Design Results for Padi1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size200
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (313,21)CAGACATGGTCGTATCTGTGGAmplicon SizecDNA: 126 bpgenomic: 1,276
Reverse (438,20)CGACGCCAGTGAGGTAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.591 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops0.707 kcal/mol
Reverse Dimers-0.966 kcal/mol
Forward-Reverse Dimers-1.922 kcal/mol
Amplicon Folding-0.033 kcal/mol outside primersite
Amplicon SequenceCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAGGTGAGGG
TCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTACCTCACTG
GCGTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)126313 - 438
Exon 2 To Exon 4 (Pair 1)
Forward (313,21)CAGACATGGTCGTATCTGTGGAmplicon SizecDNA: 182 bpgenomic: 2,005
Reverse (494,20)CCCTTGGCTCCTCTTCACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.591 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops1.99 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.694 kcal/mol
Amplicon Folding-1.183 kcal/mol outside primersite
Amplicon SequenceCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAGGTGAGGG
TCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTACCTCACTG
GCGTCGATATTTCCCTTGAGGTTGACACAGGCCGCACAGGCAAGGTGAAGAGGAGCCAAG
GG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)182313 - 494
Exon 2 To Exon 4 (Pair 2)
Forward (310,22)ATGCAGACATGGTCGTATCTGTAmplicon SizecDNA: 185 bpgenomic: 2,008
Reverse (494,20)CCCTTGGCTCCTCTTCACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.135 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.99 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.694 kcal/mol
Amplicon Folding-1.183 kcal/mol outside primersite
Amplicon SequenceATGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAGGTGA
GGGTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTACCTCA
CTGGCGTCGATATTTCCCTTGAGGTTGACACAGGCCGCACAGGCAAGGTGAAGAGGAGCC
AAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)185310 - 494
Exon 2 To Exon 3 (Pair 2)
Forward (235,22)TGGAGGTCTTCATGGTCTACAAAmplicon SizecDNA: 200 bpgenomic: 1,350
Reverse (434,20)GCCAGTGAGGTAAAGCACGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.403 kcal/mol in 3' area
Forward Dimers-0.57 kcal/mol
Reverse Loops0.785 kcal/mol
Reverse Dimers-0.966 kcal/mol
Forward-Reverse Dimers-1.427 kcal/mol
Amplicon Folding-2.136 kcal/mol outside primersite
Amplicon SequenceTGGAGGTCTTCATGGTCTACAACCGCACACGTGTGAAAGAGCCCATAGGCAAGGCCCGTT
GGCCGCTAGACACTGATGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAA
AGGACTTCAAGGTGAGGGTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCA
GCGTGCTTTACCTCACTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)200235 - 434
Exon 2 To Exon 4 (Pair 3)
Forward (308,22)TGATGCAGACATGGTCGTATCTAmplicon SizecDNA: 187 bpgenomic: 2,010
Reverse (494,20)CCCTTGGCTCCTCTTCACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.572 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.99 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.694 kcal/mol
Amplicon Folding-1.183 kcal/mol outside primersite
Amplicon SequenceTGATGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAGGT
GAGGGTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTACCT
CACTGGCGTCGATATTTCCCTTGAGGTTGACACAGGCCGCACAGGCAAGGTGAAGAGGAG
CCAAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)187308 - 494
Exon 2 To Exon 3 (Pair 3)
Forward (310,22)ATGCAGACATGGTCGTATCTGTAmplicon SizecDNA: 129 bpgenomic: 1,279
Reverse (438,20)CGACGCCAGTGAGGTAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.135 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops0.707 kcal/mol
Reverse Dimers-0.966 kcal/mol
Forward-Reverse Dimers-1.922 kcal/mol
Amplicon Folding-0.033 kcal/mol outside primersite
Amplicon SequenceATGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAGGTGA
GGGTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTACCTCA
CTGGCGTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)129310 - 438
Exon 2 To Exon 3 (Pair 4)
Forward (312,21)GCAGACATGGTCGTATCTGTGAmplicon SizecDNA: 127 bpgenomic: 1,277
Reverse (438,20)CGACGCCAGTGAGGTAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.202 kcal/mol in 3' area
Forward Dimers-0.994 kcal/mol
Reverse Loops0.707 kcal/mol
Reverse Dimers-0.966 kcal/mol
Forward-Reverse Dimers-1.922 kcal/mol
Amplicon Folding-0.033 kcal/mol outside primersite
Amplicon SequenceGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAGGTGAGG
GTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTACCTCACT
GGCGTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)127312 - 438
Exon 2 To Exon 3 (Pair 5)
Forward (306,22)ACTGATGCAGACATGGTCGTATAmplicon SizecDNA: 133 bpgenomic: 1,283
Reverse (438,20)CGACGCCAGTGAGGTAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.572 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops0.707 kcal/mol
Reverse Dimers-0.966 kcal/mol
Forward-Reverse Dimers-1.956 kcal/mol
Amplicon Folding-0.033 kcal/mol outside primersite
Amplicon SequenceACTGATGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAG
GTGAGGGTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTAC
CTCACTGGCGTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)133306 - 438
Exon 2 To Exon 4 (Pair 4)
Forward (295,20)GGCCGCTAGACACTGATGCAAmplicon SizecDNA: 200 bpgenomic: 2,023
Reverse (494,20)CCCTTGGCTCCTCTTCACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.642 kcal/mol in 3' area
Forward Dimers-1.766 kcal/mol
Reverse Loops1.99 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.851 kcal/mol
Amplicon Folding-1.183 kcal/mol outside primersite
Amplicon SequenceGGCCGCTAGACACTGATGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAA
AGGACTTCAAGGTGAGGGTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCA
GCGTGCTTTACCTCACTGGCGTCGATATTTCCCTTGAGGTTGACACAGGCCGCACAGGCA
AGGTGAAGAGGAGCCAAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)200295 - 494
Exon 2 To Exon 3 (Pair 6)
Forward (314,21)AGACATGGTCGTATCTGTGGGAmplicon SizecDNA: 125 bpgenomic: 1,275
Reverse (438,20)CGACGCCAGTGAGGTAAAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.591 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops0.707 kcal/mol
Reverse Dimers-0.966 kcal/mol
Forward-Reverse Dimers-1.922 kcal/mol
Amplicon Folding-0.033 kcal/mol outside primersite
Amplicon SequenceAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAGGTGAGGGT
CTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTACCTCACTGG
CGTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)125314 - 438
Exon 2 To Exon 3 (Pair 7)
Forward (306,22)ACTGATGCAGACATGGTCGTATAmplicon SizecDNA: 129 bpgenomic: 1,279
Reverse (434,20)GCCAGTGAGGTAAAGCACGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.572 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops0.785 kcal/mol
Reverse Dimers-0.966 kcal/mol
Forward-Reverse Dimers-1.956 kcal/mol
Amplicon Folding-0.033 kcal/mol outside primersite
Amplicon SequenceACTGATGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAG
GTGAGGGTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTAC
CTCACTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)129306 - 434
Exon 2 To Exon 4 (Pair 5)
Forward (294,20)TGGCCGCTAGACACTGATGCAmplicon SizecDNA: 201 bpgenomic: 2,024
Reverse (494,20)CCCTTGGCTCCTCTTCACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.642 kcal/mol in 3' area
Forward Dimers-2.658 kcal/mol
Reverse Loops1.99 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.868 kcal/mol
Amplicon Folding-1.183 kcal/mol outside primersite
Amplicon SequenceTGGCCGCTAGACACTGATGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTA
AAGGACTTCAAGGTGAGGGTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGC
AGCGTGCTTTACCTCACTGGCGTCGATATTTCCCTTGAGGTTGACACAGGCCGCACAGGC
AAGGTGAAGAGGAGCCAAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)201294 - 494
Exon 2 To Exon 3 (Pair 8)
Forward (306,22)ACTGATGCAGACATGGTCGTATAmplicon SizecDNA: 130 bpgenomic: 1,280
Reverse (435,20)CGCCAGTGAGGTAAAGCACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.572 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops0.707 kcal/mol
Reverse Dimers-0.966 kcal/mol
Forward-Reverse Dimers-1.956 kcal/mol
Amplicon Folding-0.033 kcal/mol outside primersite
Amplicon SequenceACTGATGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAG
GTGAGGGTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTAC
CTCACTGGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)130306 - 435
Exon 2 To Exon 3 (Pair 9)
Forward (235,22)TGGAGGTCTTCATGGTCTACAAAmplicon SizecDNA: 201 bpgenomic: 1,351
Reverse (435,20)CGCCAGTGAGGTAAAGCACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.403 kcal/mol in 3' area
Forward Dimers-0.57 kcal/mol
Reverse Loops0.707 kcal/mol
Reverse Dimers-0.966 kcal/mol
Forward-Reverse Dimers-1.427 kcal/mol
Amplicon Folding-2.136 kcal/mol outside primersite
Amplicon SequenceTGGAGGTCTTCATGGTCTACAACCGCACACGTGTGAAAGAGCCCATAGGCAAGGCCCGTT
GGCCGCTAGACACTGATGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAA
AGGACTTCAAGGTGAGGGTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCA
GCGTGCTTTACCTCACTGGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)201235 - 435
Exon 2 To Exon 4 (Pair 6)
Forward (306,22)ACTGATGCAGACATGGTCGTATAmplicon SizecDNA: 189 bpgenomic: 2,012
Reverse (494,20)CCCTTGGCTCCTCTTCACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.572 kcal/mol
Forward Dimers-1.674 kcal/mol
Reverse Loops1.99 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.694 kcal/mol
Amplicon Folding-1.183 kcal/mol outside primersite
Amplicon SequenceACTGATGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAG
GTGAGGGTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTAC
CTCACTGGCGTCGATATTTCCCTTGAGGTTGACACAGGCCGCACAGGCAAGGTGAAGAGG
AGCCAAGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)189306 - 494
Exon 2 To Exon 4 (Pair 7)
Forward (312,21)GCAGACATGGTCGTATCTGTGAmplicon SizecDNA: 183 bpgenomic: 2,006
Reverse (494,20)CCCTTGGCTCCTCTTCACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.202 kcal/mol in 3' area
Forward Dimers-0.994 kcal/mol
Reverse Loops1.99 kcal/mol in 3' area
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.694 kcal/mol
Amplicon Folding-1.183 kcal/mol outside primersite
Amplicon SequenceGCAGACATGGTCGTATCTGTGGGCACAGCCAGTAAGGAATTAAAGGACTTCAAGGTGAGG
GTCTCCTACTTTGGGGAGCAGGAAGACCAAGCTCTGGGCCGCAGCGTGCTTTACCTCACT
GGCGTCGATATTTCCCTTGAGGTTGACACAGGCCGCACAGGCAAGGTGAAGAGGAGCCAA
GGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)183312 - 494
Exon 4 To Exon 5 (Pair 1)
Forward (469,20)CAGGCAAGGTGAAGAGGAGCAmplicon SizecDNA: 100 bpgenomic: 1,482
Reverse (568,21)TGATTGTCCCGGTCACAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.582 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.634 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceCAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGGGCT
ATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)100469 - 568
Exon 4 To Exon 5 (Pair 2)
Forward (475,20)AGGTGAAGAGGAGCCAAGGGAmplicon SizecDNA: 136 bpgenomic: 1,518
Reverse (610,20)GACATCAGCCAGCTGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.728 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.667 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-1.814 kcal/mol
Amplicon Folding-2.682 kcal/mol outside primersite
Amplicon SequenceAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGGGCTATGGGG
CTATCTTGCTGGTGAACTGTGACCGGGACAATCACAGGTCCGCAGAGCCTGACCTCACCC
ACAGCTGGCTGATGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)136475 - 610
Exon 4 To Exon 5 (Pair 3)
Forward (475,20)AGGTGAAGAGGAGCCAAGGGAmplicon SizecDNA: 129 bpgenomic: 1,511
Reverse (603,19)GCCAGCTGTGGGTGAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.728 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops0.667 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-1.814 kcal/mol
Amplicon Folding-2.682 kcal/mol outside primersite
Amplicon SequenceAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGGGCTATGGGG
CTATCTTGCTGGTGAACTGTGACCGGGACAATCACAGGTCCGCAGAGCCTGACCTCACCC
ACAGCTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)129475 - 603
Exon 4 To Exon 5 (Pair 4)
Forward (466,20)GCACAGGCAAGGTGAAGAGGAmplicon SizecDNA: 102 bpgenomic: 1,484
Reverse (567,21)GATTGTCCCGGTCACAGTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.113 kcal/mol
Reverse Loops2.217 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceGCACAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGG
GCTATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)102466 - 567
Exon 4 To Exon 5 (Pair 5)
Forward (466,20)GCACAGGCAAGGTGAAGAGGAmplicon SizecDNA: 101 bpgenomic: 1,483
Reverse (566,21)ATTGTCCCGGTCACAGTTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.113 kcal/mol
Reverse Loops2.32 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceGCACAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGG
GCTATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)101466 - 566
Exon 4 To Exon 5 (Pair 6)
Forward (466,20)GCACAGGCAAGGTGAAGAGGAmplicon SizecDNA: 134 bpgenomic: 1,516
Reverse (599,19)GCTGTGGGTGAGGTCAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.113 kcal/mol
Reverse Loops1.931 kcal/mol in 3' area
Reverse Dimers0.043 kcal/mol in 3' area
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-2.682 kcal/mol outside primersite
Amplicon SequenceGCACAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGG
GCTATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATCACAGGTCCGCAGAGCCTG
ACCTCACCCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)134466 - 599
Exon 4 To Exon 5 (Pair 7)
Forward (465,20)CGCACAGGCAAGGTGAAGAGAmplicon SizecDNA: 104 bpgenomic: 1,486
Reverse (568,21)TGATTGTCCCGGTCACAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.911 kcal/mol
Forward Dimers-1.113 kcal/mol
Reverse Loops1.634 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceCGCACAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAG
GGCTATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)104465 - 568
Exon 4 To Exon 5 (Pair 8)
Forward (465,20)CGCACAGGCAAGGTGAAGAGAmplicon SizecDNA: 135 bpgenomic: 1,517
Reverse (599,19)GCTGTGGGTGAGGTCAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.911 kcal/mol
Forward Dimers-1.113 kcal/mol
Reverse Loops1.931 kcal/mol in 3' area
Reverse Dimers0.043 kcal/mol in 3' area
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-2.682 kcal/mol outside primersite
Amplicon SequenceCGCACAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAG
GGCTATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATCACAGGTCCGCAGAGCCT
GACCTCACCCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)135465 - 599
Exon 4 To Exon 5 (Pair 9)
Forward (469,20)CAGGCAAGGTGAAGAGGAGCAmplicon SizecDNA: 135 bpgenomic: 1,517
Reverse (603,19)GCCAGCTGTGGGTGAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.582 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.667 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.143 kcal/mol
Amplicon Folding-2.682 kcal/mol outside primersite
Amplicon SequenceCAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGGGCT
ATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATCACAGGTCCGCAGAGCCTGACC
TCACCCACAGCTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)135469 - 603
Exon 4 To Exon 5 (Pair 10)
Forward (466,20)GCACAGGCAAGGTGAAGAGGAmplicon SizecDNA: 138 bpgenomic: 1,520
Reverse (603,19)GCCAGCTGTGGGTGAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.113 kcal/mol
Reverse Loops0.667 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-2.682 kcal/mol outside primersite
Amplicon SequenceGCACAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGG
GCTATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATCACAGGTCCGCAGAGCCTG
ACCTCACCCACAGCTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)138466 - 603
Exon 4 To Exon 5 (Pair 11)
Forward (465,20)CGCACAGGCAAGGTGAAGAGAmplicon SizecDNA: 102 bpgenomic: 1,484
Reverse (566,21)ATTGTCCCGGTCACAGTTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.911 kcal/mol
Forward Dimers-1.113 kcal/mol
Reverse Loops2.32 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceCGCACAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAG
GGCTATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)102465 - 566
Exon 4 To Exon 5 (Pair 12)
Forward (465,20)CGCACAGGCAAGGTGAAGAGAmplicon SizecDNA: 152 bpgenomic: 1,534
Reverse (616,19)GCCAGCGACATCAGCCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.911 kcal/mol
Forward Dimers-1.113 kcal/mol
Reverse Loops1.841 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.607 kcal/mol
Amplicon Folding-2.682 kcal/mol outside primersite
Amplicon SequenceCGCACAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAG
GGCTATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATCACAGGTCCGCAGAGCCT
GACCTCACCCACAGCTGGCTGATGTCGCTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)152465 - 616
Exon 4 To Exon 5 (Pair 13)
Forward (465,20)CGCACAGGCAAGGTGAAGAGAmplicon SizecDNA: 103 bpgenomic: 1,485
Reverse (567,21)GATTGTCCCGGTCACAGTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.911 kcal/mol
Forward Dimers-1.113 kcal/mol
Reverse Loops2.217 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceCGCACAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAG
GGCTATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)103465 - 567
Exon 4 To Exon 5 (Pair 14)
Forward (465,20)CGCACAGGCAAGGTGAAGAGAmplicon SizecDNA: 139 bpgenomic: 1,521
Reverse (603,19)GCCAGCTGTGGGTGAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.911 kcal/mol
Forward Dimers-1.113 kcal/mol
Reverse Loops0.667 kcal/mol
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-2.682 kcal/mol outside primersite
Amplicon SequenceCGCACAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAG
GGCTATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATCACAGGTCCGCAGAGCCT
GACCTCACCCACAGCTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)139465 - 603
Exon 4 To Exon 5 (Pair 15)
Forward (469,20)CAGGCAAGGTGAAGAGGAGCAmplicon SizecDNA: 99 bpgenomic: 1,481
Reverse (567,21)GATTGTCCCGGTCACAGTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.582 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops2.217 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceCAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGGGCT
ATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)99469 - 567
Exon 4 To Exon 5 (Pair 16)
Forward (475,20)AGGTGAAGAGGAGCCAAGGGAmplicon SizecDNA: 93 bpgenomic: 1,475
Reverse (567,21)GATTGTCCCGGTCACAGTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.728 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops2.217 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGGGCTATGGGG
CTATCTTGCTGGTGAACTGTGACCGGGACAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)93475 - 567
Exon 4 To Exon 5 (Pair 17)
Forward (475,20)AGGTGAAGAGGAGCCAAGGGAmplicon SizecDNA: 94 bpgenomic: 1,476
Reverse (568,21)TGATTGTCCCGGTCACAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.728 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops1.634 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGGGCTATGGGG
CTATCTTGCTGGTGAACTGTGACCGGGACAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)94475 - 568
Exon 4 To Exon 5 (Pair 18)
Forward (469,20)CAGGCAAGGTGAAGAGGAGCAmplicon SizecDNA: 98 bpgenomic: 1,480
Reverse (566,21)ATTGTCCCGGTCACAGTTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.582 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops2.32 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceCAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGGGCT
ATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)98469 - 566
Exon 4 To Exon 5 (Pair 19)
Forward (475,20)AGGTGAAGAGGAGCCAAGGGAmplicon SizecDNA: 92 bpgenomic: 1,474
Reverse (566,21)ATTGTCCCGGTCACAGTTCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.728 kcal/mol
Forward Dimers-0.724 kcal/mol
Reverse Loops2.32 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGGGCTATGGGG
CTATCTTGCTGGTGAACTGTGACCGGGACAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)92475 - 566
Exon 4 To Exon 5 (Pair 20)
Forward (466,20)GCACAGGCAAGGTGAAGAGGAmplicon SizecDNA: 103 bpgenomic: 1,485
Reverse (568,21)TGATTGTCCCGGTCACAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.113 kcal/mol
Reverse Loops1.634 kcal/mol
Reverse Dimers-2.11 kcal/mol
Forward-Reverse Dimers-1.503 kcal/mol
Amplicon Folding-1.015 kcal/mol outside primersite
Amplicon SequenceGCACAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGG
GCTATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)103466 - 568
Exon 4 To Exon 5 (Pair 21)
Forward (469,20)CAGGCAAGGTGAAGAGGAGCAmplicon SizecDNA: 142 bpgenomic: 1,524
Reverse (610,20)GACATCAGCCAGCTGTGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.582 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops0.667 kcal/mol in 3' area
Reverse Dimers-2.84 kcal/mol
Forward-Reverse Dimers-2.383 kcal/mol
Amplicon Folding-2.682 kcal/mol outside primersite
Amplicon SequenceCAGGCAAGGTGAAGAGGAGCCAAGGGGACAAGAAAACCTGGCGCTGGGGCCCTGAGGGCT
ATGGGGCTATCTTGCTGGTGAACTGTGACCGGGACAATCACAGGTCCGCAGAGCCTGACC
TCACCCACAGCTGGCTGATGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)142469 - 610
Exon 6 To Exon 7 (Pair 1)
Forward (686,21)GCTTGTCTTGAACGTGCCCTTAmplicon SizecDNA: 160 bpgenomic: 2,626
Reverse (845,22)CACATAGAACTTGATCTCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.796 kcal/mol
Forward Dimers-2.808 kcal/mol
Reverse Loops1.436 kcal/mol
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-0.946 kcal/mol
Amplicon Folding-2.153 kcal/mol outside primersite
Amplicon SequenceGCTTGTCTTGAACGTGCCCTTTTCTGATTCCAAAAGAGTGAGGGTCTTCTGTGCCAGGGG
TGGGAATTCTCTCTCGGACTACAAACAGGTGCTGGGGCCCCAGTGTCTGTCCTATGAAGT
TGAGCGACAGCCAGGGGAGCAGGAGATCAAGTTCTATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)160686 - 845
Exon 6 To Exon 7 (Pair 2)
Forward (684,21)AAGCTTGTCTTGAACGTGCCCAmplicon SizecDNA: 162 bpgenomic: 2,628
Reverse (845,22)CACATAGAACTTGATCTCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.129 kcal/mol
Forward Dimers-2.904 kcal/mol
Reverse Loops1.436 kcal/mol
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-0.946 kcal/mol
Amplicon Folding-2.153 kcal/mol outside primersite
Amplicon SequenceAAGCTTGTCTTGAACGTGCCCTTTTCTGATTCCAAAAGAGTGAGGGTCTTCTGTGCCAGG
GGTGGGAATTCTCTCTCGGACTACAAACAGGTGCTGGGGCCCCAGTGTCTGTCCTATGAA
GTTGAGCGACAGCCAGGGGAGCAGGAGATCAAGTTCTATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)162684 - 845
Exon 6 To Exon 7 (Pair 3)
Forward (685,21)AGCTTGTCTTGAACGTGCCCTAmplicon SizecDNA: 162 bpgenomic: 2,628
Reverse (846,22)CCACATAGAACTTGATCTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.595 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops1.436 kcal/mol in 3' area
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-0.946 kcal/mol
Amplicon Folding-2.153 kcal/mol outside primersite
Amplicon SequenceAGCTTGTCTTGAACGTGCCCTTTTCTGATTCCAAAAGAGTGAGGGTCTTCTGTGCCAGGG
GTGGGAATTCTCTCTCGGACTACAAACAGGTGCTGGGGCCCCAGTGTCTGTCCTATGAAG
TTGAGCGACAGCCAGGGGAGCAGGAGATCAAGTTCTATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)162685 - 846
Exon 6 To Exon 7 (Pair 4)
Forward (721,20)GAGTGAGGGTCTTCTGTGCCAmplicon SizecDNA: 125 bpgenomic: 2,591
Reverse (845,22)CACATAGAACTTGATCTCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.432 kcal/mol
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops1.436 kcal/mol
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-2.153 kcal/mol outside primersite
Amplicon SequenceGAGTGAGGGTCTTCTGTGCCAGGGGTGGGAATTCTCTCTCGGACTACAAACAGGTGCTGG
GGCCCCAGTGTCTGTCCTATGAAGTTGAGCGACAGCCAGGGGAGCAGGAGATCAAGTTCT
ATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)125721 - 845
Exon 6 To Exon 7 (Pair 5)
Forward (686,21)GCTTGTCTTGAACGTGCCCTTAmplicon SizecDNA: 161 bpgenomic: 2,627
Reverse (846,22)CCACATAGAACTTGATCTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.796 kcal/mol
Forward Dimers-2.808 kcal/mol
Reverse Loops1.436 kcal/mol in 3' area
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-0.946 kcal/mol
Amplicon Folding-2.153 kcal/mol outside primersite
Amplicon SequenceGCTTGTCTTGAACGTGCCCTTTTCTGATTCCAAAAGAGTGAGGGTCTTCTGTGCCAGGGG
TGGGAATTCTCTCTCGGACTACAAACAGGTGCTGGGGCCCCAGTGTCTGTCCTATGAAGT
TGAGCGACAGCCAGGGGAGCAGGAGATCAAGTTCTATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)161686 - 846
Exon 6 To Exon 7 (Pair 6)
Forward (719,21)AAGAGTGAGGGTCTTCTGTGCAmplicon SizecDNA: 127 bpgenomic: 2,593
Reverse (845,22)CACATAGAACTTGATCTCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.432 kcal/mol in 3' area
Forward Dimers-0.475 kcal/mol
Reverse Loops1.436 kcal/mol
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-2.153 kcal/mol outside primersite
Amplicon SequenceAAGAGTGAGGGTCTTCTGTGCCAGGGGTGGGAATTCTCTCTCGGACTACAAACAGGTGCT
GGGGCCCCAGTGTCTGTCCTATGAAGTTGAGCGACAGCCAGGGGAGCAGGAGATCAAGTT
CTATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)127719 - 845
Exon 6 To Exon 7 (Pair 7)
Forward (685,21)AGCTTGTCTTGAACGTGCCCTAmplicon SizecDNA: 161 bpgenomic: 2,627
Reverse (845,22)CACATAGAACTTGATCTCCTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.595 kcal/mol in 3' area
Forward Dimers-2.808 kcal/mol
Reverse Loops1.436 kcal/mol
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-0.946 kcal/mol
Amplicon Folding-2.153 kcal/mol outside primersite
Amplicon SequenceAGCTTGTCTTGAACGTGCCCTTTTCTGATTCCAAAAGAGTGAGGGTCTTCTGTGCCAGGG
GTGGGAATTCTCTCTCGGACTACAAACAGGTGCTGGGGCCCCAGTGTCTGTCCTATGAAG
TTGAGCGACAGCCAGGGGAGCAGGAGATCAAGTTCTATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)161685 - 845
Exon 6 To Exon 7 (Pair 8)
Forward (719,21)AAGAGTGAGGGTCTTCTGTGCAmplicon SizecDNA: 128 bpgenomic: 2,594
Reverse (846,22)CCACATAGAACTTGATCTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.432 kcal/mol in 3' area
Forward Dimers-0.475 kcal/mol
Reverse Loops1.436 kcal/mol in 3' area
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-2.153 kcal/mol outside primersite
Amplicon SequenceAAGAGTGAGGGTCTTCTGTGCCAGGGGTGGGAATTCTCTCTCGGACTACAAACAGGTGCT
GGGGCCCCAGTGTCTGTCCTATGAAGTTGAGCGACAGCCAGGGGAGCAGGAGATCAAGTT
CTATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)128719 - 846
Exon 6 To Exon 7 (Pair 9)
Forward (684,21)AAGCTTGTCTTGAACGTGCCCAmplicon SizecDNA: 163 bpgenomic: 2,629
Reverse (846,22)CCACATAGAACTTGATCTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.129 kcal/mol
Forward Dimers-2.904 kcal/mol
Reverse Loops1.436 kcal/mol in 3' area
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-0.946 kcal/mol
Amplicon Folding-2.153 kcal/mol outside primersite
Amplicon SequenceAAGCTTGTCTTGAACGTGCCCTTTTCTGATTCCAAAAGAGTGAGGGTCTTCTGTGCCAGG
GGTGGGAATTCTCTCTCGGACTACAAACAGGTGCTGGGGCCCCAGTGTCTGTCCTATGAA
GTTGAGCGACAGCCAGGGGAGCAGGAGATCAAGTTCTATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)163684 - 846
Exon 6 To Exon 7 (Pair 10)
Forward (721,20)GAGTGAGGGTCTTCTGTGCCAmplicon SizecDNA: 126 bpgenomic: 2,592
Reverse (846,22)CCACATAGAACTTGATCTCCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.432 kcal/mol
Forward Dimers0.136 kcal/mol in 3' area
Reverse Loops1.436 kcal/mol in 3' area
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-2.153 kcal/mol outside primersite
Amplicon SequenceGAGTGAGGGTCTTCTGTGCCAGGGGTGGGAATTCTCTCTCGGACTACAAACAGGTGCTGG
GGCCCCAGTGTCTGTCCTATGAAGTTGAGCGACAGCCAGGGGAGCAGGAGATCAAGTTCT
ATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)126721 - 846
Exon 8 To Exon 9 (Pair 1)
Forward (972,21)TGGATCATGACGCCCAACACTAmplicon SizecDNA: 96 bpgenomic: 1,129
Reverse (1067,22)CATGTCCTCCAGGAATTTCTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops0.675 kcal/mol
Reverse Dimers-1.752 kcal/mol
Forward-Reverse Dimers-1.358 kcal/mol
Amplicon Folding-1.855 kcal/mol outside primersite
Amplicon SequenceTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGAC
ACTCATGGCTCCAATGAGAAATTCCTGGAGGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)96972 - 1067
Exon 8 To Exon 10 (Pair 1)
Forward (972,21)TGGATCATGACGCCCAACACTAmplicon SizecDNA: 197 bpgenomic: 1,593
Reverse (1168,22)ATGTAGCCAAACTCCATCTCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops1.077 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.497 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGAC
ACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCAAC
TGCAAGCTGACCATCTGCCCTCAAGTTGAAAATCGAAATGACCGCTGGATCCAGGACGAG
ATGGAGTTTGGCTACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)197972 - 1168
Exon 8 To Exon 10 (Pair 2)
Forward (970,20)CCTGGATCATGACGCCCAACAmplicon SizecDNA: 199 bpgenomic: 1,595
Reverse (1168,22)ATGTAGCCAAACTCCATCTCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol in 3' area
Forward Dimers-1.948 kcal/mol
Reverse Loops1.077 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.497 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCCTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGG
ACACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCA
ACTGCAAGCTGACCATCTGCCCTCAAGTTGAAAATCGAAATGACCGCTGGATCCAGGACG
AGATGGAGTTTGGCTACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)199970 - 1168
Exon 8 To Exon 9 (Pair 2)
Forward (977,20)CATGACGCCCAACACTCAGCAmplicon SizecDNA: 92 bpgenomic: 1,125
Reverse (1068,22)ACATGTCCTCCAGGAATTTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.208 kcal/mol
Reverse Loops0.675 kcal/mol
Reverse Dimers-2.584 kcal/mol
Forward-Reverse Dimers-1.495 kcal/mol
Amplicon Folding-1.855 kcal/mol outside primersite
Amplicon SequenceCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACTCA
TGGCTCCAATGAGAAATTCCTGGAGGACATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)92977 - 1068
Exon 8 To Exon 9 (Pair 3)
Forward (972,21)TGGATCATGACGCCCAACACTAmplicon SizecDNA: 139 bpgenomic: 1,172
Reverse (1110,20)GGCAGATGGTCAGCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops1.171 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.5 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGAC
ACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCAAC
TGCAAGCTGACCATCTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_012387 (PADI4)127914 - 1040
NM_013358 (PADI1)139972 - 1110
NM_016233 (PADI3)127926 - 1052
Exon 8 To Exon 9 (Pair 4)
Forward (969,20)CCCTGGATCATGACGCCCAAAmplicon SizecDNA: 142 bpgenomic: 1,175
Reverse (1110,20)GGCAGATGGTCAGCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol in 3' area
Forward Dimers-1.948 kcal/mol
Reverse Loops1.171 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.5 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCCCTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATG
GACACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCC
AACTGCAAGCTGACCATCTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_016233 (PADI3)130923 - 1052
NM_013358 (PADI1)142969 - 1110
NM_012387 (PADI4)130911 - 1040
Exon 8 To Exon 9 (Pair 5)
Forward (969,20)CCCTGGATCATGACGCCCAAAmplicon SizecDNA: 139 bpgenomic: 1,172
Reverse (1107,21)AGATGGTCAGCTTGCAGTTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol in 3' area
Forward Dimers-1.948 kcal/mol
Reverse Loops2.012 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.5 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCCCTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATG
GACACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCC
AACTGCAAGCTGACCATCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_012387 (PADI4)127911 - 1037
NM_013358 (PADI1)139969 - 1107
NM_016233 (PADI3)127923 - 1049
Exon 8 To Exon 9 (Pair 6)
Forward (977,20)CATGACGCCCAACACTCAGCAmplicon SizecDNA: 126 bpgenomic: 1,159
Reverse (1102,21)GTCAGCTTGCAGTTGGCTTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.208 kcal/mol
Reverse Loops0.612 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.63 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACTCA
TGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCAACTGCAA
GCTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)126977 - 1102
Exon 8 To Exon 9 (Pair 7)
Forward (969,20)CCCTGGATCATGACGCCCAAAmplicon SizecDNA: 141 bpgenomic: 1,174
Reverse (1109,21)GCAGATGGTCAGCTTGCAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol in 3' area
Forward Dimers-1.948 kcal/mol
Reverse Loops1.462 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.5 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCCCTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATG
GACACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCC
AACTGCAAGCTGACCATCTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_013358 (PADI1)141969 - 1109
NM_016233 (PADI3)129923 - 1051
NM_012387 (PADI4)129911 - 1039
Exon 8 To Exon 9 (Pair 8)
Forward (975,21)ATCATGACGCCCAACACTCAGAmplicon SizecDNA: 94 bpgenomic: 1,127
Reverse (1068,22)ACATGTCCTCCAGGAATTTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops0.675 kcal/mol
Reverse Dimers-2.584 kcal/mol
Forward-Reverse Dimers-1.732 kcal/mol
Amplicon Folding-1.855 kcal/mol outside primersite
Amplicon SequenceATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACT
CATGGCTCCAATGAGAAATTCCTGGAGGACATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)94975 - 1068
Exon 8 To Exon 9 (Pair 9)
Forward (974,21)GATCATGACGCCCAACACTCAAmplicon SizecDNA: 129 bpgenomic: 1,162
Reverse (1102,21)GTCAGCTTGCAGTTGGCTTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops0.612 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.63 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACAC
TCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCAACTG
CAAGCTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)129974 - 1102
Exon 8 To Exon 10 (Pair 3)
Forward (982,19)CGCCCAACACTCAGCCTCCAmplicon SizecDNA: 187 bpgenomic: 1,583
Reverse (1168,22)ATGTAGCCAAACTCCATCTCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.136 kcal/mol in 3' area
Forward Dimers-0.049 kcal/mol
Reverse Loops1.077 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.202 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACTCATGGCT
CCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCAACTGCAAGCTGA
CCATCTGCCCTCAAGTTGAAAATCGAAATGACCGCTGGATCCAGGACGAGATGGAGTTTG
GCTACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)187982 - 1168
Exon 8 To Exon 9 (Pair 10)
Forward (978,20)ATGACGCCCAACACTCAGCCAmplicon SizecDNA: 90 bpgenomic: 1,123
Reverse (1067,22)CATGTCCTCCAGGAATTTCTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops0.675 kcal/mol
Reverse Dimers-1.752 kcal/mol
Forward-Reverse Dimers-1.269 kcal/mol
Amplicon Folding-1.855 kcal/mol outside primersite
Amplicon SequenceATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACTCAT
GGCTCCAATGAGAAATTCCTGGAGGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)90978 - 1067
Exon 8 To Exon 9 (Pair 11)
Forward (974,21)GATCATGACGCCCAACACTCAAmplicon SizecDNA: 95 bpgenomic: 1,128
Reverse (1068,22)ACATGTCCTCCAGGAATTTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops0.675 kcal/mol
Reverse Dimers-2.584 kcal/mol
Forward-Reverse Dimers-1.732 kcal/mol
Amplicon Folding-1.855 kcal/mol outside primersite
Amplicon SequenceGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACAC
TCATGGCTCCAATGAGAAATTCCTGGAGGACATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)95974 - 1068
Exon 8 To Exon 9 (Pair 12)
Forward (972,21)TGGATCATGACGCCCAACACTAmplicon SizecDNA: 137 bpgenomic: 1,170
Reverse (1108,21)CAGATGGTCAGCTTGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops2.157 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.5 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGAC
ACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCAAC
TGCAAGCTGACCATCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_012387 (PADI4)125914 - 1038
NM_013358 (PADI1)137972 - 1108
NM_016233 (PADI3)125926 - 1050
Exon 8 To Exon 9 (Pair 13)
Forward (970,20)CCTGGATCATGACGCCCAACAmplicon SizecDNA: 140 bpgenomic: 1,173
Reverse (1109,21)GCAGATGGTCAGCTTGCAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol in 3' area
Forward Dimers-1.948 kcal/mol
Reverse Loops1.462 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.5 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCCTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGG
ACACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCA
ACTGCAAGCTGACCATCTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_016233 (PADI3)128924 - 1051
NM_013358 (PADI1)140970 - 1109
NM_012387 (PADI4)128912 - 1039
Exon 8 To Exon 9 (Pair 14)
Forward (972,21)TGGATCATGACGCCCAACACTAmplicon SizecDNA: 138 bpgenomic: 1,171
Reverse (1109,21)GCAGATGGTCAGCTTGCAGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops1.462 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.5 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGAC
ACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCAAC
TGCAAGCTGACCATCTGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_013358 (PADI1)138972 - 1109
NM_016233 (PADI3)126926 - 1051
NM_012387 (PADI4)126914 - 1039
Exon 8 To Exon 9 (Pair 15)
Forward (977,20)CATGACGCCCAACACTCAGCAmplicon SizecDNA: 91 bpgenomic: 1,124
Reverse (1067,22)CATGTCCTCCAGGAATTTCTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.208 kcal/mol
Reverse Loops0.675 kcal/mol
Reverse Dimers-1.752 kcal/mol
Forward-Reverse Dimers-1.269 kcal/mol
Amplicon Folding-1.855 kcal/mol outside primersite
Amplicon SequenceCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACTCA
TGGCTCCAATGAGAAATTCCTGGAGGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)91977 - 1067
Exon 8 To Exon 9 (Pair 16)
Forward (975,21)ATCATGACGCCCAACACTCAGAmplicon SizecDNA: 136 bpgenomic: 1,169
Reverse (1110,20)GGCAGATGGTCAGCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops1.171 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.473 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACT
CATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCAACTGC
AAGCTGACCATCTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)136975 - 1110
Exon 8 To Exon 9 (Pair 17)
Forward (974,21)GATCATGACGCCCAACACTCAAmplicon SizecDNA: 137 bpgenomic: 1,170
Reverse (1110,20)GGCAGATGGTCAGCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops1.171 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.473 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACAC
TCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCAACTG
CAAGCTGACCATCTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_013358 (PADI1)137974 - 1110
NM_016233 (PADI3)125928 - 1052
Exon 8 To Exon 9 (Pair 18)
Forward (975,21)ATCATGACGCCCAACACTCAGAmplicon SizecDNA: 93 bpgenomic: 1,126
Reverse (1067,22)CATGTCCTCCAGGAATTTCTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops0.675 kcal/mol
Reverse Dimers-1.752 kcal/mol
Forward-Reverse Dimers-1.269 kcal/mol
Amplicon Folding-1.855 kcal/mol outside primersite
Amplicon SequenceATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACT
CATGGCTCCAATGAGAAATTCCTGGAGGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)93975 - 1067
Exon 8 To Exon 9 (Pair 19)
Forward (969,20)CCCTGGATCATGACGCCCAAAmplicon SizecDNA: 140 bpgenomic: 1,173
Reverse (1108,21)CAGATGGTCAGCTTGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol in 3' area
Forward Dimers-1.948 kcal/mol
Reverse Loops2.157 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.5 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCCCTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATG
GACACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCC
AACTGCAAGCTGACCATCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_012387 (PADI4)128911 - 1038
NM_013358 (PADI1)140969 - 1108
NM_016233 (PADI3)128923 - 1050
Exon 8 To Exon 9 (Pair 20)
Forward (975,21)ATCATGACGCCCAACACTCAGAmplicon SizecDNA: 128 bpgenomic: 1,161
Reverse (1102,21)GTCAGCTTGCAGTTGGCTTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops0.612 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-2.63 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACT
CATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCAACTGC
AAGCTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)128975 - 1102
Exon 8 To Exon 9 (Pair 21)
Forward (972,21)TGGATCATGACGCCCAACACTAmplicon SizecDNA: 97 bpgenomic: 1,130
Reverse (1068,22)ACATGTCCTCCAGGAATTTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-1.948 kcal/mol
Reverse Loops0.675 kcal/mol
Reverse Dimers-2.584 kcal/mol
Forward-Reverse Dimers-1.732 kcal/mol
Amplicon Folding-1.855 kcal/mol outside primersite
Amplicon SequenceTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGAC
ACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)97972 - 1068
Exon 8 To Exon 9 (Pair 22)
Forward (970,20)CCTGGATCATGACGCCCAACAmplicon SizecDNA: 139 bpgenomic: 1,172
Reverse (1108,21)CAGATGGTCAGCTTGCAGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol in 3' area
Forward Dimers-1.948 kcal/mol
Reverse Loops2.157 kcal/mol
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.5 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCCTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGG
ACACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCA
ACTGCAAGCTGACCATCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_012387 (PADI4)127912 - 1038
NM_013358 (PADI1)139970 - 1108
NM_016233 (PADI3)127924 - 1050
Exon 8 To Exon 9 (Pair 23)
Forward (978,20)ATGACGCCCAACACTCAGCCAmplicon SizecDNA: 89 bpgenomic: 1,122
Reverse (1066,23)ATGTCCTCCAGGAATTTCTCATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops0.675 kcal/mol
Reverse Dimers-1.752 kcal/mol
Forward-Reverse Dimers-1.269 kcal/mol
Amplicon Folding-1.855 kcal/mol outside primersite
Amplicon SequenceATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACTCAT
GGCTCCAATGAGAAATTCCTGGAGGACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)89978 - 1066
Exon 8 To Exon 9 (Pair 24)
Forward (970,20)CCTGGATCATGACGCCCAACAmplicon SizecDNA: 141 bpgenomic: 1,174
Reverse (1110,20)GGCAGATGGTCAGCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol in 3' area
Forward Dimers-1.948 kcal/mol
Reverse Loops1.171 kcal/mol in 3' area
Reverse Dimers-2.77 kcal/mol
Forward-Reverse Dimers-1.5 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCCTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGG
ACACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCA
ACTGCAAGCTGACCATCTGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_013358 (PADI1)141970 - 1110
NM_016233 (PADI3)129924 - 1052
NM_012387 (PADI4)129912 - 1040
Exon 8 To Exon 10 (Pair 4)
Forward (969,20)CCCTGGATCATGACGCCCAAAmplicon SizecDNA: 200 bpgenomic: 1,596
Reverse (1168,22)ATGTAGCCAAACTCCATCTCGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol in 3' area
Forward Dimers-1.948 kcal/mol
Reverse Loops1.077 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.497 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCCCTGGATCATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATG
GACACTCATGGCTCCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCC
AACTGCAAGCTGACCATCTGCCCTCAAGTTGAAAATCGAAATGACCGCTGGATCCAGGAC
GAGATGGAGTTTGGCTACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)200969 - 1168
Exon 8 To Exon 9 (Pair 25)
Forward (978,20)ATGACGCCCAACACTCAGCCAmplicon SizecDNA: 91 bpgenomic: 1,124
Reverse (1068,22)ACATGTCCTCCAGGAATTTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.458 kcal/mol
Reverse Loops0.675 kcal/mol
Reverse Dimers-2.584 kcal/mol
Forward-Reverse Dimers-1.269 kcal/mol
Amplicon Folding-1.855 kcal/mol outside primersite
Amplicon SequenceATGACGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACTCAT
GGCTCCAATGAGAAATTCCTGGAGGACATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)91978 - 1068
Exon 8 To Exon 10 (Pair 5)
Forward (982,19)CGCCCAACACTCAGCCTCCAmplicon SizecDNA: 185 bpgenomic: 1,581
Reverse (1166,21)GTAGCCAAACTCCATCTCGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.136 kcal/mol in 3' area
Forward Dimers-0.049 kcal/mol
Reverse Loops1.077 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-0.508 kcal/mol
Amplicon Folding-2.098 kcal/mol outside primersite
Amplicon SequenceCGCCCAACACTCAGCCTCCTGAGGAGCTGTATGTGTGCAGAGTGATGGACACTCATGGCT
CCAATGAGAAATTCCTGGAGGACATGTCTTATCTGACATTGAAAGCCAACTGCAAGCTGA
CCATCTGCCCTCAAGTTGAAAATCGAAATGACCGCTGGATCCAGGACGAGATGGAGTTTG
GCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_013358 (PADI1)185982 - 1166
 

See below for some more details.

Program Output:

Loading ...