Design Results for RAB31

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size90Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 4 (Pair 1)
Forward (255,22)TCCAGGATCACTTTGACCACAAAmplicon SizecDNA: 145 bpgenomic: 38,725
Reverse (399,23)TACATGGGAGCCAATGAATGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.056 kcal/mol
Reverse Dimers-1.954 kcal/mol
Forward-Reverse Dimers-1.539 kcal/mol
Amplicon Folding-1.433 kcal/mol outside primersite
Amplicon SequenceTCCAGGATCACTTTGACCACAACATCAGCCCTACTATTGGGGCATCTTTTATGACCAAAA
CTGTGCCTTGTGGAAATGAACTTCACAAGTTCCTCATCTGGGACACTGCTGGTCAGGAAC
GGTTTCATTCATTGGCTCCCATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)145255 - 399
Exon 2 To Exon 4 (Pair 2)
Forward (251,22)TTTGTCCAGGATCACTTTGACCAmplicon SizecDNA: 150 bpgenomic: 38,730
Reverse (400,22)GTACATGGGAGCCAATGAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.056 kcal/mol
Reverse Dimers-1.954 kcal/mol
Forward-Reverse Dimers-1.539 kcal/mol
Amplicon Folding-1.433 kcal/mol outside primersite
Amplicon SequenceTTTGTCCAGGATCACTTTGACCACAACATCAGCCCTACTATTGGGGCATCTTTTATGACC
AAAACTGTGCCTTGTGGAAATGAACTTCACAAGTTCCTCATCTGGGACACTGCTGGTCAG
GAACGGTTTCATTCATTGGCTCCCATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)150251 - 400
Exon 2 To Exon 4 (Pair 3)
Forward (257,22)CAGGATCACTTTGACCACAACAAmplicon SizecDNA: 143 bpgenomic: 38,723
Reverse (399,23)TACATGGGAGCCAATGAATGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.056 kcal/mol
Reverse Dimers-1.954 kcal/mol
Forward-Reverse Dimers-1.539 kcal/mol
Amplicon Folding-1.433 kcal/mol outside primersite
Amplicon SequenceCAGGATCACTTTGACCACAACATCAGCCCTACTATTGGGGCATCTTTTATGACCAAAACT
GTGCCTTGTGGAAATGAACTTCACAAGTTCCTCATCTGGGACACTGCTGGTCAGGAACGG
TTTCATTCATTGGCTCCCATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)143257 - 399
Exon 2 To Exon 4 (Pair 4)
Forward (252,22)TTGTCCAGGATCACTTTGACCAAmplicon SizecDNA: 149 bpgenomic: 38,729
Reverse (400,22)GTACATGGGAGCCAATGAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.056 kcal/mol
Reverse Dimers-1.954 kcal/mol
Forward-Reverse Dimers-1.539 kcal/mol
Amplicon Folding-1.433 kcal/mol outside primersite
Amplicon SequenceTTGTCCAGGATCACTTTGACCACAACATCAGCCCTACTATTGGGGCATCTTTTATGACCA
AAACTGTGCCTTGTGGAAATGAACTTCACAAGTTCCTCATCTGGGACACTGCTGGTCAGG
AACGGTTTCATTCATTGGCTCCCATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)149252 - 400
Exon 2 To Exon 4 (Pair 5)
Forward (251,22)TTTGTCCAGGATCACTTTGACCAmplicon SizecDNA: 149 bpgenomic: 38,729
Reverse (399,23)TACATGGGAGCCAATGAATGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.056 kcal/mol
Reverse Dimers-1.954 kcal/mol
Forward-Reverse Dimers-1.539 kcal/mol
Amplicon Folding-1.433 kcal/mol outside primersite
Amplicon SequenceTTTGTCCAGGATCACTTTGACCACAACATCAGCCCTACTATTGGGGCATCTTTTATGACC
AAAACTGTGCCTTGTGGAAATGAACTTCACAAGTTCCTCATCTGGGACACTGCTGGTCAG
GAACGGTTTCATTCATTGGCTCCCATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)149251 - 399
Exon 2 To Exon 4 (Pair 6)
Forward (257,22)CAGGATCACTTTGACCACAACAAmplicon SizecDNA: 144 bpgenomic: 38,724
Reverse (400,22)GTACATGGGAGCCAATGAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-0.893 kcal/mol
Reverse Loops1.056 kcal/mol
Reverse Dimers-1.954 kcal/mol
Forward-Reverse Dimers-1.539 kcal/mol
Amplicon Folding-1.433 kcal/mol outside primersite
Amplicon SequenceCAGGATCACTTTGACCACAACATCAGCCCTACTATTGGGGCATCTTTTATGACCAAAACT
GTGCCTTGTGGAAATGAACTTCACAAGTTCCTCATCTGGGACACTGCTGGTCAGGAACGG
TTTCATTCATTGGCTCCCATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)144257 - 400
Exon 2 To Exon 4 (Pair 7)
Forward (254,21)GTCCAGGATCACTTTGACCACAmplicon SizecDNA: 147 bpgenomic: 38,727
Reverse (400,22)GTACATGGGAGCCAATGAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.056 kcal/mol
Reverse Dimers-1.954 kcal/mol
Forward-Reverse Dimers-1.539 kcal/mol
Amplicon Folding-1.433 kcal/mol outside primersite
Amplicon SequenceGTCCAGGATCACTTTGACCACAACATCAGCCCTACTATTGGGGCATCTTTTATGACCAAA
ACTGTGCCTTGTGGAAATGAACTTCACAAGTTCCTCATCTGGGACACTGCTGGTCAGGAA
CGGTTTCATTCATTGGCTCCCATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)147254 - 400
Exon 2 To Exon 4 (Pair 8)
Forward (254,21)GTCCAGGATCACTTTGACCACAmplicon SizecDNA: 146 bpgenomic: 38,726
Reverse (399,23)TACATGGGAGCCAATGAATGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.056 kcal/mol
Reverse Dimers-1.954 kcal/mol
Forward-Reverse Dimers-1.539 kcal/mol
Amplicon Folding-1.433 kcal/mol outside primersite
Amplicon SequenceGTCCAGGATCACTTTGACCACAACATCAGCCCTACTATTGGGGCATCTTTTATGACCAAA
ACTGTGCCTTGTGGAAATGAACTTCACAAGTTCCTCATCTGGGACACTGCTGGTCAGGAA
CGGTTTCATTCATTGGCTCCCATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)146254 - 399
Exon 2 To Exon 4 (Pair 9)
Forward (252,22)TTGTCCAGGATCACTTTGACCAAmplicon SizecDNA: 148 bpgenomic: 38,728
Reverse (399,23)TACATGGGAGCCAATGAATGAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.056 kcal/mol
Reverse Dimers-1.954 kcal/mol
Forward-Reverse Dimers-1.539 kcal/mol
Amplicon Folding-1.433 kcal/mol outside primersite
Amplicon SequenceTTGTCCAGGATCACTTTGACCACAACATCAGCCCTACTATTGGGGCATCTTTTATGACCA
AAACTGTGCCTTGTGGAAATGAACTTCACAAGTTCCTCATCTGGGACACTGCTGGTCAGG
AACGGTTTCATTCATTGGCTCCCATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)148252 - 399
Exon 2 To Exon 4 (Pair 10)
Forward (255,22)TCCAGGATCACTTTGACCACAAAmplicon SizecDNA: 146 bpgenomic: 38,726
Reverse (400,22)GTACATGGGAGCCAATGAATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.925 kcal/mol
Forward Dimers-1.226 kcal/mol
Reverse Loops1.056 kcal/mol
Reverse Dimers-1.954 kcal/mol
Forward-Reverse Dimers-1.539 kcal/mol
Amplicon Folding-1.433 kcal/mol outside primersite
Amplicon SequenceTCCAGGATCACTTTGACCACAACATCAGCCCTACTATTGGGGCATCTTTTATGACCAAAA
CTGTGCCTTGTGGAAATGAACTTCACAAGTTCCTCATCTGGGACACTGCTGGTCAGGAAC
GGTTTCATTCATTGGCTCCCATGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)146255 - 400
Exon 3 To Exon 5 (Pair 1)
Forward (334,22)ACTTCACAAGTTCCTCATCTGGAmplicon SizecDNA: 146 bpgenomic: 22,954
Reverse (479,24)TGACCCATTTCTTCAAGGTATAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.807 kcal/mol
Forward Dimers-1.236 kcal/mol
Reverse Loops0.71 kcal/mol
Reverse Dimers-1.231 kcal/mol
Forward-Reverse Dimers-1.495 kcal/mol
Amplicon Folding-0.492 kcal/mol outside primersite
Amplicon SequenceACTTCACAAGTTCCTCATCTGGGACACTGCTGGTCAGGAACGGTTTCATTCATTGGCTCC
CATGTACTATCGAGGCTCAGCTGCAGCTGTTATCGTGTATGATATTACCAAGCAGGATTC
ATTTTATACCTTGAAGAAATGGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)146334 - 479
Exon 3 To Exon 5 (Pair 2)
Forward (357,20)ACACTGCTGGTCAGGAACGGAmplicon SizecDNA: 149 bpgenomic: 22,957
Reverse (505,22)TTCTGGACCATGTTCTTTCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.696 kcal/mol
Forward Dimers-1.056 kcal/mol
Reverse Loops1.702 kcal/mol
Reverse Dimers-1.242 kcal/mol
Forward-Reverse Dimers-2.581 kcal/mol
Amplicon Folding-1.762 kcal/mol outside primersite
Amplicon SequenceACACTGCTGGTCAGGAACGGTTTCATTCATTGGCTCCCATGTACTATCGAGGCTCAGCTG
CAGCTGTTATCGTGTATGATATTACCAAGCAGGATTCATTTTATACCTTGAAGAAATGGG
TCAAGGAGCTGAAAGAACATGGTCCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)149357 - 505
Exon 3 To Exon 5 (Pair 3)
Forward (344,21)TTCCTCATCTGGGACACTGCTAmplicon SizecDNA: 136 bpgenomic: 22,944
Reverse (479,24)TGACCCATTTCTTCAAGGTATAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.741 kcal/mol
Forward Dimers-0.365 kcal/mol
Reverse Loops0.71 kcal/mol
Reverse Dimers-1.231 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-0.492 kcal/mol outside primersite
Amplicon SequenceTTCCTCATCTGGGACACTGCTGGTCAGGAACGGTTTCATTCATTGGCTCCCATGTACTAT
CGAGGCTCAGCTGCAGCTGTTATCGTGTATGATATTACCAAGCAGGATTCATTTTATACC
TTGAAGAAATGGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)136344 - 479
Exon 3 To Exon 5 (Pair 4)
Forward (356,20)GACACTGCTGGTCAGGAACGAmplicon SizecDNA: 124 bpgenomic: 22,932
Reverse (479,24)TGACCCATTTCTTCAAGGTATAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.696 kcal/mol
Forward Dimers-1.056 kcal/mol
Reverse Loops0.71 kcal/mol
Reverse Dimers-1.231 kcal/mol
Forward-Reverse Dimers-2.257 kcal/mol
Amplicon Folding-0.492 kcal/mol outside primersite
Amplicon SequenceGACACTGCTGGTCAGGAACGGTTTCATTCATTGGCTCCCATGTACTATCGAGGCTCAGCT
GCAGCTGTTATCGTGTATGATATTACCAAGCAGGATTCATTTTATACCTTGAAGAAATGG
GTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)124356 - 479
Exon 3 To Exon 5 (Pair 5)
Forward (356,20)GACACTGCTGGTCAGGAACGAmplicon SizecDNA: 150 bpgenomic: 22,958
Reverse (505,22)TTCTGGACCATGTTCTTTCAGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.696 kcal/mol
Forward Dimers-1.056 kcal/mol
Reverse Loops1.702 kcal/mol
Reverse Dimers-1.242 kcal/mol
Forward-Reverse Dimers-2.581 kcal/mol
Amplicon Folding-1.762 kcal/mol outside primersite
Amplicon SequenceGACACTGCTGGTCAGGAACGGTTTCATTCATTGGCTCCCATGTACTATCGAGGCTCAGCT
GCAGCTGTTATCGTGTATGATATTACCAAGCAGGATTCATTTTATACCTTGAAGAAATGG
GTCAAGGAGCTGAAAGAACATGGTCCAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)150356 - 505
Exon 3 To Exon 5 (Pair 6)
Forward (357,20)ACACTGCTGGTCAGGAACGGAmplicon SizecDNA: 123 bpgenomic: 22,931
Reverse (479,24)TGACCCATTTCTTCAAGGTATAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.696 kcal/mol
Forward Dimers-1.056 kcal/mol
Reverse Loops0.71 kcal/mol
Reverse Dimers-1.231 kcal/mol
Forward-Reverse Dimers-2.257 kcal/mol
Amplicon Folding-0.492 kcal/mol outside primersite
Amplicon SequenceACACTGCTGGTCAGGAACGGTTTCATTCATTGGCTCCCATGTACTATCGAGGCTCAGCTG
CAGCTGTTATCGTGTATGATATTACCAAGCAGGATTCATTTTATACCTTGAAGAAATGGG
TCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)123357 - 479
Exon 3 To Exon 5 (Pair 7)
Forward (346,20)CCTCATCTGGGACACTGCTGAmplicon SizecDNA: 134 bpgenomic: 22,942
Reverse (479,24)TGACCCATTTCTTCAAGGTATAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.741 kcal/mol
Forward Dimers-0.06 kcal/mol
Reverse Loops0.71 kcal/mol
Reverse Dimers-1.231 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-0.492 kcal/mol outside primersite
Amplicon SequenceCCTCATCTGGGACACTGCTGGTCAGGAACGGTTTCATTCATTGGCTCCCATGTACTATCG
AGGCTCAGCTGCAGCTGTTATCGTGTATGATATTACCAAGCAGGATTCATTTTATACCTT
GAAGAAATGGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)134346 - 479
Exon 3 To Exon 5 (Pair 8)
Forward (347,20)CTCATCTGGGACACTGCTGGAmplicon SizecDNA: 133 bpgenomic: 22,941
Reverse (479,24)TGACCCATTTCTTCAAGGTATAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.741 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops0.71 kcal/mol
Reverse Dimers-1.231 kcal/mol
Forward-Reverse Dimers-2.936 kcal/mol
Amplicon Folding-0.492 kcal/mol outside primersite
Amplicon SequenceCTCATCTGGGACACTGCTGGTCAGGAACGGTTTCATTCATTGGCTCCCATGTACTATCGA
GGCTCAGCTGCAGCTGTTATCGTGTATGATATTACCAAGCAGGATTCATTTTATACCTTG
AAGAAATGGGTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)133347 - 479
Exon 5 To Exon 6 (Pair 1)
Forward (472,22)ATGGGTCAAGGAGCTGAAAGAAAmplicon SizecDNA: 142 bpgenomic: 30,501
Reverse (613,21)AACCACGATGGCACCTATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAA
CAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGA
ATCCATAGGTGCCATCGTGGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)142472 - 613
Exon 5 To Exon 6 (Pair 2)
Forward (478,22)CAAGGAGCTGAAAGAACATGGTAmplicon SizecDNA: 135 bpgenomic: 30,494
Reverse (612,21)ACCACGATGGCACCTATGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTG
CGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCAT
AGGTGCCATCGTGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)135478 - 612
Exon 5 To Exon 6 (Pair 3)
Forward (479,22)AAGGAGCTGAAAGAACATGGTCAmplicon SizecDNA: 113 bpgenomic: 30,472
Reverse (591,22)TCAGCGTATTCCTTAGCATCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.857 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGC
GACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)113479 - 591
Exon 5 To Exon 6 (Pair 4)
Forward (471,22)AATGGGTCAAGGAGCTGAAAGAAmplicon SizecDNA: 151 bpgenomic: 30,510
Reverse (621,21)CTTGTCTCAACCACGATGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAA
ACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
AATCCATAGGTGCCATCGTGGTTGAGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)151471 - 621
Exon 5 To Exon 6 (Pair 5)
Forward (478,22)CAAGGAGCTGAAAGAACATGGTAmplicon SizecDNA: 136 bpgenomic: 30,495
Reverse (613,21)AACCACGATGGCACCTATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTG
CGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCAT
AGGTGCCATCGTGGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)136478 - 613
Exon 5 To Exon 6 (Pair 6)
Forward (472,22)ATGGGTCAAGGAGCTGAAAGAAAmplicon SizecDNA: 150 bpgenomic: 30,509
Reverse (621,21)CTTGTCTCAACCACGATGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAA
CAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGA
ATCCATAGGTGCCATCGTGGTTGAGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)150472 - 621
Exon 5 To Exon 6 (Pair 7)
Forward (477,22)TCAAGGAGCTGAAAGAACATGGAmplicon SizecDNA: 114 bpgenomic: 30,473
Reverse (590,22)CAGCGTATTCCTTAGCATCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.867 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGT
GCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)114477 - 590
Exon 5 To Exon 6 (Pair 8)
Forward (476,22)GTCAAGGAGCTGAAAGAACATGAmplicon SizecDNA: 143 bpgenomic: 30,502
Reverse (618,20)GTCTCAACCACGATGGCACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAG
TGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCC
ATAGGTGCCATCGTGGTTGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)143476 - 618
Exon 5 To Exon 6 (Pair 9)
Forward (477,22)TCAAGGAGCTGAAAGAACATGGAmplicon SizecDNA: 135 bpgenomic: 30,494
Reverse (611,21)CCACGATGGCACCTATGGATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGT
GCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCA
TAGGTGCCATCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)135477 - 611
Exon 5 To Exon 6 (Pair 10)
Forward (471,22)AATGGGTCAAGGAGCTGAAAGAAmplicon SizecDNA: 150 bpgenomic: 30,509
Reverse (620,21)TTGTCTCAACCACGATGGCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAA
ACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
AATCCATAGGTGCCATCGTGGTTGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)150471 - 620
Exon 5 To Exon 6 (Pair 11)
Forward (476,22)GTCAAGGAGCTGAAAGAACATGAmplicon SizecDNA: 138 bpgenomic: 30,497
Reverse (613,21)AACCACGATGGCACCTATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAG
TGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCC
ATAGGTGCCATCGTGGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)138476 - 613
Exon 5 To Exon 6 (Pair 12)
Forward (470,22)AAATGGGTCAAGGAGCTGAAAGAmplicon SizecDNA: 142 bpgenomic: 30,501
Reverse (611,21)CCACGATGGCACCTATGGATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGA
AACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCT
GAATCCATAGGTGCCATCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)142470 - 611
Exon 5 To Exon 6 (Pair 13)
Forward (476,22)GTCAAGGAGCTGAAAGAACATGAmplicon SizecDNA: 137 bpgenomic: 30,496
Reverse (612,21)ACCACGATGGCACCTATGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAG
TGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCC
ATAGGTGCCATCGTGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)137476 - 612
Exon 5 To Exon 6 (Pair 14)
Forward (481,21)GGAGCTGAAAGAACATGGTCCAmplicon SizecDNA: 111 bpgenomic: 30,470
Reverse (591,22)TCAGCGTATTCCTTAGCATCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.626 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGA
CCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)111481 - 591
Exon 5 To Exon 6 (Pair 15)
Forward (476,22)GTCAAGGAGCTGAAAGAACATGAmplicon SizecDNA: 146 bpgenomic: 30,505
Reverse (621,21)CTTGTCTCAACCACGATGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAG
TGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCC
ATAGGTGCCATCGTGGTTGAGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)146476 - 621
Exon 5 To Exon 6 (Pair 16)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 130 bpgenomic: 30,489
Reverse (613,21)AACCACGATGGCACCTATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.609 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCATAGGTGC
CATCGTGGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)130484 - 613
Exon 5 To Exon 6 (Pair 17)
Forward (475,22)GGTCAAGGAGCTGAAAGAACATAmplicon SizecDNA: 136 bpgenomic: 30,495
Reverse (610,21)CACGATGGCACCTATGGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAA
GTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATC
CATAGGTGCCATCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)136475 - 610
Exon 5 To Exon 6 (Pair 18)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 119 bpgenomic: 30,478
Reverse (602,22)CACCTATGGATTCAGCGTATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops1.066 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.853 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCATAGGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)119484 - 602
Exon 5 To Exon 6 (Pair 19)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 108 bpgenomic: 30,467
Reverse (591,22)TCAGCGTATTCCTTAGCATCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.299 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)108484 - 591
Exon 5 To Exon 6 (Pair 20)
Forward (471,22)AATGGGTCAAGGAGCTGAAAGAAmplicon SizecDNA: 120 bpgenomic: 30,479
Reverse (590,22)CAGCGTATTCCTTAGCATCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.867 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAA
ACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)120471 - 590
Exon 5 To Exon 6 (Pair 21)
Forward (470,22)AAATGGGTCAAGGAGCTGAAAGAmplicon SizecDNA: 151 bpgenomic: 30,510
Reverse (620,21)TTGTCTCAACCACGATGGCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGA
AACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCT
GAATCCATAGGTGCCATCGTGGTTGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)151470 - 620
Exon 5 To Exon 6 (Pair 22)
Forward (470,22)AAATGGGTCAAGGAGCTGAAAGAmplicon SizecDNA: 139 bpgenomic: 30,498
Reverse (608,21)CGATGGCACCTATGGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGA
AACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCT
GAATCCATAGGTGCCATCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)139470 - 608
Exon 5 To Exon 6 (Pair 23)
Forward (470,22)AAATGGGTCAAGGAGCTGAAAGAmplicon SizecDNA: 141 bpgenomic: 30,500
Reverse (610,21)CACGATGGCACCTATGGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGA
AACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCT
GAATCCATAGGTGCCATCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)141470 - 610
Exon 5 To Exon 6 (Pair 24)
Forward (477,22)TCAAGGAGCTGAAAGAACATGGAmplicon SizecDNA: 134 bpgenomic: 30,493
Reverse (610,21)CACGATGGCACCTATGGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGT
GCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCA
TAGGTGCCATCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)134477 - 610
Exon 5 To Exon 6 (Pair 25)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 137 bpgenomic: 30,496
Reverse (620,21)TTGTCTCAACCACGATGGCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.609 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCATAGGTGC
CATCGTGGTTGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)137484 - 620
Exon 5 To Exon 6 (Pair 26)
Forward (474,21)GGGTCAAGGAGCTGAAAGAACAmplicon SizecDNA: 138 bpgenomic: 30,497
Reverse (611,21)CCACGATGGCACCTATGGATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACA
AGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAAT
CCATAGGTGCCATCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)138474 - 611
Exon 5 To Exon 6 (Pair 27)
Forward (472,22)ATGGGTCAAGGAGCTGAAAGAAAmplicon SizecDNA: 141 bpgenomic: 30,500
Reverse (612,21)ACCACGATGGCACCTATGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAA
CAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGA
ATCCATAGGTGCCATCGTGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)141472 - 612
Exon 5 To Exon 6 (Pair 28)
Forward (479,22)AAGGAGCTGAAAGAACATGGTCAmplicon SizecDNA: 132 bpgenomic: 30,491
Reverse (610,21)CACGATGGCACCTATGGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGC
GACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCATA
GGTGCCATCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)132479 - 610
Exon 5 To Exon 6 (Pair 29)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 132 bpgenomic: 30,491
Reverse (615,21)TCAACCACGATGGCACCTATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.609 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCATAGGTGC
CATCGTGGTTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)132484 - 615
Exon 5 To Exon 6 (Pair 30)
Forward (479,22)AAGGAGCTGAAAGAACATGGTCAmplicon SizecDNA: 130 bpgenomic: 30,489
Reverse (608,21)CGATGGCACCTATGGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGC
GACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCATA
GGTGCCATCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)130479 - 608
Exon 5 To Exon 6 (Pair 31)
Forward (481,21)GGAGCTGAAAGAACATGGTCCAmplicon SizecDNA: 107 bpgenomic: 30,466
Reverse (587,22)CGTATTCCTTAGCATCCTTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.703 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGA
CCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)107481 - 587
Exon 5 To Exon 6 (Pair 32)
Forward (481,21)GGAGCTGAAAGAACATGGTCCAmplicon SizecDNA: 108 bpgenomic: 30,467
Reverse (588,22)GCGTATTCCTTAGCATCCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.703 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGA
CCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)108481 - 588
Exon 5 To Exon 6 (Pair 33)
Forward (471,22)AATGGGTCAAGGAGCTGAAAGAAmplicon SizecDNA: 148 bpgenomic: 30,507
Reverse (618,20)GTCTCAACCACGATGGCACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAA
ACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
AATCCATAGGTGCCATCGTGGTTGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)148471 - 618
Exon 5 To Exon 6 (Pair 34)
Forward (476,22)GTCAAGGAGCTGAAAGAACATGAmplicon SizecDNA: 133 bpgenomic: 30,492
Reverse (608,21)CGATGGCACCTATGGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAG
TGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCC
ATAGGTGCCATCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)133476 - 608
Exon 5 To Exon 6 (Pair 35)
Forward (475,22)GGTCAAGGAGCTGAAAGAACATAmplicon SizecDNA: 146 bpgenomic: 30,505
Reverse (620,21)TTGTCTCAACCACGATGGCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.711 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAA
GTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATC
CATAGGTGCCATCGTGGTTGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)146475 - 620
Exon 5 To Exon 6 (Pair 36)
Forward (471,22)AATGGGTCAAGGAGCTGAAAGAAmplicon SizecDNA: 142 bpgenomic: 30,501
Reverse (612,21)ACCACGATGGCACCTATGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAA
ACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
AATCCATAGGTGCCATCGTGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)142471 - 612
Exon 5 To Exon 6 (Pair 37)
Forward (477,22)TCAAGGAGCTGAAAGAACATGGAmplicon SizecDNA: 142 bpgenomic: 30,501
Reverse (618,20)GTCTCAACCACGATGGCACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGT
GCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCA
TAGGTGCCATCGTGGTTGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)142477 - 618
Exon 5 To Exon 6 (Pair 38)
Forward (479,22)AAGGAGCTGAAAGAACATGGTCAmplicon SizecDNA: 133 bpgenomic: 30,492
Reverse (611,21)CCACGATGGCACCTATGGATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGC
GACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCATA
GGTGCCATCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)133479 - 611
Exon 5 To Exon 6 (Pair 39)
Forward (475,22)GGTCAAGGAGCTGAAAGAACATAmplicon SizecDNA: 138 bpgenomic: 30,497
Reverse (612,21)ACCACGATGGCACCTATGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAA
GTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATC
CATAGGTGCCATCGTGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)138475 - 612
Exon 5 To Exon 6 (Pair 40)
Forward (481,21)GGAGCTGAAAGAACATGGTCCAmplicon SizecDNA: 109 bpgenomic: 30,468
Reverse (589,22)AGCGTATTCCTTAGCATCCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.783 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGA
CCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)109481 - 589
Exon 5 To Exon 6 (Pair 41)
Forward (474,21)GGGTCAAGGAGCTGAAAGAACAmplicon SizecDNA: 148 bpgenomic: 30,507
Reverse (621,21)CTTGTCTCAACCACGATGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACA
AGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAAT
CCATAGGTGCCATCGTGGTTGAGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)148474 - 621
Exon 5 To Exon 6 (Pair 42)
Forward (472,22)ATGGGTCAAGGAGCTGAAAGAAAmplicon SizecDNA: 149 bpgenomic: 30,508
Reverse (620,21)TTGTCTCAACCACGATGGCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAA
CAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGA
ATCCATAGGTGCCATCGTGGTTGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)149472 - 620
Exon 5 To Exon 6 (Pair 43)
Forward (471,22)AATGGGTCAAGGAGCTGAAAGAAmplicon SizecDNA: 141 bpgenomic: 30,500
Reverse (611,21)CCACGATGGCACCTATGGATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAA
ACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
AATCCATAGGTGCCATCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)141471 - 611
Exon 5 To Exon 6 (Pair 44)
Forward (470,22)AAATGGGTCAAGGAGCTGAAAGAmplicon SizecDNA: 144 bpgenomic: 30,503
Reverse (613,21)AACCACGATGGCACCTATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGA
AACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCT
GAATCCATAGGTGCCATCGTGGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)144470 - 613
Exon 5 To Exon 6 (Pair 45)
Forward (474,21)GGGTCAAGGAGCTGAAAGAACAmplicon SizecDNA: 117 bpgenomic: 30,476
Reverse (590,22)CAGCGTATTCCTTAGCATCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.867 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACA
AGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)117474 - 590
Exon 5 To Exon 6 (Pair 46)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 120 bpgenomic: 30,479
Reverse (603,22)GCACCTATGGATTCAGCGTATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops1.066 kcal/mol
Reverse Dimers-0.566 kcal/mol
Forward-Reverse Dimers-2.853 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCATAGGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)120484 - 603
Exon 5 To Exon 6 (Pair 47)
Forward (481,21)GGAGCTGAAAGAACATGGTCCAmplicon SizecDNA: 110 bpgenomic: 30,469
Reverse (590,22)CAGCGTATTCCTTAGCATCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.321 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGA
CCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)110481 - 590
Exon 5 To Exon 6 (Pair 48)
Forward (470,22)AAATGGGTCAAGGAGCTGAAAGAmplicon SizecDNA: 143 bpgenomic: 30,502
Reverse (612,21)ACCACGATGGCACCTATGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGA
AACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCT
GAATCCATAGGTGCCATCGTGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)143470 - 612
Exon 5 To Exon 6 (Pair 49)
Forward (475,22)GGTCAAGGAGCTGAAAGAACATAmplicon SizecDNA: 147 bpgenomic: 30,506
Reverse (621,21)CTTGTCTCAACCACGATGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.711 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAA
GTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATC
CATAGGTGCCATCGTGGTTGAGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)147475 - 621
Exon 5 To Exon 6 (Pair 50)
Forward (477,22)TCAAGGAGCTGAAAGAACATGGAmplicon SizecDNA: 132 bpgenomic: 30,491
Reverse (608,21)CGATGGCACCTATGGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGT
GCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCA
TAGGTGCCATCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)132477 - 608
Exon 5 To Exon 6 (Pair 51)
Forward (478,22)CAAGGAGCTGAAAGAACATGGTAmplicon SizecDNA: 134 bpgenomic: 30,493
Reverse (611,21)CCACGATGGCACCTATGGATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTG
CGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCAT
AGGTGCCATCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)134478 - 611
Exon 5 To Exon 6 (Pair 52)
Forward (479,22)AAGGAGCTGAAAGAACATGGTCAmplicon SizecDNA: 112 bpgenomic: 30,471
Reverse (590,22)CAGCGTATTCCTTAGCATCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.552 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGC
GACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)112479 - 590
Exon 5 To Exon 6 (Pair 53)
Forward (476,22)GTCAAGGAGCTGAAAGAACATGAmplicon SizecDNA: 115 bpgenomic: 30,474
Reverse (590,22)CAGCGTATTCCTTAGCATCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.867 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAG
TGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)115476 - 590
Exon 5 To Exon 6 (Pair 54)
Forward (474,21)GGGTCAAGGAGCTGAAAGAACAmplicon SizecDNA: 140 bpgenomic: 30,499
Reverse (613,21)AACCACGATGGCACCTATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACA
AGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAAT
CCATAGGTGCCATCGTGGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)140474 - 613
Exon 5 To Exon 6 (Pair 55)
Forward (471,22)AATGGGTCAAGGAGCTGAAAGAAmplicon SizecDNA: 140 bpgenomic: 30,499
Reverse (610,21)CACGATGGCACCTATGGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAA
ACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
AATCCATAGGTGCCATCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)140471 - 610
Exon 5 To Exon 6 (Pair 56)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 106 bpgenomic: 30,465
Reverse (589,22)AGCGTATTCCTTAGCATCCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.456 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)106484 - 589
Exon 5 To Exon 6 (Pair 57)
Forward (470,22)AAATGGGTCAAGGAGCTGAAAGAmplicon SizecDNA: 149 bpgenomic: 30,508
Reverse (618,20)GTCTCAACCACGATGGCACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGA
AACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCT
GAATCCATAGGTGCCATCGTGGTTGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)149470 - 618
Exon 5 To Exon 6 (Pair 58)
Forward (474,21)GGGTCAAGGAGCTGAAAGAACAmplicon SizecDNA: 147 bpgenomic: 30,506
Reverse (620,21)TTGTCTCAACCACGATGGCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.002 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACA
AGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAAT
CCATAGGTGCCATCGTGGTTGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)147474 - 620
Exon 5 To Exon 6 (Pair 59)
Forward (478,22)CAAGGAGCTGAAAGAACATGGTAmplicon SizecDNA: 131 bpgenomic: 30,490
Reverse (608,21)CGATGGCACCTATGGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTG
CGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCAT
AGGTGCCATCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)131478 - 608
Exon 5 To Exon 6 (Pair 60)
Forward (474,21)GGGTCAAGGAGCTGAAAGAACAmplicon SizecDNA: 139 bpgenomic: 30,498
Reverse (612,21)ACCACGATGGCACCTATGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACA
AGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAAT
CCATAGGTGCCATCGTGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)139474 - 612
Exon 5 To Exon 6 (Pair 61)
Forward (471,22)AATGGGTCAAGGAGCTGAAAGAAmplicon SizecDNA: 143 bpgenomic: 30,502
Reverse (613,21)AACCACGATGGCACCTATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAA
ACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
AATCCATAGGTGCCATCGTGGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)143471 - 613
Exon 5 To Exon 6 (Pair 62)
Forward (476,22)GTCAAGGAGCTGAAAGAACATGAmplicon SizecDNA: 135 bpgenomic: 30,494
Reverse (610,21)CACGATGGCACCTATGGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAG
TGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCC
ATAGGTGCCATCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)135476 - 610
Exon 5 To Exon 6 (Pair 63)
Forward (476,22)GTCAAGGAGCTGAAAGAACATGAmplicon SizecDNA: 145 bpgenomic: 30,504
Reverse (620,21)TTGTCTCAACCACGATGGCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAG
TGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCC
ATAGGTGCCATCGTGGTTGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)145476 - 620
Exon 5 To Exon 6 (Pair 64)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 107 bpgenomic: 30,466
Reverse (590,22)CAGCGTATTCCTTAGCATCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.994 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)107484 - 590
Exon 5 To Exon 6 (Pair 65)
Forward (478,22)CAAGGAGCTGAAAGAACATGGTAmplicon SizecDNA: 113 bpgenomic: 30,472
Reverse (590,22)CAGCGTATTCCTTAGCATCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.867 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTG
CGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)113478 - 590
Exon 5 To Exon 6 (Pair 66)
Forward (477,22)TCAAGGAGCTGAAAGAACATGGAmplicon SizecDNA: 145 bpgenomic: 30,504
Reverse (621,21)CTTGTCTCAACCACGATGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGT
GCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCA
TAGGTGCCATCGTGGTTGAGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)145477 - 621
Exon 5 To Exon 6 (Pair 67)
Forward (472,22)ATGGGTCAAGGAGCTGAAAGAAAmplicon SizecDNA: 139 bpgenomic: 30,498
Reverse (610,21)CACGATGGCACCTATGGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAA
CAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGA
ATCCATAGGTGCCATCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)139472 - 610
Exon 5 To Exon 6 (Pair 68)
Forward (474,21)GGGTCAAGGAGCTGAAAGAACAmplicon SizecDNA: 137 bpgenomic: 30,496
Reverse (610,21)CACGATGGCACCTATGGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACA
AGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAAT
CCATAGGTGCCATCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)137474 - 610
Exon 5 To Exon 6 (Pair 69)
Forward (471,22)AATGGGTCAAGGAGCTGAAAGAAmplicon SizecDNA: 138 bpgenomic: 30,497
Reverse (608,21)CGATGGCACCTATGGATTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceAATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAA
ACAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
AATCCATAGGTGCCATCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)138471 - 608
Exon 5 To Exon 6 (Pair 70)
Forward (477,22)TCAAGGAGCTGAAAGAACATGGAmplicon SizecDNA: 137 bpgenomic: 30,496
Reverse (613,21)AACCACGATGGCACCTATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGT
GCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCA
TAGGTGCCATCGTGGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)137477 - 613
Exon 5 To Exon 6 (Pair 71)
Forward (472,22)ATGGGTCAAGGAGCTGAAAGAAAmplicon SizecDNA: 140 bpgenomic: 30,499
Reverse (611,21)CCACGATGGCACCTATGGATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAA
CAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGA
ATCCATAGGTGCCATCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)140472 - 611
Exon 5 To Exon 6 (Pair 72)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 138 bpgenomic: 30,497
Reverse (621,21)CTTGTCTCAACCACGATGGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.609 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCATAGGTGC
CATCGTGGTTGAGACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)138484 - 621
Exon 5 To Exon 6 (Pair 73)
Forward (475,22)GGTCAAGGAGCTGAAAGAACATAmplicon SizecDNA: 144 bpgenomic: 30,503
Reverse (618,20)GTCTCAACCACGATGGCACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.711 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAA
GTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATC
CATAGGTGCCATCGTGGTTGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)144475 - 618
Exon 5 To Exon 6 (Pair 74)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 135 bpgenomic: 30,494
Reverse (618,20)GTCTCAACCACGATGGCACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.609 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCATAGGTGC
CATCGTGGTTGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)135484 - 618
Exon 5 To Exon 6 (Pair 75)
Forward (472,22)ATGGGTCAAGGAGCTGAAAGAAAmplicon SizecDNA: 119 bpgenomic: 30,478
Reverse (590,22)CAGCGTATTCCTTAGCATCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.538 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.867 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceATGGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAA
CAAGTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)119472 - 590
Exon 5 To Exon 6 (Pair 76)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 104 bpgenomic: 30,463
Reverse (587,22)CGTATTCCTTAGCATCCTTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops1.703 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.456 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)104484 - 587
Exon 5 To Exon 6 (Pair 77)
Forward (478,22)CAAGGAGCTGAAAGAACATGGTAmplicon SizecDNA: 133 bpgenomic: 30,492
Reverse (610,21)CACGATGGCACCTATGGATTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTG
CGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCAT
AGGTGCCATCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)133478 - 610
Exon 5 To Exon 6 (Pair 78)
Forward (476,22)GTCAAGGAGCTGAAAGAACATGAmplicon SizecDNA: 136 bpgenomic: 30,495
Reverse (611,21)CCACGATGGCACCTATGGATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAG
TGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCC
ATAGGTGCCATCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)136476 - 611
Exon 5 To Exon 6 (Pair 79)
Forward (477,22)TCAAGGAGCTGAAAGAACATGGAmplicon SizecDNA: 144 bpgenomic: 30,503
Reverse (620,21)TTGTCTCAACCACGATGGCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-1.352 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGT
GCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATCCA
TAGGTGCCATCGTGGTTGAGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)144477 - 620
Exon 5 To Exon 6 (Pair 80)
Forward (475,22)GGTCAAGGAGCTGAAAGAACATAmplicon SizecDNA: 137 bpgenomic: 30,496
Reverse (611,21)CCACGATGGCACCTATGGATTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.066 kcal/mol in 3' area
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAA
GTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATC
CATAGGTGCCATCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)137475 - 611
Exon 5 To Exon 6 (Pair 81)
Forward (475,22)GGTCAAGGAGCTGAAAGAACATAmplicon SizecDNA: 139 bpgenomic: 30,498
Reverse (613,21)AACCACGATGGCACCTATGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.674 kcal/mol
Reverse Dimers-1.66 kcal/mol
Forward-Reverse Dimers-2.449 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGGTCAAGGAGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAA
GTGCGACCTCTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGCTGAATC
CATAGGTGCCATCGTGGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)139475 - 613
Exon 5 To Exon 6 (Pair 82)
Forward (484,22)GCTGAAAGAACATGGTCCAGAAAmplicon SizecDNA: 105 bpgenomic: 30,464
Reverse (588,22)GCGTATTCCTTAGCATCCTTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.712 kcal/mol
Forward Dimers-2.598 kcal/mol
Reverse Loops1.703 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.456 kcal/mol
Amplicon Folding-1.354 kcal/mol outside primersite
Amplicon SequenceGCTGAAAGAACATGGTCCAGAAAACATTGTAATGGCCATCGCTGGAAACAAGTGCGACCT
CTCAGATATTAGGGAGGTTCCCCTGAAGGATGCTAAGGAATACGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006868 (RAB31)105484 - 588
 

See below for some more details.

Program Output:

Loading ...