 2,017
Reverse (1735,20)GGATCAGTGCCATCTTGCGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol in 3' area
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCC
GCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAA
AGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1641432 - 1595
NM_031990 (PTBP1)1641489 - 1652
NM_002819 (PTBP1)1641510 - 1673
Exon 13 To Exon 15 (Pair 2)
Forward (1571,22)GCTCCAAGAACTTCCAGAACATAmplicon SizecDNA: 182 bpgenomic: 2,035
Reverse (1752,19)CTCCACGGAGCCCATCTGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.215 kcal/mol in 3' area
Reverse Dimers-1.002 kcal/mol
Forward-Reverse Dimers-2.972 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCC
CGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCA
AAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGG
AG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1821509 - 1690
NM_031990 (PTBP1)1821488 - 1669
NM_031991 (PTBP1)1821431 - 1612
Exon 13 To Exon 15 (Pair 3)
Forward (1569,21)GGGCTCCAAGAACTTCCAGAAAmplicon SizecDNA: 161 bpgenomic: 2,014
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACAT
CCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGT
CAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1611507 - 1667
NM_031991 (PTBP1)1611429 - 1589
NM_031990 (PTBP1)1611486 - 1646
Exon 13 To Exon 14 (Pair 1)
Forward (1521,20)CCTGACCAAGGACTACGGCAAmplicon SizecDNA: 181 bpgenomic: 1,961
Reverse (1701,21)CTTGAATCCTTTGACGACGCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.136 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.717 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCTGACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAA
CTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGT
CTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAA
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1811381 - 1561
NM_031990 (PTBP1)1811438 - 1618
NM_002819 (PTBP1)1811459 - 1639
Exon 13 To Exon 15 (Pair 4)
Forward (1606,19)GCCACGCTGCACCTCTCCAAmplicon SizecDNA: 136 bpgenomic: 1,989
Reverse (1741,21)CCATCTGGATCAGTGCCATCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops0.98 kcal/mol
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTG
TTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATG
GCACTGATCCAGATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1361544 - 1679
NM_031991 (PTBP1)1361466 - 1601
NM_031990 (PTBP1)1361523 - 1658
Exon 13 To Exon 15 (Pair 5)
Forward (1574,23)CCAAGAACTTCCAGAACATATTCAmplicon SizecDNA: 162 bpgenomic: 2,015
Reverse (1735,20)GGATCAGTGCCATCTTGCGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol in 3' area
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGC
CCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAG
GATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1621434 - 1595
NM_031990 (PTBP1)1621491 - 1652
NM_002819 (PTBP1)1621512 - 1673
Exon 13 To Exon 15 (Pair 6)
Forward (1567,20)CCGGGCTCCAAGAACTTCCAAmplicon SizecDNA: 163 bpgenomic: 2,016
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.594 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAAC
ATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTC
GTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1631427 - 1589
NM_031990 (PTBP1)1631484 - 1646
NM_002819 (PTBP1)1631505 - 1667
Exon 13 To Exon 15 (Pair 7)
Forward (1525,21)ACCAAGGACTACGGCAACTCAAmplicon SizecDNA: 221 bpgenomic: 2,074
Reverse (1745,20)GAGCCCATCTGGATCAGTGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.815 kcal/mol
Forward Dimers-0.934 kcal/mol
Reverse Loops0.367 kcal/mol
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTC
CAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCC
GAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTC
TTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)2211442 - 1662
NM_031991 (PTBP1)2211385 - 1605
NM_002819 (PTBP1)2211463 - 1683
Exon 13 To Exon 15 (Pair 8)
Forward (1569,21)GGGCTCCAAGAACTTCCAGAAAmplicon SizecDNA: 163 bpgenomic: 2,016
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACAT
CCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGT
CAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1631429 - 1591
NM_031990 (PTBP1)1631486 - 1648
NM_002819 (PTBP1)1631507 - 1669
Exon 13 To Exon 15 (Pair 9)
Forward (1610,20)CGCTGCACCTCTCCAACATCAmplicon SizecDNA: 132 bpgenomic: 1,985
Reverse (1741,21)CCATCTGGATCAGTGCCATCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops0.98 kcal/mol
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTT
CCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
TGATCCAGATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1321548 - 1679
NM_031991 (PTBP1)1321470 - 1601
NM_031990 (PTBP1)1321527 - 1658
Exon 13 To Exon 15 (Pair 10)
Forward (1567,20)CCGGGCTCCAAGAACTTCCAAmplicon SizecDNA: 177 bpgenomic: 2,030
Reverse (1743,20)GCCCATCTGGATCAGTGCCANr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.594 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops0.446 kcal/mol
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-2.845 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAAC
ATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTC
GTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1771484 - 1660
NM_031991 (PTBP1)1771427 - 1603
NM_002819 (PTBP1)1771505 - 1681
Exon 13 To Exon 15 (Pair 11)
Forward (1547,20)CCCTGCACCGCTTCAAGAAGAmplicon SizecDNA: 192 bpgenomic: 2,045
Reverse (1738,21)TCTGGATCAGTGCCATCTTGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.679 kcal/mol
Reverse Dimers-0.968 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGG
CCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGT
TTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGG
CACTGATCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1921485 - 1676
NM_031990 (PTBP1)1921464 - 1655
NM_031991 (PTBP1)1921407 - 1598
Exon 13 To Exon 15 (Pair 12)
Forward (1611,20)GCTGCACCTCTCCAACATCCAmplicon SizecDNA: 131 bpgenomic: 1,984
Reverse (1741,21)CCATCTGGATCAGTGCCATCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops0.98 kcal/mol
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTC
CAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACT
GATCCAGATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1311549 - 1679
NM_031991 (PTBP1)1311471 - 1601
NM_031990 (PTBP1)1311528 - 1658
Exon 13 To Exon 15 (Pair 13)
Forward (1612,20)CTGCACCTCTCCAACATCCCAmplicon SizecDNA: 141 bpgenomic: 1,994
Reverse (1752,19)CTCCACGGAGCCCATCTGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.215 kcal/mol in 3' area
Reverse Dimers-1.002 kcal/mol
Forward-Reverse Dimers-1.733 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCC
AGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
ATCCAGATGGGCTCCGTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1411529 - 1669
NM_031991 (PTBP1)1411472 - 1612
NM_002819 (PTBP1)1411550 - 1690
Exon 13 To Exon 15 (Pair 14)
Forward (1608,20)CACGCTGCACCTCTCCAACAAmplicon SizecDNA: 122 bpgenomic: 1,975
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.556 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTT
TTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGC
AC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1221468 - 1589
NM_031990 (PTBP1)1221525 - 1646
NM_002819 (PTBP1)1221546 - 1667
Exon 13 To Exon 14 (Pair 2)
Forward (1569,21)GGGCTCCAAGAACTTCCAGAAAmplicon SizecDNA: 133 bpgenomic: 1,913
Reverse (1701,21)CTTGAATCCTTTGACGACGCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.095 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.825 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACAT
CCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGT
CAAAGGATTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1331429 - 1561
NM_031990 (PTBP1)1331486 - 1618
NM_002819 (PTBP1)1331507 - 1639
Exon 13 To Exon 15 (Pair 15)
Forward (1567,20)CCGGGCTCCAAGAACTTCCAAmplicon SizecDNA: 169 bpgenomic: 2,022
Reverse (1735,20)GGATCAGTGCCATCTTGCGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.594 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.563 kcal/mol in 3' area
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAAC
ATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTC
GTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 13 To Exon 15 (Pair 16)
Forward (1570,21)GGCTCCAAGAACTTCCAGAACAmplicon SizecDNA: 166 bpgenomic: 2,019
Reverse (1735,20)GGATCAGTGCCATCTTGCGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol in 3' area
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.729 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATC
CCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTC
AAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 13 To Exon 15 (Pair 17)
Forward (1610,20)CGCTGCACCTCTCCAACATCAmplicon SizecDNA: 137 bpgenomic: 1,990
Reverse (1746,20)GGAGCCCATCTGGATCAGTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops0.09 kcal/mol in 3' area
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-1.686 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTT
CCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
TGATCCAGATGGGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1371548 - 1684
NM_031990 (PTBP1)1371527 - 1663
NM_031991 (PTBP1)1371470 - 1606
Exon 13 To Exon 15 (Pair 18)
Forward (1525,21)ACCAAGGACTACGGCAACTCAAmplicon SizecDNA: 229 bpgenomic: 2,082
Reverse (1753,19)CCTCCACGGAGCCCATCTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.815 kcal/mol
Forward Dimers-0.934 kcal/mol
Reverse Loops0.979 kcal/mol
Reverse Dimers-1.424 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTC
CAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCC
GAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTC
TTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)2291442 - 1670
NM_031991 (PTBP1)2291385 - 1613
NM_002819 (PTBP1)2291463 - 1691
Exon 13 To Exon 15 (Pair 19)
Forward (1570,21)GGCTCCAAGAACTTCCAGAACAmplicon SizecDNA: 160 bpgenomic: 2,013
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.729 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATC
CCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTC
AAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1601430 - 1589
NM_031990 (PTBP1)1601487 - 1646
NM_002819 (PTBP1)1601508 - 1667
Exon 13 To Exon 15 (Pair 20)
Forward (1611,20)GCTGCACCTCTCCAACATCCAmplicon SizecDNA: 128 bpgenomic: 1,981
Reverse (1738,21)TCTGGATCAGTGCCATCTTGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.679 kcal/mol
Reverse Dimers-0.968 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTC
CAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACT
GATCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1281549 - 1676
NM_031991 (PTBP1)1281471 - 1598
NM_031990 (PTBP1)1281528 - 1655
Exon 13 To Exon 15 (Pair 21)
Forward (1571,22)GCTCCAAGAACTTCCAGAACATAmplicon SizecDNA: 161 bpgenomic: 2,014
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCC
CGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCA
AAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1611509 - 1669
NM_031990 (PTBP1)1611488 - 1648
NM_031991 (PTBP1)1611431 - 1591
Exon 13 To Exon 15 (Pair 22)
Forward (1603,19)TCGGCCACGCTGCACCTCTAmplicon SizecDNA: 129 bpgenomic: 1,982
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.964 kcal/mol
Forward Dimers-2.704 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTC
CTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAG
ATGGCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1291541 - 1669
NM_031990 (PTBP1)1291520 - 1648
NM_031991 (PTBP1)1291463 - 1591
Exon 13 To Exon 15 (Pair 23)
Forward (1603,19)TCGGCCACGCTGCACCTCTAmplicon SizecDNA: 127 bpgenomic: 1,980
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.964 kcal/mol
Forward Dimers-2.704 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTC
CTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAG
ATGGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1271541 - 1667
NM_031991 (PTBP1)1271463 - 1589
NM_031990 (PTBP1)1271520 - 1646
Exon 13 To Exon 15 (Pair 24)
Forward (1603,19)TCGGCCACGCTGCACCTCTAmplicon SizecDNA: 150 bpgenomic: 2,003
Reverse (1752,19)CTCCACGGAGCCCATCTGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.964 kcal/mol
Forward Dimers-2.704 kcal/mol
Reverse Loops1.215 kcal/mol in 3' area
Reverse Dimers-1.002 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTC
CTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAG
ATGGCACTGATCCAGATGGGCTCCGTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1501463 - 1612
NM_031990 (PTBP1)1501520 - 1669
NM_002819 (PTBP1)1501541 - 1690
Exon 13 To Exon 15 (Pair 25)
Forward (1608,20)CACGCTGCACCTCTCCAACAAmplicon SizecDNA: 131 bpgenomic: 1,984
Reverse (1738,21)TCTGGATCAGTGCCATCTTGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.556 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops1.679 kcal/mol
Reverse Dimers-0.968 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTT
TTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGC
ACTGATCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1311525 - 1655
NM_031991 (PTBP1)1311468 - 1598
NM_002819 (PTBP1)1311546 - 1676
Exon 13 To Exon 14 (Pair 3)
Forward (1606,19)GCCACGCTGCACCTCTCCAAmplicon SizecDNA: 96 bpgenomic: 1,876
Reverse (1701,21)CTTGAATCCTTTGACGACGCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.518 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTG
TTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)961544 - 1639
NM_031990 (PTBP1)961523 - 1618
NM_031991 (PTBP1)961466 - 1561
Exon 13 To Exon 15 (Pair 26)
Forward (1547,20)CCCTGCACCGCTTCAAGAAGAmplicon SizecDNA: 206 bpgenomic: 2,059
Reverse (1752,19)CTCCACGGAGCCCATCTGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.215 kcal/mol in 3' area
Reverse Dimers-1.002 kcal/mol
Forward-Reverse Dimers-2.858 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGG
CCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGT
TTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGG
CACTGATCCAGATGGGCTCCGTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)2061485 - 1690
NM_031990 (PTBP1)2061464 - 1669
NM_031991 (PTBP1)2061407 - 1612
Exon 13 To Exon 15 (Pair 27)
Forward (1525,21)ACCAAGGACTACGGCAACTCAAmplicon SizecDNA: 211 bpgenomic: 2,064
Reverse (1735,20)GGATCAGTGCCATCTTGCGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.815 kcal/mol
Forward Dimers-0.934 kcal/mol
Reverse Loops1.563 kcal/mol in 3' area
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.417 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTC
CAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCC
GAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTC
TTCCAGAAGGACCGCAAGATGGCACTGATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)2111385 - 1595
NM_031990 (PTBP1)2111442 - 1652
NM_002819 (PTBP1)2111463 - 1673
Exon 13 To Exon 15 (Pair 28)
Forward (1525,21)ACCAAGGACTACGGCAACTCAAmplicon SizecDNA: 222 bpgenomic: 2,075
Reverse (1746,20)GGAGCCCATCTGGATCAGTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.815 kcal/mol
Forward Dimers-0.934 kcal/mol
Reverse Loops0.09 kcal/mol in 3' area
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-1.8 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTC
CAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCC
GAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTC
TTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)2221442 - 1663
NM_031991 (PTBP1)2221385 - 1606
NM_002819 (PTBP1)2221463 - 1684
Exon 13 To Exon 14 (Pair 4)
Forward (1574,23)CCAAGAACTTCCAGAACATATTCAmplicon SizecDNA: 128 bpgenomic: 1,908
Reverse (1701,21)CTTGAATCCTTTGACGACGCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.825 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGC
CCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAG
GATTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1281512 - 1639
NM_031990 (PTBP1)1281491 - 1618
NM_031991 (PTBP1)1281434 - 1561
Exon 13 To Exon 15 (Pair 29)
Forward (1611,20)GCTGCACCTCTCCAACATCCAmplicon SizecDNA: 142 bpgenomic: 1,995
Reverse (1752,19)CTCCACGGAGCCCATCTGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.215 kcal/mol in 3' area
Reverse Dimers-1.002 kcal/mol
Forward-Reverse Dimers-1.733 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTC
CAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACT
GATCCAGATGGGCTCCGTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1421549 - 1690
NM_031991 (PTBP1)1421471 - 1612
NM_031990 (PTBP1)1421528 - 1669
Exon 13 To Exon 15 (Pair 30)
Forward (1525,21)ACCAAGGACTACGGCAACTCAAmplicon SizecDNA: 214 bpgenomic: 2,067
Reverse (1738,21)TCTGGATCAGTGCCATCTTGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.815 kcal/mol
Forward Dimers-0.934 kcal/mol
Reverse Loops1.679 kcal/mol
Reverse Dimers-0.968 kcal/mol
Forward-Reverse Dimers-2.417 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTC
CAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCC
GAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTC
TTCCAGAAGGACCGCAAGATGGCACTGATCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)2141463 - 1676
NM_031991 (PTBP1)2141385 - 1598
NM_031990 (PTBP1)2141442 - 1655
Exon 13 To Exon 15 (Pair 31)
Forward (1610,20)CGCTGCACCTCTCCAACATCAmplicon SizecDNA: 122 bpgenomic: 1,975
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTT
CCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
TG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1221527 - 1648
NM_031991 (PTBP1)1221470 - 1591
NM_002819 (PTBP1)1221548 - 1669
Exon 13 To Exon 15 (Pair 32)
Forward (1547,20)CCCTGCACCGCTTCAAGAAGAmplicon SizecDNA: 207 bpgenomic: 2,060
Reverse (1753,19)CCTCCACGGAGCCCATCTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops0.979 kcal/mol
Reverse Dimers-1.424 kcal/mol
Forward-Reverse Dimers-2.858 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGG
CCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGT
TTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGG
CACTGATCCAGATGGGCTCCGTGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)2071485 - 1691
NM_031991 (PTBP1)2071407 - 1613
NM_031990 (PTBP1)2071464 - 1670
Exon 13 To Exon 15 (Pair 33)
Forward (1525,21)ACCAAGGACTACGGCAACTCAAmplicon SizecDNA: 228 bpgenomic: 2,081
Reverse (1752,19)CTCCACGGAGCCCATCTGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.815 kcal/mol
Forward Dimers-0.934 kcal/mol
Reverse Loops1.215 kcal/mol in 3' area
Reverse Dimers-1.002 kcal/mol
Forward-Reverse Dimers-1.934 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTC
CAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCC
GAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTC
TTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)2281463 - 1690
NM_031990 (PTBP1)2281442 - 1669
NM_031991 (PTBP1)2281385 - 1612
Exon 13 To Exon 15 (Pair 34)
Forward (1523,21)TGACCAAGGACTACGGCAACTAmplicon SizecDNA: 231 bpgenomic: 2,084
Reverse (1753,19)CCTCCACGGAGCCCATCTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.815 kcal/mol
Forward Dimers-0.934 kcal/mol
Reverse Loops0.979 kcal/mol
Reverse Dimers-1.424 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceTGACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACT
TCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCT
CCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGT
TCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)2311461 - 1691
NM_031991 (PTBP1)2311383 - 1613
NM_031990 (PTBP1)2311440 - 1670
Exon 13 To Exon 15 (Pair 35)
Forward (1610,20)CGCTGCACCTCTCCAACATCAmplicon SizecDNA: 144 bpgenomic: 1,997
Reverse (1753,19)CCTCCACGGAGCCCATCTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops0.979 kcal/mol
Reverse Dimers-1.424 kcal/mol
Forward-Reverse Dimers-1.733 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTT
CCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
TGATCCAGATGGGCTCCGTGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1441548 - 1691
NM_031990 (PTBP1)1441527 - 1670
NM_031991 (PTBP1)1441470 - 1613
Exon 13 To Exon 15 (Pair 36)
Forward (1610,20)CGCTGCACCTCTCCAACATCAmplicon SizecDNA: 126 bpgenomic: 1,979
Reverse (1735,20)GGATCAGTGCCATCTTGCGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol in 3' area
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTT
CCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
TGATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1261470 - 1595
NM_031990 (PTBP1)1261527 - 1652
NM_002819 (PTBP1)1261548 - 1673
Exon 13 To Exon 15 (Pair 37)
Forward (1567,20)CCGGGCTCCAAGAACTTCCAAmplicon SizecDNA: 172 bpgenomic: 2,025
Reverse (1738,21)TCTGGATCAGTGCCATCTTGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.594 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.679 kcal/mol
Reverse Dimers-0.968 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAAC
ATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTC
GTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1721505 - 1676
NM_031990 (PTBP1)1721484 - 1655
NM_031991 (PTBP1)1721427 - 1598
Exon 13 To Exon 15 (Pair 38)
Forward (1571,22)GCTCCAAGAACTTCCAGAACATAmplicon SizecDNA: 159 bpgenomic: 2,012
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.639 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCC
CGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCA
AAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1591509 - 1667
NM_031990 (PTBP1)1591488 - 1646
NM_031991 (PTBP1)1591431 - 1589
Exon 13 To Exon 15 (Pair 39)
Forward (1603,19)TCGGCCACGCTGCACCTCTAmplicon SizecDNA: 151 bpgenomic: 2,004
Reverse (1753,19)CCTCCACGGAGCCCATCTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.964 kcal/mol
Forward Dimers-2.704 kcal/mol
Reverse Loops0.979 kcal/mol
Reverse Dimers-1.424 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTC
CTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAG
ATGGCACTGATCCAGATGGGCTCCGTGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1511463 - 1613
NM_031990 (PTBP1)1511520 - 1670
NM_002819 (PTBP1)1511541 - 1691
Exon 13 To Exon 15 (Pair 40)
Forward (1611,20)GCTGCACCTCTCCAACATCCAmplicon SizecDNA: 119 bpgenomic: 1,972
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.818 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTC
CAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1191549 - 1667
NM_031991 (PTBP1)1191471 - 1589
NM_031990 (PTBP1)1191528 - 1646
Exon 13 To Exon 15 (Pair 41)
Forward (1612,20)CTGCACCTCTCCAACATCCCAmplicon SizecDNA: 124 bpgenomic: 1,977
Reverse (1735,20)GGATCAGTGCCATCTTGCGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol in 3' area
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCC
AGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
ATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1241529 - 1652
NM_031991 (PTBP1)1241472 - 1595
NM_002819 (PTBP1)1241550 - 1673
Exon 13 To Exon 15 (Pair 42)
Forward (1611,20)GCTGCACCTCTCCAACATCCAmplicon SizecDNA: 121 bpgenomic: 1,974
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTC
CAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACT
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1211471 - 1591
NM_031990 (PTBP1)1211528 - 1648
NM_002819 (PTBP1)1211549 - 1669
Exon 13 To Exon 15 (Pair 43)
Forward (1610,20)CGCTGCACCTCTCCAACATCAmplicon SizecDNA: 129 bpgenomic: 1,982
Reverse (1738,21)TCTGGATCAGTGCCATCTTGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.679 kcal/mol
Reverse Dimers-0.968 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTT
CCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
TGATCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1291470 - 1598
NM_031990 (PTBP1)1291527 - 1655
NM_002819 (PTBP1)1291548 - 1676
Exon 13 To Exon 15 (Pair 44)
Forward (1611,20)GCTGCACCTCTCCAACATCCAmplicon SizecDNA: 143 bpgenomic: 1,996
Reverse (1753,19)CCTCCACGGAGCCCATCTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops0.979 kcal/mol
Reverse Dimers-1.424 kcal/mol
Forward-Reverse Dimers-1.733 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTC
CAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACT
GATCCAGATGGGCTCCGTGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1431549 - 1691
NM_031990 (PTBP1)1431528 - 1670
NM_031991 (PTBP1)1431471 - 1613
Exon 13 To Exon 15 (Pair 45)
Forward (1567,20)CCGGGCTCCAAGAACTTCCAAmplicon SizecDNA: 165 bpgenomic: 2,018
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.594 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAAC
ATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTC
GTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1651505 - 1669
NM_031991 (PTBP1)1651427 - 1591
NM_031990 (PTBP1)1651484 - 1648
Exon 13 To Exon 15 (Pair 46)
Forward (1606,19)GCCACGCTGCACCTCTCCAAmplicon SizecDNA: 133 bpgenomic: 1,986
Reverse (1738,21)TCTGGATCAGTGCCATCTTGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops1.679 kcal/mol
Reverse Dimers-0.968 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTG
TTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATG
GCACTGATCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1331523 - 1655
NM_031991 (PTBP1)1331466 - 1598
NM_002819 (PTBP1)1331544 - 1676
Exon 13 To Exon 15 (Pair 47)
Forward (1612,20)CTGCACCTCTCCAACATCCCAmplicon SizecDNA: 142 bpgenomic: 1,995
Reverse (1753,19)CCTCCACGGAGCCCATCTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops0.979 kcal/mol
Reverse Dimers-1.424 kcal/mol
Forward-Reverse Dimers-1.733 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCC
AGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
ATCCAGATGGGCTCCGTGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1421472 - 1613
NM_031990 (PTBP1)1421529 - 1670
NM_002819 (PTBP1)1421550 - 1691
Exon 13 To Exon 15 (Pair 48)
Forward (1571,22)GCTCCAAGAACTTCCAGAACATAmplicon SizecDNA: 165 bpgenomic: 2,018
Reverse (1735,20)GGATCAGTGCCATCTTGCGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol in 3' area
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCC
CGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCA
AAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1651488 - 1652
NM_031991 (PTBP1)1651431 - 1595
NM_002819 (PTBP1)1651509 - 1673
Exon 13 To Exon 15 (Pair 49)
Forward (1574,23)CCAAGAACTTCCAGAACATATTCAmplicon SizecDNA: 156 bpgenomic: 2,009
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.639 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGC
CCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAG
GATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1561434 - 1589
NM_031990 (PTBP1)1561491 - 1646
NM_002819 (PTBP1)1561512 - 1667
Exon 13 To Exon 15 (Pair 50)
Forward (1608,20)CACGCTGCACCTCTCCAACAAmplicon SizecDNA: 134 bpgenomic: 1,987
Reverse (1741,21)CCATCTGGATCAGTGCCATCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.556 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops0.98 kcal/mol
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTT
TTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGC
ACTGATCCAGATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1341546 - 1679
NM_031990 (PTBP1)1341525 - 1658
NM_031991 (PTBP1)1341468 - 1601
Exon 13 To Exon 15 (Pair 51)
Forward (1521,20)CCTGACCAAGGACTACGGCAAmplicon SizecDNA: 233 bpgenomic: 2,086
Reverse (1753,19)CCTCCACGGAGCCCATCTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.136 kcal/mol
Forward Dimers-1.402 kcal/mol
Reverse Loops0.979 kcal/mol
Reverse Dimers-1.424 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCTGACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAA
CTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGT
CTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAA
GTTCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)2331381 - 1613
NM_031990 (PTBP1)2331438 - 1670
NM_002819 (PTBP1)2331459 - 1691
Exon 13 To Exon 14 (Pair 5)
Forward (1608,20)CACGCTGCACCTCTCCAACAAmplicon SizecDNA: 94 bpgenomic: 1,874
Reverse (1701,21)CTTGAATCCTTTGACGACGCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.556 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.518 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTT
TTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)941525 - 1618
NM_031991 (PTBP1)941468 - 1561
NM_002819 (PTBP1)941546 - 1639
Exon 13 To Exon 15 (Pair 52)
Forward (1612,20)CTGCACCTCTCCAACATCCCAmplicon SizecDNA: 127 bpgenomic: 1,980
Reverse (1738,21)TCTGGATCAGTGCCATCTTGCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.679 kcal/mol
Reverse Dimers-0.968 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCC
AGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
ATCCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1271550 - 1676
NM_031990 (PTBP1)1271529 - 1655
NM_031991 (PTBP1)1271472 - 1598
Exon 13 To Exon 15 (Pair 53)
Forward (1611,20)GCTGCACCTCTCCAACATCCAmplicon SizecDNA: 125 bpgenomic: 1,978
Reverse (1735,20)GGATCAGTGCCATCTTGCGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol in 3' area
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTC
CAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACT
GATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1251528 - 1652
NM_031991 (PTBP1)1251471 - 1595
NM_002819 (PTBP1)1251549 - 1673
Exon 13 To Exon 15 (Pair 54)
Forward (1572,23)CTCCAAGAACTTCCAGAACATATAmplicon SizecDNA: 160 bpgenomic: 2,013
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCC
GCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAA
AGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1601510 - 1669
NM_031990 (PTBP1)1601489 - 1648
NM_031991 (PTBP1)1601432 - 1591
Exon 13 To Exon 15 (Pair 55)
Forward (1606,19)GCCACGCTGCACCTCTCCAAmplicon SizecDNA: 124 bpgenomic: 1,977
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTG
TTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATG
GCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1241544 - 1667
NM_031991 (PTBP1)1241466 - 1589
NM_031990 (PTBP1)1241523 - 1646
Exon 13 To Exon 15 (Pair 56)
Forward (1570,21)GGCTCCAAGAACTTCCAGAACAmplicon SizecDNA: 162 bpgenomic: 2,015
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.729 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATC
CCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTC
AAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1621508 - 1669
NM_031991 (PTBP1)1621430 - 1591
NM_031990 (PTBP1)1621487 - 1648
Exon 13 To Exon 14 (Pair 6)
Forward (1570,21)GGCTCCAAGAACTTCCAGAACAmplicon SizecDNA: 132 bpgenomic: 1,912
Reverse (1701,21)CTTGAATCCTTTGACGACGCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.095 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.825 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATC
CCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTC
AAAGGATTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1321430 - 1561
NM_031990 (PTBP1)1321487 - 1618
NM_002819 (PTBP1)1321508 - 1639
Exon 13 To Exon 15 (Pair 57)
Forward (1612,20)CTGCACCTCTCCAACATCCCAmplicon SizecDNA: 120 bpgenomic: 1,973
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCC
AGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1201529 - 1648
NM_031991 (PTBP1)1201472 - 1591
NM_002819 (PTBP1)1201550 - 1669
Exon 13 To Exon 14 (Pair 7)
Forward (1571,22)GCTCCAAGAACTTCCAGAACATAmplicon SizecDNA: 131 bpgenomic: 1,911
Reverse (1701,21)CTTGAATCCTTTGACGACGCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.825 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCC
CGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCA
AAGGATTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1311431 - 1561
NM_031990 (PTBP1)1311488 - 1618
NM_002819 (PTBP1)1311509 - 1639
Exon 13 To Exon 15 (Pair 58)
Forward (1608,20)CACGCTGCACCTCTCCAACAAmplicon SizecDNA: 124 bpgenomic: 1,977
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.556 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTT
TTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGC
ACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1241525 - 1648
NM_031991 (PTBP1)1241468 - 1591
NM_002819 (PTBP1)1241546 - 1669
Exon 13 To Exon 15 (Pair 59)
Forward (1572,23)CTCCAAGAACTTCCAGAACATATAmplicon SizecDNA: 182 bpgenomic: 2,035
Reverse (1753,19)CCTCCACGGAGCCCATCTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops0.979 kcal/mol
Reverse Dimers-1.424 kcal/mol
Forward-Reverse Dimers-1.428 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCC
GCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAA
AGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGGA
GG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1821489 - 1670
NM_031991 (PTBP1)1821432 - 1613
NM_002819 (PTBP1)1821510 - 1691
Exon 13 To Exon 15 (Pair 60)
Forward (1612,20)CTGCACCTCTCCAACATCCCAmplicon SizecDNA: 130 bpgenomic: 1,983
Reverse (1741,21)CCATCTGGATCAGTGCCATCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops0.98 kcal/mol
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCC
AGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
ATCCAGATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1301529 - 1658
NM_031991 (PTBP1)1301472 - 1601
NM_002819 (PTBP1)1301550 - 1679
Exon 13 To Exon 15 (Pair 61)
Forward (1569,21)GGGCTCCAAGAACTTCCAGAAAmplicon SizecDNA: 167 bpgenomic: 2,020
Reverse (1735,20)GGATCAGTGCCATCTTGCGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol in 3' area
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol in 3' area
Reverse Dimers-0.734 kcal/mol
Forward-Reverse Dimers-2.02 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACAT
CCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGT
CAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 13 To Exon 15 (Pair 62)
Forward (1610,20)CGCTGCACCTCTCCAACATCAmplicon SizecDNA: 120 bpgenomic: 1,973
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.818 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTT
CCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1201470 - 1589
NM_031990 (PTBP1)1201527 - 1646
NM_002819 (PTBP1)1201548 - 1667
Exon 13 To Exon 15 (Pair 63)
Forward (1571,22)GCTCCAAGAACTTCCAGAACATAmplicon SizecDNA: 183 bpgenomic: 2,036
Reverse (1753,19)CCTCCACGGAGCCCATCTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops0.979 kcal/mol
Reverse Dimers-1.424 kcal/mol
Forward-Reverse Dimers-2.972 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCC
CGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCA
AAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGG
AGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1831509 - 1691
NM_031991 (PTBP1)1831431 - 1613
NM_031990 (PTBP1)1831488 - 1670
Exon 13 To Exon 15 (Pair 64)
Forward (1547,20)CCCTGCACCGCTTCAAGAAGAmplicon SizecDNA: 195 bpgenomic: 2,048
Reverse (1741,21)CCATCTGGATCAGTGCCATCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops0.98 kcal/mol
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-2.145 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGG
CCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGT
TTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGG
CACTGATCCAGATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1951464 - 1658
NM_031991 (PTBP1)1951407 - 1601
NM_002819 (PTBP1)1951485 - 1679
Exon 13 To Exon 14 (Pair 8)
Forward (1603,19)TCGGCCACGCTGCACCTCTAmplicon SizecDNA: 99 bpgenomic: 1,879
Reverse (1701,21)CTTGAATCCTTTGACGACGCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.964 kcal/mol
Forward Dimers-2.704 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.518 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTC
CTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)991463 - 1561
NM_031990 (PTBP1)991520 - 1618
NM_002819 (PTBP1)991541 - 1639
Exon 13 To Exon 14 (Pair 9)
Forward (1572,23)CTCCAAGAACTTCCAGAACATATAmplicon SizecDNA: 130 bpgenomic: 1,910
Reverse (1701,21)CTTGAATCCTTTGACGACGCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.825 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCC
GCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAA
AGGATTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1301489 - 1618
NM_031991 (PTBP1)1301432 - 1561
NM_002819 (PTBP1)1301510 - 1639
Exon 13 To Exon 15 (Pair 65)
Forward (1610,20)CGCTGCACCTCTCCAACATCAmplicon SizecDNA: 143 bpgenomic: 1,996
Reverse (1752,19)CTCCACGGAGCCCATCTGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.215 kcal/mol in 3' area
Reverse Dimers-1.002 kcal/mol
Forward-Reverse Dimers-1.733 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTT
CCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
TGATCCAGATGGGCTCCGTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1431548 - 1690
NM_031990 (PTBP1)1431527 - 1669
NM_031991 (PTBP1)1431470 - 1612
Exon 13 To Exon 15 (Pair 66)
Forward (1606,19)GCCACGCTGCACCTCTCCAAmplicon SizecDNA: 126 bpgenomic: 1,979
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-2.173 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTG
TTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATG
GCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1261544 - 1669
NM_031990 (PTBP1)1261523 - 1648
NM_031991 (PTBP1)1261466 - 1591
Exon 13 To Exon 14 (Pair 10)
Forward (1567,20)CCGGGCTCCAAGAACTTCCAAmplicon SizecDNA: 135 bpgenomic: 1,915
Reverse (1701,21)CTTGAATCCTTTGACGACGCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.594 kcal/mol in 3' area
Forward Dimers-1.956 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.825 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAAC
ATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTC
GTCAAAGGATTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1351427 - 1561
NM_031990 (PTBP1)1351484 - 1618
NM_002819 (PTBP1)1351505 - 1639
Exon 13 To Exon 15 (Pair 67)
Forward (1574,23)CCAAGAACTTCCAGAACATATTCAmplicon SizecDNA: 158 bpgenomic: 2,011
Reverse (1731,20)CAGTGCCATCTTGCGGTCCTNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGC
CCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAG
GATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)1581434 - 1591
NM_031990 (PTBP1)1581491 - 1648
NM_002819 (PTBP1)1581512 - 1669
Exon 13 To Exon 15 (Pair 68)
Forward (1572,23)CTCCAAGAACTTCCAGAACATATAmplicon SizecDNA: 158 bpgenomic: 2,011
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.543 kcal/mol
Forward Dimers-1.095 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.639 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCC
GCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAA
AGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)1581489 - 1646
NM_031991 (PTBP1)1581432 - 1589
NM_002819 (PTBP1)1581510 - 1667
Exon 13 To Exon 14 (Pair 11)
Forward (1610,20)CGCTGCACCTCTCCAACATCAmplicon SizecDNA: 92 bpgenomic: 1,872
Reverse (1701,21)CTTGAATCCTTTGACGACGCCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.772 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-0.975 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTT
CCAGCAATGGGGGCGTCGTCAAAGGATTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)921527 - 1618
NM_031991 (PTBP1)921470 - 1561
NM_002819 (PTBP1)921548 - 1639
Exon 13 To Exon 15 (Pair 69)
Forward (1523,21)TGACCAAGGACTACGGCAACTAmplicon SizecDNA: 230 bpgenomic: 2,083
Reverse (1752,19)CTCCACGGAGCCCATCTGGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.815 kcal/mol
Forward Dimers-0.934 kcal/mol
Reverse Loops1.215 kcal/mol in 3' area
Reverse Dimers-1.002 kcal/mol
Forward-Reverse Dimers-1.934 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceTGACCAAGGACTACGGCAACTCACCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACT
TCCAGAACATATTCCCGCCCTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCT
CCGAGGAGGATCTCAAGGTCCTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGT
TCTTCCAGAAGGACCGCAAGATGGCACTGATCCAGATGGGCTCCGTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031991 (PTBP1)2301383 - 1612
NM_031990 (PTBP1)2301440 - 1669
NM_002819 (PTBP1)2301461 - 1690
Exon 13 To Exon 15 (Pair 70)
Forward (1612,20)CTGCACCTCTCCAACATCCCAmplicon SizecDNA: 118 bpgenomic: 1,971
Reverse (1729,20)GTGCCATCTTGCGGTCCTTCNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops2.866 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops1.563 kcal/mol
Reverse Dimers-0.134 kcal/mol
Forward-Reverse Dimers-1.818 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGTTTTCC
AGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1181550 - 1667
NM_031991 (PTBP1)1181472 - 1589
NM_031990 (PTBP1)1181529 - 1646
Exon 13 To Exon 15 (Pair 71)
Forward (1603,19)TCGGCCACGCTGCACCTCTAmplicon SizecDNA: 144 bpgenomic: 1,997
Reverse (1746,20)GGAGCCCATCTGGATCAGTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.964 kcal/mol
Forward Dimers-2.704 kcal/mol
Reverse Loops0.09 kcal/mol in 3' area
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-1.534 kcal/mol
Amplicon Folding-1.579 kcal/mol outside primersite
Amplicon SequenceTCGGCCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTC
CTGTTTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAG
ATGGCACTGATCCAGATGGGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002819 (PTBP1)1441541 - 1684
NM_031990 (PTBP1)1441520 - 1663
NM_031991 (PTBP1)1441463 - 1606
Exon 13 To Exon 15 (Pair 72)
Forward (1547,20)CCCTGCACCGCTTCAAGAAGAmplicon SizecDNA: 200 bpgenomic: 2,053
Reverse (1746,20)GGAGCCCATCTGGATCAGTGNr. of Isoforms 3 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.558 kcal/mol in 3' area
Forward Dimers-1.124 kcal/mol
Reverse Loops0.09 kcal/mol in 3' area
Reverse Dimers-1.341 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-1.59 kcal/mol outside primersite
Amplicon SequenceCCCTGCACCGCTTCAAGAAGCCGGGCTCCAAGAACTTCCAGAACATATTCCCGCCCTCGG
CCACGCTGCACCTCTCCAACATCCCGCCCTCAGTCTCCGAGGAGGATCTCAAGGTCCTGT
TTTCCAGCAATGGGGGCGTCGTCAAAGGATTCAAGTTCTTCCAGAAGGACCGCAAGATGG
CACTGATCCAGATGGGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_031990 (PTBP1)2001464 - 1663
NM_031991 (PTBP1)2001407 - 1606
NM_002819 (PTBP1)2001485 - 1684
 

See below for some more details.

Program Output:

Loading ...