Design Results for Ppara

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (70,19)GGCCCTGTCTGCTCTGTGGAmplicon SizecDNA: 136 bpgenomic: 24,912
Reverse (205,21)AAGCACGTCCTCACATGACACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.817 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-2.477 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceGGCCCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGC
TGTCACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTC
ATGTGAGGACGTGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13670 - 205
Exon 2 To Exon 4 (Pair 1)
Forward (82,22)TCTGTGGACTCAACAGTTTGTGAmplicon SizecDNA: 178 bpgenomic: 46,459
Reverse (259,20)AGATGGTGCTGGTTGTGCCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops1.226 kcal/mol in 3' area
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-1.165 kcal/mol
Amplicon Folding-2.494 kcal/mol outside primersite
Amplicon SequenceTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCACCACAGT
TCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGT
GCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)17882 - 259
NM_001001928 (PPARA)9482 - 175
Exon 2 To Exon 3 (Pair 2)
Forward (75,21)TGTCTGCTCTGTGGACTCAACAmplicon SizecDNA: 132 bpgenomic: 24,908
Reverse (206,21)GAAGCACGTCCTCACATGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol
Forward Dimers0.043 kcal/mol
Reverse Loops1.817 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-2.477 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCA
CCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTG
AGGACGTGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13275 - 206
Exon 2 To Exon 4 (Pair 2)
Forward (70,19)GGCCCTGTCTGCTCTGTGGAmplicon SizecDNA: 192 bpgenomic: 46,473
Reverse (261,20)CCAGATGGTGCTGGTTGTGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops0.684 kcal/mol
Reverse Dimers-1.641 kcal/mol
Forward-Reverse Dimers-1.085 kcal/mol
Amplicon Folding-2.494 kcal/mol outside primersite
Amplicon SequenceGGCCCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGC
TGTCACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTC
ATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACC
AGCACCATCTGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001001928 (PPARA)10870 - 177
NM_005036 (PPARA)19270 - 261
Exon 2 To Exon 3 (Pair 3)
Forward (82,22)TCTGTGGACTCAACAGTTTGTGAmplicon SizecDNA: 118 bpgenomic: 24,894
Reverse (199,22)GTCCTCACATGACACTGAATCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops1.944 kcal/mol
Reverse Dimers-2.294 kcal/mol
Forward-Reverse Dimers-2.87 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCACCACAGT
TCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)11882 - 199
Exon 2 To Exon 3 (Pair 4)
Forward (75,21)TGTCTGCTCTGTGGACTCAACAmplicon SizecDNA: 130 bpgenomic: 24,906
Reverse (204,21)AGCACGTCCTCACATGACACTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol
Forward Dimers0.043 kcal/mol
Reverse Loops1.817 kcal/mol
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.936 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCA
CCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTG
AGGACGTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13075 - 204
Exon 2 To Exon 3 (Pair 5)
Forward (74,21)CTGTCTGCTCTGTGGACTCAAAmplicon SizecDNA: 101 bpgenomic: 24,877
Reverse (174,22)GGCACTTTGATCTTGAACTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol in 3' area
Forward Dimers0.043 kcal/mol in 3' area
Reverse Loops1.582 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.006 kcal/mol
Amplicon Folding-1.518 kcal/mol outside primersite
Amplicon SequenceCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTC
ACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)10174 - 174
Exon 2 To Exon 3 (Pair 6)
Forward (75,21)TGTCTGCTCTGTGGACTCAACAmplicon SizecDNA: 127 bpgenomic: 24,903
Reverse (201,22)ACGTCCTCACATGACACTGAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol
Forward Dimers0.043 kcal/mol
Reverse Loops1.944 kcal/mol in 3' area
Reverse Dimers-2.294 kcal/mol
Forward-Reverse Dimers-1.496 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCA
CCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTG
AGGACGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)12775 - 201
Exon 2 To Exon 3 (Pair 7)
Forward (74,21)CTGTCTGCTCTGTGGACTCAAAmplicon SizecDNA: 133 bpgenomic: 24,909
Reverse (206,21)GAAGCACGTCCTCACATGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol in 3' area
Forward Dimers0.043 kcal/mol in 3' area
Reverse Loops1.817 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-2.477 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTC
ACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGT
GAGGACGTGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13374 - 206
Exon 2 To Exon 3 (Pair 8)
Forward (85,21)GTGGACTCAACAGTTTGTGGCAmplicon SizecDNA: 124 bpgenomic: 24,900
Reverse (208,21)AGGAAGCACGTCCTCACATGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops0.473 kcal/mol
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.496 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCACCACAGTTCT
GGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCT
TCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)12485 - 208
Exon 2 To Exon 3 (Pair 9)
Forward (75,21)TGTCTGCTCTGTGGACTCAACAmplicon SizecDNA: 134 bpgenomic: 24,910
Reverse (208,21)AGGAAGCACGTCCTCACATGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol
Forward Dimers0.043 kcal/mol
Reverse Loops0.473 kcal/mol
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-2.477 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCA
CCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTG
AGGACGTGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13475 - 208
Exon 2 To Exon 3 (Pair 10)
Forward (70,19)GGCCCTGTCTGCTCTGTGGAmplicon SizecDNA: 105 bpgenomic: 24,881
Reverse (174,22)GGCACTTTGATCTTGAACTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.582 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.717 kcal/mol
Amplicon Folding-1.518 kcal/mol outside primersite
Amplicon SequenceGGCCCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGC
TGTCACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)10570 - 174
Exon 2 To Exon 3 (Pair 11)
Forward (82,22)TCTGTGGACTCAACAGTTTGTGAmplicon SizecDNA: 125 bpgenomic: 24,901
Reverse (206,21)GAAGCACGTCCTCACATGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops1.817 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.496 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCACCACAGT
TCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGT
GCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)12582 - 206
Exon 2 To Exon 3 (Pair 12)
Forward (70,19)GGCCCTGTCTGCTCTGTGGAmplicon SizecDNA: 137 bpgenomic: 24,913
Reverse (206,21)GAAGCACGTCCTCACATGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.817 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-2.477 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceGGCCCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGC
TGTCACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTC
ATGTGAGGACGTGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13770 - 206
Exon 2 To Exon 3 (Pair 13)
Forward (85,21)GTGGACTCAACAGTTTGTGGCAmplicon SizecDNA: 122 bpgenomic: 24,898
Reverse (206,21)GAAGCACGTCCTCACATGACANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops1.817 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.496 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCACCACAGTTCT
GGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCT
TC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)12285 - 206
Exon 2 To Exon 3 (Pair 14)
Forward (74,21)CTGTCTGCTCTGTGGACTCAAAmplicon SizecDNA: 131 bpgenomic: 24,907
Reverse (204,21)AGCACGTCCTCACATGACACTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol in 3' area
Forward Dimers0.043 kcal/mol in 3' area
Reverse Loops1.817 kcal/mol
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.936 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTC
ACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGT
GAGGACGTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13174 - 204
Exon 2 To Exon 3 (Pair 15)
Forward (75,21)TGTCTGCTCTGTGGACTCAACAmplicon SizecDNA: 131 bpgenomic: 24,907
Reverse (205,21)AAGCACGTCCTCACATGACACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol
Forward Dimers0.043 kcal/mol
Reverse Loops1.817 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-2.477 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCA
CCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTG
AGGACGTGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13175 - 205
Exon 2 To Exon 3 (Pair 16)
Forward (85,21)GTGGACTCAACAGTTTGTGGCAmplicon SizecDNA: 120 bpgenomic: 24,896
Reverse (204,21)AGCACGTCCTCACATGACACTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops1.817 kcal/mol
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.496 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCACCACAGTTCT
GGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)12085 - 204
Exon 2 To Exon 3 (Pair 17)
Forward (75,21)TGTCTGCTCTGTGGACTCAACAmplicon SizecDNA: 125 bpgenomic: 24,901
Reverse (199,22)GTCCTCACATGACACTGAATCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol
Forward Dimers0.043 kcal/mol
Reverse Loops1.944 kcal/mol
Reverse Dimers-2.294 kcal/mol
Forward-Reverse Dimers-1.448 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCA
CCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTG
AGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)12575 - 199
Exon 2 To Exon 3 (Pair 18)
Forward (75,21)TGTCTGCTCTGTGGACTCAACAmplicon SizecDNA: 100 bpgenomic: 24,876
Reverse (174,22)GGCACTTTGATCTTGAACTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol
Forward Dimers0.043 kcal/mol
Reverse Loops1.582 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.006 kcal/mol
Amplicon Folding-1.518 kcal/mol outside primersite
Amplicon SequenceTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCA
CCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)10075 - 174
Exon 2 To Exon 3 (Pair 19)
Forward (74,21)CTGTCTGCTCTGTGGACTCAAAmplicon SizecDNA: 135 bpgenomic: 24,911
Reverse (208,21)AGGAAGCACGTCCTCACATGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol in 3' area
Forward Dimers0.043 kcal/mol in 3' area
Reverse Loops0.473 kcal/mol
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-2.477 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTC
ACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGT
GAGGACGTGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13574 - 208
Exon 2 To Exon 3 (Pair 20)
Forward (70,19)GGCCCTGTCTGCTCTGTGGAmplicon SizecDNA: 104 bpgenomic: 24,880
Reverse (173,22)GCACTTTGATCTTGAACTTCCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.582 kcal/mol
Reverse Dimers-0.18 kcal/mol
Forward-Reverse Dimers-0.715 kcal/mol
Amplicon Folding-1.518 kcal/mol outside primersite
Amplicon SequenceGGCCCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGC
TGTCACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)10470 - 173
Exon 2 To Exon 3 (Pair 21)
Forward (70,19)GGCCCTGTCTGCTCTGTGGAmplicon SizecDNA: 139 bpgenomic: 24,915
Reverse (208,21)AGGAAGCACGTCCTCACATGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops0.473 kcal/mol
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-2.477 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceGGCCCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGC
TGTCACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTC
ATGTGAGGACGTGCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13970 - 208
Exon 2 To Exon 3 (Pair 22)
Forward (70,19)GGCCCTGTCTGCTCTGTGGAmplicon SizecDNA: 135 bpgenomic: 24,911
Reverse (204,21)AGCACGTCCTCACATGACACTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-2.004 kcal/mol
Reverse Loops1.817 kcal/mol
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.936 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceGGCCCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGC
TGTCACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTC
ATGTGAGGACGTGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13570 - 204
Exon 2 To Exon 3 (Pair 23)
Forward (82,22)TCTGTGGACTCAACAGTTTGTGAmplicon SizecDNA: 123 bpgenomic: 24,899
Reverse (204,21)AGCACGTCCTCACATGACACTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops1.817 kcal/mol
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.496 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCACCACAGT
TCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGT
GCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)12382 - 204
Exon 2 To Exon 3 (Pair 24)
Forward (85,21)GTGGACTCAACAGTTTGTGGCAmplicon SizecDNA: 115 bpgenomic: 24,891
Reverse (199,22)GTCCTCACATGACACTGAATCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops1.944 kcal/mol
Reverse Dimers-2.294 kcal/mol
Forward-Reverse Dimers-2.87 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCACCACAGTTCT
GGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)11585 - 199
Exon 2 To Exon 3 (Pair 25)
Forward (75,21)TGTCTGCTCTGTGGACTCAACAmplicon SizecDNA: 128 bpgenomic: 24,904
Reverse (202,21)CACGTCCTCACATGACACTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol
Forward Dimers0.043 kcal/mol
Reverse Loops1.944 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.496 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCA
CCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTG
AGGACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)12875 - 202
Exon 2 To Exon 3 (Pair 26)
Forward (74,21)CTGTCTGCTCTGTGGACTCAAAmplicon SizecDNA: 132 bpgenomic: 24,908
Reverse (205,21)AAGCACGTCCTCACATGACACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.476 kcal/mol in 3' area
Forward Dimers0.043 kcal/mol in 3' area
Reverse Loops1.817 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-2.477 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceCTGTCTGCTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTC
ACCACAGTTCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGT
GAGGACGTGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)13274 - 205
Exon 2 To Exon 3 (Pair 27)
Forward (82,22)TCTGTGGACTCAACAGTTTGTGAmplicon SizecDNA: 127 bpgenomic: 24,903
Reverse (208,21)AGGAAGCACGTCCTCACATGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops0.473 kcal/mol
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.496 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCACCACAGT
TCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGT
GCTTCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)12782 - 208
Exon 2 To Exon 3 (Pair 28)
Forward (82,22)TCTGTGGACTCAACAGTTTGTGAmplicon SizecDNA: 124 bpgenomic: 24,900
Reverse (205,21)AAGCACGTCCTCACATGACACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops1.817 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.496 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceTCTGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCACCACAGT
TCTGGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGT
GCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)12482 - 205
Exon 2 To Exon 3 (Pair 29)
Forward (85,21)GTGGACTCAACAGTTTGTGGCAmplicon SizecDNA: 121 bpgenomic: 24,897
Reverse (205,21)AAGCACGTCCTCACATGACACNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.77 kcal/mol
Forward Dimers-1.354 kcal/mol
Reverse Loops1.817 kcal/mol in 3' area
Reverse Dimers-2.898 kcal/mol
Forward-Reverse Dimers-1.496 kcal/mol
Amplicon Folding-2.154 kcal/mol outside primersite
Amplicon SequenceGTGGACTCAACAGTTTGTGGCAAGACAAGCTCAGAACTGAGAAGCTGTCACCACAGTTCT
GGAGGCTGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCT
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)12185 - 205
Exon 3 To Exon 4 (Pair 1)
Forward (169,21)AGTGCCAGCAGATTCAGTGTCAmplicon SizecDNA: 213 bpgenomic: 21,718
Reverse (381,22)GCGAAATCTCTTGGATGTTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.198 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGC
TTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCAC
TCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCC
TGCAAGAAATGGGAAACATCCAAGAGATTTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)213169 - 381
Exon 3 To Exon 4 (Pair 2)
Forward (164,22)ATCAAAGTGCCAGCAGATTCAGAmplicon SizecDNA: 173 bpgenomic: 21,678
Reverse (336,21)ATAACGGGCTCTCTAGATCGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.62 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-2.537 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGA
GTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAG
CCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)173164 - 336
Exon 3 To Exon 4 (Pair 3)
Forward (169,21)AGTGCCAGCAGATTCAGTGTCAmplicon SizecDNA: 206 bpgenomic: 21,711
Reverse (374,23)CTCTTGGATGTTTCCCATTTCTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.198 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGC
TTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCAC
TCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCC
TGCAAGAAATGGGAAACATCCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)206169 - 374
Exon 3 To Exon 4 (Pair 4)
Forward (169,21)AGTGCCAGCAGATTCAGTGTCAmplicon SizecDNA: 215 bpgenomic: 21,720
Reverse (383,23)TTGCGAAATCTCTTGGATGTTTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.198 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGC
TTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCAC
TCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCC
TGCAAGAAATGGGAAACATCCAAGAGATTTCGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)215169 - 383
Exon 3 To Exon 4 (Pair 5)
Forward (153,22)GGAAGTTCAAGATCAAAGTGCCAmplicon SizecDNA: 228 bpgenomic: 21,733
Reverse (380,22)CGAAATCTCTTGGATGTTTCCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.193 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTT
CATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTG
GACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCG
TTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)228153 - 380
Exon 3 To Exon 4 (Pair 6)
Forward (174,22)CAGCAGATTCAGTGTCATGTGAAmplicon SizecDNA: 207 bpgenomic: 21,712
Reverse (380,22)CGAAATCTCTTGGATGTTTCCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGA
GCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGC
CCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAA
GAAATGGGAAACATCCAAGAGATTTCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)207174 - 380
Exon 3 To Exon 4 (Pair 7)
Forward (152,22)GGGAAGTTCAAGATCAAAGTGCAmplicon SizecDNA: 232 bpgenomic: 21,737
Reverse (383,23)TTGCGAAATCTCTTGGATGTTTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.193 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCT
TCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGT
GGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCC
GTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)232152 - 383
Exon 3 To Exon 4 (Pair 8)
Forward (178,22)AGATTCAGTGTCATGTGAGGACAmplicon SizecDNA: 203 bpgenomic: 21,708
Reverse (380,22)CGAAATCTCTTGGATGTTTCCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.979 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-1.998 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTC
GGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCC
TCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAAA
TGGGAAACATCCAAGAGATTTCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)203178 - 380
Exon 3 To Exon 4 (Pair 9)
Forward (172,21)GCCAGCAGATTCAGTGTCATGAmplicon SizecDNA: 172 bpgenomic: 21,677
Reverse (343,22)TCTTCAGATAACGGGCTCTCTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.14 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-2.104 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTG
GAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCT
GCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)172172 - 343
Exon 3 To Exon 4 (Pair 10)
Forward (196,21)GGACGTGCTTCCTGCTTCATAAmplicon SizecDNA: 179 bpgenomic: 21,684
Reverse (374,23)CTCTTGGATGTTTCCCATTTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.913 kcal/mol
Forward Dimers-2.852 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-0.89 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACC
ATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCG
GCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)179196 - 374
Exon 3 To Exon 4 (Pair 11)
Forward (198,22)ACGTGCTTCCTGCTTCATAGATAmplicon SizecDNA: 184 bpgenomic: 21,689
Reverse (381,22)GCGAAATCTCTTGGATGTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.913 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.318 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCAT
CTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGC
GATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATT
TCGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)184198 - 381
Exon 3 To Exon 4 (Pair 12)
Forward (169,21)AGTGCCAGCAGATTCAGTGTCAmplicon SizecDNA: 205 bpgenomic: 21,710
Reverse (373,23)TCTTGGATGTTTCCCATTTCTTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.198 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGC
TTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCAC
TCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCC
TGCAAGAAATGGGAAACATCCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)205169 - 373
Exon 3 To Exon 4 (Pair 13)
Forward (160,22)CAAGATCAAAGTGCCAGCAGATAmplicon SizecDNA: 177 bpgenomic: 21,682
Reverse (336,21)ATAACGGGCTCTCTAGATCGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.182 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.62 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-2.537 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGAT
AAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGG
AAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)177160 - 336
Exon 3 To Exon 4 (Pair 14)
Forward (177,22)CAGATTCAGTGTCATGTGAGGAAmplicon SizecDNA: 167 bpgenomic: 21,672
Reverse (343,22)TCTTCAGATAACGGGCTCTCTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-0.94 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCT
CGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCC
CTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)167177 - 343
Exon 3 To Exon 4 (Pair 15)
Forward (152,22)GGGAAGTTCAAGATCAAAGTGCAmplicon SizecDNA: 105 bpgenomic: 21,610
Reverse (256,19)TGGTGCTGGTTGTGCCGCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.193 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.048 kcal/mol in 3' area
Reverse Dimers0.055 kcal/mol in 3' area
Forward-Reverse Dimers-0.895 kcal/mol
Amplicon Folding-0.34 kcal/mol outside primersite
Amplicon SequenceGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCT
TCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)105152 - 256
Exon 3 To Exon 4 (Pair 16)
Forward (175,22)AGCAGATTCAGTGTCATGTGAGAmplicon SizecDNA: 85 bpgenomic: 21,590
Reverse (259,20)AGATGGTGCTGGTTGTGCCGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.226 kcal/mol in 3' area
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-1.798 kcal/mol
Amplicon Folding-0.34 kcal/mol outside primersite
Amplicon SequenceAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAG
CTCGGCGGCACAACCAGCACCATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)85175 - 259
Exon 3 To Exon 4 (Pair 17)
Forward (157,22)GTTCAAGATCAAAGTGCCAGCAAmplicon SizecDNA: 225 bpgenomic: 21,730
Reverse (381,22)GCGAAATCTCTTGGATGTTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATA
GATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACA
CGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTAT
CTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)225157 - 381
Exon 3 To Exon 4 (Pair 18)
Forward (170,21)GTGCCAGCAGATTCAGTGTCAAmplicon SizecDNA: 211 bpgenomic: 21,716
Reverse (380,22)CGAAATCTCTTGGATGTTTCCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.14 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCT
TGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACT
CTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCT
GCAAGAAATGGGAAACATCCAAGAGATTTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)211170 - 380
Exon 3 To Exon 4 (Pair 19)
Forward (169,21)AGTGCCAGCAGATTCAGTGTCAmplicon SizecDNA: 168 bpgenomic: 21,673
Reverse (336,21)ATAACGGGCTCTCTAGATCGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.198 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.62 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-2.104 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGC
TTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCAC
TCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)168169 - 336
Exon 3 To Exon 4 (Pair 20)
Forward (196,21)GGACGTGCTTCCTGCTTCATAAmplicon SizecDNA: 178 bpgenomic: 21,683
Reverse (373,23)TCTTGGATGTTTCCCATTTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.913 kcal/mol
Forward Dimers-2.852 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-0.89 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACC
ATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCG
GCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)178196 - 373
Exon 3 To Exon 4 (Pair 21)
Forward (152,22)GGGAAGTTCAAGATCAAAGTGCAmplicon SizecDNA: 222 bpgenomic: 21,727
Reverse (373,23)TCTTGGATGTTTCCCATTTCTTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.193 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-2.381 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCT
TCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGT
GGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCC
GTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)222152 - 373
Exon 3 To Exon 4 (Pair 22)
Forward (174,22)CAGCAGATTCAGTGTCATGTGAAmplicon SizecDNA: 208 bpgenomic: 21,713
Reverse (381,22)GCGAAATCTCTTGGATGTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGA
GCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGC
CCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAA
GAAATGGGAAACATCCAAGAGATTTCGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)208174 - 381
Exon 3 To Exon 4 (Pair 23)
Forward (172,21)GCCAGCAGATTCAGTGTCATGAmplicon SizecDNA: 210 bpgenomic: 21,715
Reverse (381,22)GCGAAATCTCTTGGATGTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.14 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTG
GAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCT
GCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGC
AAGAAATGGGAAACATCCAAGAGATTTCGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)210172 - 381
Exon 3 To Exon 4 (Pair 24)
Forward (198,22)ACGTGCTTCCTGCTTCATAGATAmplicon SizecDNA: 146 bpgenomic: 21,651
Reverse (343,22)TCTTCAGATAACGGGCTCTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.913 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-2.043 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCAT
CTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGC
GATCTAGAGAGCCCGTTATCTGAAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)146198 - 343
Exon 3 To Exon 4 (Pair 25)
Forward (170,21)GTGCCAGCAGATTCAGTGTCAAmplicon SizecDNA: 206 bpgenomic: 21,711
Reverse (375,23)TCTCTTGGATGTTTCCCATTTCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.14 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.657 kcal/mol in 3' area
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCT
TGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACT
CTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCT
GCAAGAAATGGGAAACATCCAAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)206170 - 375
Exon 3 To Exon 4 (Pair 26)
Forward (174,22)CAGCAGATTCAGTGTCATGTGAAmplicon SizecDNA: 170 bpgenomic: 21,675
Reverse (343,22)TCTTCAGATAACGGGCTCTCTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-2.104 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGA
GCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGC
CCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)170174 - 343
Exon 3 To Exon 4 (Pair 27)
Forward (170,21)GTGCCAGCAGATTCAGTGTCAAmplicon SizecDNA: 174 bpgenomic: 21,679
Reverse (343,22)TCTTCAGATAACGGGCTCTCTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.14 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-2.104 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCT
TGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACT
CTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)174170 - 343
Exon 3 To Exon 4 (Pair 28)
Forward (169,21)AGTGCCAGCAGATTCAGTGTCAmplicon SizecDNA: 207 bpgenomic: 21,712
Reverse (375,23)TCTCTTGGATGTTTCCCATTTCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.198 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.657 kcal/mol in 3' area
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGC
TTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCAC
TCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCC
TGCAAGAAATGGGAAACATCCAAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)207169 - 375
Exon 3 To Exon 4 (Pair 29)
Forward (158,22)TTCAAGATCAAAGTGCCAGCAGAmplicon SizecDNA: 216 bpgenomic: 21,721
Reverse (373,23)TCTTGGATGTTTCCCATTTCTTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.59 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAG
ATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACAC
GGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATC
TGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)216158 - 373
Exon 3 To Exon 4 (Pair 30)
Forward (175,22)AGCAGATTCAGTGTCATGTGAGAmplicon SizecDNA: 162 bpgenomic: 21,667
Reverse (336,21)ATAACGGGCTCTCTAGATCGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.62 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.63 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAG
CTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCC
CCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)162175 - 336
Exon 3 To Exon 4 (Pair 31)
Forward (157,22)GTTCAAGATCAAAGTGCCAGCAAmplicon SizecDNA: 218 bpgenomic: 21,723
Reverse (374,23)CTCTTGGATGTTTCCCATTTCTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.59 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATA
GATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACA
CGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTAT
CTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)218157 - 374
Exon 3 To Exon 4 (Pair 32)
Forward (175,22)AGCAGATTCAGTGTCATGTGAGAmplicon SizecDNA: 209 bpgenomic: 21,714
Reverse (383,23)TTGCGAAATCTCTTGGATGTTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAG
CTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCC
CCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAG
AAATGGGAAACATCCAAGAGATTTCGCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)209175 - 383
Exon 3 To Exon 4 (Pair 33)
Forward (157,22)GTTCAAGATCAAAGTGCCAGCAAmplicon SizecDNA: 219 bpgenomic: 21,724
Reverse (375,23)TCTCTTGGATGTTTCCCATTTCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.657 kcal/mol in 3' area
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.59 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATA
GATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACA
CGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTAT
CTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)219157 - 375
Exon 3 To Exon 4 (Pair 34)
Forward (152,22)GGGAAGTTCAAGATCAAAGTGCAmplicon SizecDNA: 109 bpgenomic: 21,614
Reverse (260,20)CAGATGGTGCTGGTTGTGCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.193 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.302 kcal/mol in 3' area
Reverse Dimers-0.435 kcal/mol
Forward-Reverse Dimers-0.895 kcal/mol
Amplicon Folding-0.34 kcal/mol outside primersite
Amplicon SequenceGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCT
TCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)109152 - 260
Exon 3 To Exon 4 (Pair 35)
Forward (174,22)CAGCAGATTCAGTGTCATGTGAAmplicon SizecDNA: 87 bpgenomic: 21,592
Reverse (260,20)CAGATGGTGCTGGTTGTGCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.302 kcal/mol in 3' area
Reverse Dimers-0.435 kcal/mol
Forward-Reverse Dimers-2.338 kcal/mol
Amplicon Folding-0.34 kcal/mol outside primersite
Amplicon SequenceCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGA
GCTCGGCGGCACAACCAGCACCATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)87174 - 260
Exon 3 To Exon 4 (Pair 36)
Forward (163,22)GATCAAAGTGCCAGCAGATTCAAmplicon SizecDNA: 212 bpgenomic: 21,717
Reverse (374,23)CTCTTGGATGTTTCCCATTTCTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.677 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAG
AGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAA
GCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAG
AGTTCCTGCAAGAAATGGGAAACATCCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)212163 - 374
Exon 3 To Exon 4 (Pair 37)
Forward (175,22)AGCAGATTCAGTGTCATGTGAGAmplicon SizecDNA: 207 bpgenomic: 21,712
Reverse (381,22)GCGAAATCTCTTGGATGTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAG
CTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCC
CCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAG
AAATGGGAAACATCCAAGAGATTTCGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)207175 - 381
Exon 3 To Exon 4 (Pair 38)
Forward (197,21)GACGTGCTTCCTGCTTCATAGAmplicon SizecDNA: 147 bpgenomic: 21,652
Reverse (343,22)TCTTCAGATAACGGGCTCTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.913 kcal/mol
Forward Dimers-2.852 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-2.043 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCA
TCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGG
CGATCTAGAGAGCCCGTTATCTGAAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)147197 - 343
Exon 3 To Exon 4 (Pair 39)
Forward (172,21)GCCAGCAGATTCAGTGTCATGAmplicon SizecDNA: 204 bpgenomic: 21,709
Reverse (375,23)TCTCTTGGATGTTTCCCATTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.14 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.657 kcal/mol in 3' area
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTG
GAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCT
GCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGC
AAGAAATGGGAAACATCCAAGAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)204172 - 375
Exon 3 To Exon 4 (Pair 40)
Forward (160,22)CAAGATCAAAGTGCCAGCAGATAmplicon SizecDNA: 215 bpgenomic: 21,720
Reverse (374,23)CTCTTGGATGTTTCCCATTTCTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.182 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGAT
AAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGG
AAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTG
AAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)215160 - 374
Exon 3 To Exon 4 (Pair 41)
Forward (156,22)AGTTCAAGATCAAAGTGCCAGCAmplicon SizecDNA: 225 bpgenomic: 21,730
Reverse (380,22)CGAAATCTCTTGGATGTTTCCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.251 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCAT
AGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGAC
ACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTA
TCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)225156 - 380
Exon 3 To Exon 4 (Pair 42)
Forward (170,21)GTGCCAGCAGATTCAGTGTCAAmplicon SizecDNA: 212 bpgenomic: 21,717
Reverse (381,22)GCGAAATCTCTTGGATGTTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.14 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCT
TGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACT
CTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCT
GCAAGAAATGGGAAACATCCAAGAGATTTCGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)212170 - 381
Exon 3 To Exon 4 (Pair 43)
Forward (152,22)GGGAAGTTCAAGATCAAAGTGCAmplicon SizecDNA: 110 bpgenomic: 21,615
Reverse (261,20)CCAGATGGTGCTGGTTGTGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.193 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops0.684 kcal/mol
Reverse Dimers-1.641 kcal/mol
Forward-Reverse Dimers-0.895 kcal/mol
Amplicon Folding-0.34 kcal/mol outside primersite
Amplicon SequenceGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCT
TCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)110152 - 261
Exon 3 To Exon 4 (Pair 44)
Forward (160,22)CAAGATCAAAGTGCCAGCAGATAmplicon SizecDNA: 216 bpgenomic: 21,721
Reverse (375,23)TCTCTTGGATGTTTCCCATTTCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.182 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.657 kcal/mol in 3' area
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGAT
AAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGG
AAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTG
AAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)216160 - 375
Exon 3 To Exon 4 (Pair 45)
Forward (198,22)ACGTGCTTCCTGCTTCATAGATAmplicon SizecDNA: 139 bpgenomic: 21,644
Reverse (336,21)ATAACGGGCTCTCTAGATCGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.913 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops0.62 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-2.043 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCAT
CTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGC
GATCTAGAGAGCCCGTTAT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)139198 - 336
Exon 3 To Exon 4 (Pair 46)
Forward (170,21)GTGCCAGCAGATTCAGTGTCAAmplicon SizecDNA: 205 bpgenomic: 21,710
Reverse (374,23)CTCTTGGATGTTTCCCATTTCTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.14 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCT
TGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACT
CTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCT
GCAAGAAATGGGAAACATCCAAGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)205170 - 374
Exon 3 To Exon 4 (Pair 47)
Forward (162,22)AGATCAAAGTGCCAGCAGATTCAmplicon SizecDNA: 212 bpgenomic: 21,717
Reverse (373,23)TCTTGGATGTTTCCCATTTCTTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.677 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAA
GAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAA
AGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAA
GAGTTCCTGCAAGAAATGGGAAACATCCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)212162 - 373
Exon 3 To Exon 4 (Pair 48)
Forward (175,22)AGCAGATTCAGTGTCATGTGAGAmplicon SizecDNA: 87 bpgenomic: 21,592
Reverse (261,20)CCAGATGGTGCTGGTTGTGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.684 kcal/mol
Reverse Dimers-1.641 kcal/mol
Forward-Reverse Dimers-1.798 kcal/mol
Amplicon Folding-0.34 kcal/mol outside primersite
Amplicon SequenceAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAG
CTCGGCGGCACAACCAGCACCATCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)87175 - 261
Exon 3 To Exon 4 (Pair 49)
Forward (158,22)TTCAAGATCAAAGTGCCAGCAGAmplicon SizecDNA: 224 bpgenomic: 21,729
Reverse (381,22)GCGAAATCTCTTGGATGTTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAG
ATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACAC
GGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATC
TGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)224158 - 381
Exon 3 To Exon 4 (Pair 50)
Forward (198,22)ACGTGCTTCCTGCTTCATAGATAmplicon SizecDNA: 176 bpgenomic: 21,681
Reverse (373,23)TCTTGGATGTTTCCCATTTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.913 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCAT
CTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGC
GATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)176198 - 373
Exon 3 To Exon 4 (Pair 51)
Forward (153,22)GGAAGTTCAAGATCAAAGTGCCAmplicon SizecDNA: 231 bpgenomic: 21,736
Reverse (383,23)TTGCGAAATCTCTTGGATGTTTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.193 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTT
CATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTG
GACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCG
TTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)231153 - 383
Exon 3 To Exon 4 (Pair 52)
Forward (152,22)GGGAAGTTCAAGATCAAAGTGCAmplicon SizecDNA: 229 bpgenomic: 21,734
Reverse (380,22)CGAAATCTCTTGGATGTTTCCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.193 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCT
TCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGT
GGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCC
GTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)229152 - 380
Exon 3 To Exon 4 (Pair 53)
Forward (152,22)GGGAAGTTCAAGATCAAAGTGCAmplicon SizecDNA: 192 bpgenomic: 21,697
Reverse (343,22)TCTTCAGATAACGGGCTCTCTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.193 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.316 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCT
TCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGT
GGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCC
GTTATCTGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)192152 - 343
Exon 3 To Exon 4 (Pair 54)
Forward (159,22)TCAAGATCAAAGTGCCAGCAGAAmplicon SizecDNA: 178 bpgenomic: 21,683
Reverse (336,21)ATAACGGGCTCTCTAGATCGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.62 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-2.537 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGA
TAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACG
GAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)178159 - 336
Exon 3 To Exon 4 (Pair 55)
Forward (170,21)GTGCCAGCAGATTCAGTGTCAAmplicon SizecDNA: 204 bpgenomic: 21,709
Reverse (373,23)TCTTGGATGTTTCCCATTTCTTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.14 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCT
TGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACT
CTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCT
GCAAGAAATGGGAAACATCCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)204170 - 373
Exon 3 To Exon 4 (Pair 56)
Forward (197,21)GACGTGCTTCCTGCTTCATAGAmplicon SizecDNA: 187 bpgenomic: 21,692
Reverse (383,23)TTGCGAAATCTCTTGGATGTTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.913 kcal/mol
Forward Dimers-2.852 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.396 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCA
TCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGG
CGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGAT
TTCGCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)187197 - 383
Exon 3 To Exon 4 (Pair 57)
Forward (165,22)TCAAAGTGCCAGCAGATTCAGTAmplicon SizecDNA: 172 bpgenomic: 21,677
Reverse (336,21)ATAACGGGCTCTCTAGATCGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.62 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-2.537 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceTCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAG
TAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGC
CCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)172165 - 336
Exon 3 To Exon 4 (Pair 58)
Forward (163,22)GATCAAAGTGCCAGCAGATTCAAmplicon SizecDNA: 213 bpgenomic: 21,718
Reverse (375,23)TCTCTTGGATGTTTCCCATTTCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.677 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.657 kcal/mol in 3' area
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAG
AGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAA
GCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAG
AGTTCCTGCAAGAAATGGGAAACATCCAAGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)213163 - 375
Exon 3 To Exon 4 (Pair 59)
Forward (152,22)GGGAAGTTCAAGATCAAAGTGCAmplicon SizecDNA: 185 bpgenomic: 21,690
Reverse (336,21)ATAACGGGCTCTCTAGATCGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.193 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops0.62 kcal/mol in 3' area
Reverse Dimers-1.236 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGGGAAGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCT
TCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGT
GGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCC
GTTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)185152 - 336
Exon 3 To Exon 4 (Pair 60)
Forward (157,22)GTTCAAGATCAAAGTGCCAGCAAmplicon SizecDNA: 224 bpgenomic: 21,729
Reverse (380,22)CGAAATCTCTTGGATGTTTCCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATA
GATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACA
CGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTAT
CTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGATTTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)224157 - 380
Exon 3 To Exon 4 (Pair 61)
Forward (175,22)AGCAGATTCAGTGTCATGTGAGAmplicon SizecDNA: 169 bpgenomic: 21,674
Reverse (343,22)TCTTCAGATAACGGGCTCTCTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.913 kcal/mol in 3' area
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.63 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAG
CTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCC
CCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)169175 - 343
Exon 3 To Exon 4 (Pair 62)
Forward (177,22)CAGATTCAGTGTCATGTGAGGAAmplicon SizecDNA: 207 bpgenomic: 21,712
Reverse (383,23)TTGCGAAATCTCTTGGATGTTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.252 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCT
CGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCC
CTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAA
ATGGGAAACATCCAAGAGATTTCGCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)207177 - 383
Exon 3 To Exon 4 (Pair 63)
Forward (196,21)GGACGTGCTTCCTGCTTCATAAmplicon SizecDNA: 185 bpgenomic: 21,690
Reverse (380,22)CGAAATCTCTTGGATGTTTCCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.913 kcal/mol
Forward Dimers-2.852 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-0.574 kcal/mol
Forward-Reverse Dimers-0.89 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACC
ATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCG
GCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGA
TTTCG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)185196 - 380
Exon 3 To Exon 4 (Pair 64)
Forward (157,22)GTTCAAGATCAAAGTGCCAGCAAmplicon SizecDNA: 217 bpgenomic: 21,722
Reverse (373,23)TCTTGGATGTTTCCCATTTCTTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.209 kcal/mol in 3' area
Forward Dimers-0.806 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.59 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceGTTCAAGATCAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATA
GATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACA
CGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTAT
CTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)217157 - 373
Exon 3 To Exon 4 (Pair 65)
Forward (174,22)CAGCAGATTCAGTGTCATGTGAAmplicon SizecDNA: 202 bpgenomic: 21,707
Reverse (375,23)TCTCTTGGATGTTTCCCATTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.015 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.657 kcal/mol in 3' area
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGA
GCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGC
CCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAA
GAAATGGGAAACATCCAAGAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)202174 - 375
Exon 3 To Exon 4 (Pair 66)
Forward (198,22)ACGTGCTTCCTGCTTCATAGATAmplicon SizecDNA: 177 bpgenomic: 21,682
Reverse (374,23)CTCTTGGATGTTTCCCATTTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.913 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCAT
CTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGC
GATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)177198 - 374
Exon 3 To Exon 4 (Pair 67)
Forward (167,22)AAAGTGCCAGCAGATTCAGTGTAmplicon SizecDNA: 207 bpgenomic: 21,712
Reverse (373,23)TCTTGGATGTTTCCCATTTCTTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.198 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.657 kcal/mol
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-1.498 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTA
GCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCC
ACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTT
CCTGCAAGAAATGGGAAACATCCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)207167 - 373
Exon 3 To Exon 4 (Pair 68)
Forward (167,22)AAAGTGCCAGCAGATTCAGTGTAmplicon SizecDNA: 215 bpgenomic: 21,720
Reverse (381,22)GCGAAATCTCTTGGATGTTTCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.198 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.856 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-2.472 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceAAAGTGCCAGCAGATTCAGTGTCATGTGAGGACGTGCTTCCTGCTTCATAGATAAGAGTA
GCTTGGAGCTCGGCGGCACAACCAGCACCATCTGGTCGCGATGGTGGACACGGAAAGCCC
ACTCTGCCCCCTCTCCCCACTCGAGGCCGGCGATCTAGAGAGCCCGTTATCTGAAGAGTT
CCTGCAAGAAATGGGAAACATCCAAGAGATTTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005036 (PPARA)215167 - 381
Exon 3 To Exon 4 (Pair 69)
Forward (198,22)ACGTGCTTCCTGCTTCATAGATAmplicon SizecDNA: 178 bpgenomic: 21,683
Reverse (375,23)TCTCTTGGATGTTTCCCATTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.913 kcal/mol
Forward Dimers-1.726 kcal/mol
Reverse Loops0.657 kcal/mol in 3' area
Reverse Dimers-0.876 kcal/mol
Forward-Reverse Dimers-0.787 kcal/mol
Amplicon Folding-1.774 kcal/mol outside primersite
Amplicon SequenceACGTGCTTCCTGCTTCATAGATAAGAGTAGCTTGGAGCTCGGCGGCACAACCAGCACCAT
CTGGTCGCGATGGTGGACACGGAAAGCCCACTCTGCCCCCTCTCCCCACTCGAGGCCGGC
GATCTAGAGAGCCCGTTATCTGAAGAGTTCCTGCAAGAAATGGGAAACATCCAAGAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_005036 (PPARA)178198 - 375
 

See below for some more details.

Program Output:

Loading ...