Design Results for RAB3B

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (319,21)ACCTCCTTCCTCTTCCGCTATAmplicon SizecDNA: 171 bpgenomic: 39,648
Reverse (489,22)GTAATAGGCTGTTGTGATGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.246 kcal/mol
Forward Dimers0.204 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTG
GGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATC
TGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)171319 - 489
Exon 2 To Exon 3 (Pair 2)
Forward (328,21)CTCTTCCGCTATGCTGATGACAmplicon SizecDNA: 162 bpgenomic: 39,639
Reverse (489,22)GTAATAGGCTGTTGTGATGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-0.66 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGAC
TTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACACA
GCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)162328 - 489
Exon 2 To Exon 3 (Pair 3)
Forward (328,21)CTCTTCCGCTATGCTGATGACAmplicon SizecDNA: 165 bpgenomic: 39,642
Reverse (492,22)ACGGTAATAGGCTGTTGTGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.997 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGAC
TTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACACA
GCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)165328 - 492
Exon 2 To Exon 3 (Pair 4)
Forward (326,21)TCCTCTTCCGCTATGCTGATGAmplicon SizecDNA: 169 bpgenomic: 39,646
Reverse (494,21)CCACGGTAATAGGCTGTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCG
ACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACA
CAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)169326 - 494
Exon 2 To Exon 3 (Pair 5)
Forward (311,21)TTGGCAAGACCTCCTTCCTCTAmplicon SizecDNA: 180 bpgenomic: 39,657
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol
Forward Dimers-1.683 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTA
GCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAAC
TGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)180311 - 490
Exon 2 To Exon 3 (Pair 6)
Forward (309,21)TGTTGGCAAGACCTCCTTCCTAmplicon SizecDNA: 184 bpgenomic: 39,661
Reverse (492,22)ACGGTAATAGGCTGTTGTGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol in 3' area
Forward Dimers-1.683 kcal/mol
Reverse Loops0.997 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTGTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGT
TAGCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAA
ACTGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTA
CCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)184309 - 492
Exon 2 To Exon 3 (Pair 7)
Forward (326,21)TCCTCTTCCGCTATGCTGATGAmplicon SizecDNA: 167 bpgenomic: 39,644
Reverse (492,22)ACGGTAATAGGCTGTTGTGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.997 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCG
ACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACA
CAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)167326 - 492
Exon 2 To Exon 3 (Pair 8)
Forward (312,21)TGGCAAGACCTCCTTCCTCTTAmplicon SizecDNA: 179 bpgenomic: 39,656
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol
Forward Dimers-0.933 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAG
CACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACT
GCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)179312 - 490
Exon 2 To Exon 3 (Pair 9)
Forward (328,21)CTCTTCCGCTATGCTGATGACAmplicon SizecDNA: 159 bpgenomic: 39,636
Reverse (486,21)ATAGGCTGTTGTGATGGTCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-0.426 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGAC
TTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACACA
GCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)159328 - 486
Exon 2 To Exon 3 (Pair 10)
Forward (326,21)TCCTCTTCCGCTATGCTGATGAmplicon SizecDNA: 163 bpgenomic: 39,640
Reverse (488,22)TAATAGGCTGTTGTGATGGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCG
ACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACA
CAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)163326 - 488
Exon 2 To Exon 3 (Pair 11)
Forward (327,21)CCTCTTCCGCTATGCTGATGAAmplicon SizecDNA: 166 bpgenomic: 39,643
Reverse (492,22)ACGGTAATAGGCTGTTGTGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.997 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGA
CTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACAC
AGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)166327 - 492
Exon 2 To Exon 3 (Pair 12)
Forward (309,21)TGTTGGCAAGACCTCCTTCCTAmplicon SizecDNA: 186 bpgenomic: 39,663
Reverse (494,21)CCACGGTAATAGGCTGTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol in 3' area
Forward Dimers-1.683 kcal/mol
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTGTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGT
TAGCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAA
ACTGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTA
CCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)186309 - 494
Exon 2 To Exon 3 (Pair 13)
Forward (322,21)TCCTTCCTCTTCCGCTATGCTAmplicon SizecDNA: 168 bpgenomic: 39,645
Reverse (489,22)GTAATAGGCTGTTGTGATGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGC
ATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGG
GACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)168322 - 489
Exon 2 To Exon 3 (Pair 14)
Forward (322,21)TCCTTCCTCTTCCGCTATGCTAmplicon SizecDNA: 172 bpgenomic: 39,649
Reverse (493,22)CACGGTAATAGGCTGTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGC
ATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGG
GACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)172322 - 493
Exon 2 To Exon 3 (Pair 15)
Forward (328,21)CTCTTCCGCTATGCTGATGACAmplicon SizecDNA: 166 bpgenomic: 39,643
Reverse (493,22)CACGGTAATAGGCTGTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGAC
TTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACACA
GCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)166328 - 493
Exon 2 To Exon 3 (Pair 16)
Forward (317,20)AGACCTCCTTCCTCTTCCGCAmplicon SizecDNA: 174 bpgenomic: 39,651
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.722 kcal/mol
Forward Dimers0.066 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCG
TGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGA
TCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)174317 - 490
Exon 2 To Exon 3 (Pair 17)
Forward (324,21)CTTCCTCTTCCGCTATGCTGAAmplicon SizecDNA: 171 bpgenomic: 39,648
Reverse (494,21)CCACGGTAATAGGCTGTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCAT
CGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGA
CACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)171324 - 494
Exon 2 To Exon 3 (Pair 18)
Forward (328,21)CTCTTCCGCTATGCTGATGACAmplicon SizecDNA: 167 bpgenomic: 39,644
Reverse (494,21)CCACGGTAATAGGCTGTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGAC
TTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACACA
GCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)167328 - 494
Exon 2 To Exon 3 (Pair 19)
Forward (309,21)TGTTGGCAAGACCTCCTTCCTAmplicon SizecDNA: 187 bpgenomic: 39,664
Reverse (495,21)CCCACGGTAATAGGCTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol in 3' area
Forward Dimers-1.683 kcal/mol
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTGTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGT
TAGCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAA
ACTGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTA
CCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)187309 - 495
Exon 2 To Exon 3 (Pair 20)
Forward (327,21)CCTCTTCCGCTATGCTGATGAAmplicon SizecDNA: 163 bpgenomic: 39,640
Reverse (489,22)GTAATAGGCTGTTGTGATGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.061 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGA
CTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACAC
AGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)163327 - 489
Exon 2 To Exon 3 (Pair 21)
Forward (327,21)CCTCTTCCGCTATGCTGATGAAmplicon SizecDNA: 162 bpgenomic: 39,639
Reverse (488,22)TAATAGGCTGTTGTGATGGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.061 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGA
CTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACAC
AGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)162327 - 488
Exon 2 To Exon 3 (Pair 22)
Forward (309,21)TGTTGGCAAGACCTCCTTCCTAmplicon SizecDNA: 185 bpgenomic: 39,662
Reverse (493,22)CACGGTAATAGGCTGTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol in 3' area
Forward Dimers-1.683 kcal/mol
Reverse Loops0.523 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTGTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGT
TAGCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAA
ACTGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTA
CCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)185309 - 493
Exon 2 To Exon 3 (Pair 23)
Forward (326,21)TCCTCTTCCGCTATGCTGATGAmplicon SizecDNA: 161 bpgenomic: 39,638
Reverse (486,21)ATAGGCTGTTGTGATGGTCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCG
ACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACA
CAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)161326 - 486
Exon 2 To Exon 3 (Pair 24)
Forward (312,21)TGGCAAGACCTCCTTCCTCTTAmplicon SizecDNA: 182 bpgenomic: 39,659
Reverse (493,22)CACGGTAATAGGCTGTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol
Forward Dimers-0.933 kcal/mol
Reverse Loops0.523 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAG
CACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACT
GCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCG
TG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)182312 - 493
Exon 2 To Exon 3 (Pair 25)
Forward (327,21)CCTCTTCCGCTATGCTGATGAAmplicon SizecDNA: 167 bpgenomic: 39,644
Reverse (493,22)CACGGTAATAGGCTGTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGA
CTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACAC
AGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)167327 - 493
Exon 2 To Exon 3 (Pair 26)
Forward (324,21)CTTCCTCTTCCGCTATGCTGAAmplicon SizecDNA: 170 bpgenomic: 39,647
Reverse (493,22)CACGGTAATAGGCTGTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCAT
CGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGA
CACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)170324 - 493
Exon 2 To Exon 3 (Pair 27)
Forward (311,21)TTGGCAAGACCTCCTTCCTCTAmplicon SizecDNA: 185 bpgenomic: 39,662
Reverse (495,21)CCCACGGTAATAGGCTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol
Forward Dimers-1.683 kcal/mol
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTA
GCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAAC
TGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
GTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)185311 - 495
Exon 2 To Exon 3 (Pair 28)
Forward (322,21)TCCTTCCTCTTCCGCTATGCTAmplicon SizecDNA: 173 bpgenomic: 39,650
Reverse (494,21)CCACGGTAATAGGCTGTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGC
ATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGG
GACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)173322 - 494
Exon 2 To Exon 3 (Pair 29)
Forward (319,21)ACCTCCTTCCTCTTCCGCTATAmplicon SizecDNA: 168 bpgenomic: 39,645
Reverse (486,21)ATAGGCTGTTGTGATGGTCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.246 kcal/mol
Forward Dimers0.204 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTG
GGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATC
TGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)168319 - 486
Exon 2 To Exon 3 (Pair 30)
Forward (326,21)TCCTCTTCCGCTATGCTGATGAmplicon SizecDNA: 168 bpgenomic: 39,645
Reverse (493,22)CACGGTAATAGGCTGTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCG
ACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACA
CAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)168326 - 493
Exon 2 To Exon 3 (Pair 31)
Forward (311,21)TTGGCAAGACCTCCTTCCTCTAmplicon SizecDNA: 184 bpgenomic: 39,661
Reverse (494,21)CCACGGTAATAGGCTGTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol
Forward Dimers-1.683 kcal/mol
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTA
GCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAAC
TGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
GTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)184311 - 494
Exon 2 To Exon 3 (Pair 32)
Forward (327,21)CCTCTTCCGCTATGCTGATGAAmplicon SizecDNA: 160 bpgenomic: 39,637
Reverse (486,21)ATAGGCTGTTGTGATGGTCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.061 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGA
CTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACAC
AGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)160327 - 486
Exon 2 To Exon 3 (Pair 33)
Forward (328,21)CTCTTCCGCTATGCTGATGACAmplicon SizecDNA: 163 bpgenomic: 39,640
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-0.66 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGAC
TTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACACA
GCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)163328 - 490
Exon 2 To Exon 3 (Pair 34)
Forward (307,21)AGTGTTGGCAAGACCTCCTTCAmplicon SizecDNA: 187 bpgenomic: 39,664
Reverse (493,22)CACGGTAATAGGCTGTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol in 3' area
Forward Dimers-2.999 kcal/mol
Reverse Loops0.523 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceAGTGTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTC
GTTAGCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTG
AAACTGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTAT
TACCGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)187307 - 493
Exon 2 To Exon 3 (Pair 35)
Forward (307,21)AGTGTTGGCAAGACCTCCTTCAmplicon SizecDNA: 188 bpgenomic: 39,665
Reverse (494,21)CCACGGTAATAGGCTGTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol in 3' area
Forward Dimers-2.999 kcal/mol
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceAGTGTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTC
GTTAGCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTG
AAACTGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTAT
TACCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)188307 - 494
Exon 2 To Exon 3 (Pair 36)
Forward (322,21)TCCTTCCTCTTCCGCTATGCTAmplicon SizecDNA: 171 bpgenomic: 39,648
Reverse (492,22)ACGGTAATAGGCTGTTGTGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops0.997 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGC
ATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGG
GACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)171322 - 492
Exon 2 To Exon 3 (Pair 37)
Forward (326,21)TCCTCTTCCGCTATGCTGATGAmplicon SizecDNA: 164 bpgenomic: 39,641
Reverse (489,22)GTAATAGGCTGTTGTGATGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCG
ACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACA
CAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)164326 - 489
Exon 2 To Exon 3 (Pair 38)
Forward (327,21)CCTCTTCCGCTATGCTGATGAAmplicon SizecDNA: 164 bpgenomic: 39,641
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.061 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGA
CTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACAC
AGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)164327 - 490
Exon 2 To Exon 3 (Pair 39)
Forward (307,21)AGTGTTGGCAAGACCTCCTTCAmplicon SizecDNA: 186 bpgenomic: 39,663
Reverse (492,22)ACGGTAATAGGCTGTTGTGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol in 3' area
Forward Dimers-2.999 kcal/mol
Reverse Loops0.997 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceAGTGTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTC
GTTAGCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTG
AAACTGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTAT
TACCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)186307 - 492
Exon 2 To Exon 3 (Pair 40)
Forward (309,21)TGTTGGCAAGACCTCCTTCCTAmplicon SizecDNA: 182 bpgenomic: 39,659
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol in 3' area
Forward Dimers-1.683 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTGTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGT
TAGCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAA
ACTGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTA
CC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)182309 - 490
Exon 2 To Exon 3 (Pair 41)
Forward (327,21)CCTCTTCCGCTATGCTGATGAAmplicon SizecDNA: 169 bpgenomic: 39,646
Reverse (495,21)CCCACGGTAATAGGCTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGA
CTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACAC
AGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)169327 - 495
Exon 2 To Exon 3 (Pair 42)
Forward (322,21)TCCTTCCTCTTCCGCTATGCTAmplicon SizecDNA: 174 bpgenomic: 39,651
Reverse (495,21)CCCACGGTAATAGGCTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGC
ATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGG
GACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)174322 - 495
Exon 2 To Exon 3 (Pair 43)
Forward (326,21)TCCTCTTCCGCTATGCTGATGAmplicon SizecDNA: 165 bpgenomic: 39,642
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCG
ACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACA
CAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)165326 - 490
Exon 2 To Exon 3 (Pair 44)
Forward (322,21)TCCTTCCTCTTCCGCTATGCTAmplicon SizecDNA: 169 bpgenomic: 39,646
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGC
ATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGG
GACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)169322 - 490
Exon 2 To Exon 3 (Pair 45)
Forward (326,21)TCCTCTTCCGCTATGCTGATGAmplicon SizecDNA: 170 bpgenomic: 39,647
Reverse (495,21)CCCACGGTAATAGGCTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCG
ACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACA
CAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)170326 - 495
Exon 2 To Exon 3 (Pair 46)
Forward (328,21)CTCTTCCGCTATGCTGATGACAmplicon SizecDNA: 161 bpgenomic: 39,638
Reverse (488,22)TAATAGGCTGTTGTGATGGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-0.66 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGAC
TTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACACA
GCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)161328 - 488
Exon 2 To Exon 3 (Pair 47)
Forward (324,21)CTTCCTCTTCCGCTATGCTGAAmplicon SizecDNA: 163 bpgenomic: 39,640
Reverse (486,21)ATAGGCTGTTGTGATGGTCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCAT
CGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGA
CACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)163324 - 486
Exon 2 To Exon 3 (Pair 48)
Forward (319,21)ACCTCCTTCCTCTTCCGCTATAmplicon SizecDNA: 170 bpgenomic: 39,647
Reverse (488,22)TAATAGGCTGTTGTGATGGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.246 kcal/mol
Forward Dimers0.204 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTG
GGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATC
TGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)170319 - 488
Exon 2 To Exon 3 (Pair 49)
Forward (324,21)CTTCCTCTTCCGCTATGCTGAAmplicon SizecDNA: 172 bpgenomic: 39,649
Reverse (495,21)CCCACGGTAATAGGCTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCAT
CGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGA
CACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)172324 - 495
Exon 2 To Exon 3 (Pair 50)
Forward (312,21)TGGCAAGACCTCCTTCCTCTTAmplicon SizecDNA: 184 bpgenomic: 39,661
Reverse (495,21)CCCACGGTAATAGGCTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol
Forward Dimers-0.933 kcal/mol
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAG
CACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACT
GCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCG
TGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)184312 - 495
Exon 2 To Exon 3 (Pair 51)
Forward (312,21)TGGCAAGACCTCCTTCCTCTTAmplicon SizecDNA: 181 bpgenomic: 39,658
Reverse (492,22)ACGGTAATAGGCTGTTGTGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol
Forward Dimers-0.933 kcal/mol
Reverse Loops0.997 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAG
CACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACT
GCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCG
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)181312 - 492
Exon 2 To Exon 3 (Pair 52)
Forward (322,21)TCCTTCCTCTTCCGCTATGCTAmplicon SizecDNA: 165 bpgenomic: 39,642
Reverse (486,21)ATAGGCTGTTGTGATGGTCCGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGC
ATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGG
GACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)165322 - 486
Exon 2 To Exon 3 (Pair 53)
Forward (319,21)ACCTCCTTCCTCTTCCGCTATAmplicon SizecDNA: 172 bpgenomic: 39,649
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops999.246 kcal/mol
Forward Dimers0.204 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTG
GGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATC
TGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)172319 - 490
Exon 2 To Exon 3 (Pair 54)
Forward (324,21)CTTCCTCTTCCGCTATGCTGAAmplicon SizecDNA: 166 bpgenomic: 39,643
Reverse (489,22)GTAATAGGCTGTTGTGATGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCAT
CGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGA
CACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)166324 - 489
Exon 2 To Exon 3 (Pair 55)
Forward (306,21)CAGTGTTGGCAAGACCTCCTTAmplicon SizecDNA: 254 bpgenomic: 39,731
Reverse (559,22)AGTCTTGGACAGCATTGAAGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.916 kcal/mol
Forward Dimers-2.999 kcal/mol
Reverse Loops1.2 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.6 kcal/mol
Amplicon Folding-2.379 kcal/mol outside primersite
Amplicon SequenceCAGTGTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTT
CGTTAGCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGT
GAAACTGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTA
TTACCGTGGGGCCATGGGCTTCATTCTGATGTATGACATCACCAATGAAGAGTCCTTCAA
TGCTGTCCAAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)254306 - 559
Exon 2 To Exon 3 (Pair 56)
Forward (328,21)CTCTTCCGCTATGCTGATGACAmplicon SizecDNA: 168 bpgenomic: 39,645
Reverse (495,21)CCCACGGTAATAGGCTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGAC
TTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACACA
GCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)168328 - 495
Exon 2 To Exon 3 (Pair 57)
Forward (312,21)TGGCAAGACCTCCTTCCTCTTAmplicon SizecDNA: 183 bpgenomic: 39,660
Reverse (494,21)CCACGGTAATAGGCTGTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol
Forward Dimers-0.933 kcal/mol
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAG
CACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACT
GCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCG
TGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)183312 - 494
Exon 2 To Exon 3 (Pair 58)
Forward (318,20)GACCTCCTTCCTCTTCCGCTAmplicon SizecDNA: 173 bpgenomic: 39,650
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.19 kcal/mol
Forward Dimers0.204 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGT
GGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGAT
CTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)173318 - 490
Exon 2 To Exon 3 (Pair 59)
Forward (307,21)AGTGTTGGCAAGACCTCCTTCAmplicon SizecDNA: 189 bpgenomic: 39,666
Reverse (495,21)CCCACGGTAATAGGCTGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol in 3' area
Forward Dimers-2.999 kcal/mol
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceAGTGTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTC
GTTAGCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTG
AAACTGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTAT
TACCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)189307 - 495
Exon 2 To Exon 3 (Pair 60)
Forward (311,21)TTGGCAAGACCTCCTTCCTCTAmplicon SizecDNA: 182 bpgenomic: 39,659
Reverse (492,22)ACGGTAATAGGCTGTTGTGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol
Forward Dimers-1.683 kcal/mol
Reverse Loops0.997 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTA
GCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAAC
TGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
GT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)182311 - 492
Exon 2 To Exon 3 (Pair 61)
Forward (327,21)CCTCTTCCGCTATGCTGATGAAmplicon SizecDNA: 168 bpgenomic: 39,645
Reverse (494,21)CCACGGTAATAGGCTGTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol
Forward Dimers0.044 kcal/mol in 3' area
Reverse Loops0.523 kcal/mol in 3' area
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCATCGA
CTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGACAC
AGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)168327 - 494
Exon 2 To Exon 3 (Pair 62)
Forward (324,21)CTTCCTCTTCCGCTATGCTGAAmplicon SizecDNA: 169 bpgenomic: 39,646
Reverse (492,22)ACGGTAATAGGCTGTTGTGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops0.997 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.837 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCAT
CGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGA
CACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)169324 - 492
Exon 2 To Exon 3 (Pair 63)
Forward (322,21)TCCTTCCTCTTCCGCTATGCTAmplicon SizecDNA: 167 bpgenomic: 39,644
Reverse (488,22)TAATAGGCTGTTGTGATGGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGC
ATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGG
GACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)167322 - 488
Exon 2 To Exon 3 (Pair 64)
Forward (324,21)CTTCCTCTTCCGCTATGCTGAAmplicon SizecDNA: 167 bpgenomic: 39,644
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCAT
CGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGA
CACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)167324 - 490
Exon 2 To Exon 3 (Pair 65)
Forward (324,21)CTTCCTCTTCCGCTATGCTGAAmplicon SizecDNA: 165 bpgenomic: 39,642
Reverse (488,22)TAATAGGCTGTTGTGATGGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.925 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol in 3' area
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.366 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTAGCACCGTGGGCAT
CGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAACTGCAGATCTGGGA
CACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)165324 - 488
Exon 2 To Exon 3 (Pair 66)
Forward (311,21)TTGGCAAGACCTCCTTCCTCTAmplicon SizecDNA: 183 bpgenomic: 39,660
Reverse (493,22)CACGGTAATAGGCTGTTGTGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol
Forward Dimers-1.683 kcal/mol
Reverse Loops0.523 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTCGTTA
GCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTGAAAC
TGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACC
GTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)183311 - 493
Exon 2 To Exon 3 (Pair 67)
Forward (307,21)AGTGTTGGCAAGACCTCCTTCAmplicon SizecDNA: 184 bpgenomic: 39,661
Reverse (490,22)GGTAATAGGCTGTTGTGATGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.799 kcal/mol in 3' area
Forward Dimers-2.999 kcal/mol
Reverse Loops1.555 kcal/mol
Reverse Dimers-1.785 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.531 kcal/mol outside primersite
Amplicon SequenceAGTGTTGGCAAGACCTCCTTCCTCTTCCGCTATGCTGATGACACGTTCACCCCAGCCTTC
GTTAGCACCGTGGGCATCGACTTCAAGGTGAAGACAGTCTACCGTCACGAGAAGCGGGTG
AAACTGCAGATCTGGGACACAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTAT
TACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)184307 - 490
Exon 3 To Exon 4 (Pair 1)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 106 bpgenomic: 3,957
Reverse (636,22)TTCCTCCATGTCACACTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)106531 - 636
Exon 3 To Exon 4 (Pair 2)
Forward (468,22)GACCATCACAACAGCCTATTACAmplicon SizecDNA: 182 bpgenomic: 4,033
Reverse (649,21)GAACAACCCTCTCTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.47 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops2.815 kcal/mol
Reverse Dimers0.789 kcal/mol
Forward-Reverse Dimers-0.271 kcal/mol
Amplicon Folding-1.94 kcal/mol outside primersite
Amplicon SequenceGACCATCACAACAGCCTATTACCGTGGGGCCATGGGCTTCATTCTGATGTATGACATCAC
CAATGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTG
GGACAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGT
TC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)182468 - 649
Exon 3 To Exon 5 (Pair 1)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 179 bpgenomic: 17,233
Reverse (709,23)CACTGGCTTCAAAGAAATCAAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops1.332 kcal/mol
Reverse Dimers-0.993 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCC
CACTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)179531 - 709
Exon 3 To Exon 5 (Pair 2)
Forward (534,22)AGAGTCCTTCAATGCTGTCCAAAmplicon SizecDNA: 189 bpgenomic: 17,243
Reverse (722,22)ATGTTCTCCTTTGCACTGGCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.722 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops0.958 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACAA
TGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCAC
TGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCAAA
GGAGAACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)189534 - 722
Exon 3 To Exon 4 (Pair 3)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 103 bpgenomic: 3,954
Reverse (633,21)CTCCATGTCACACTTGTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)103531 - 633
Exon 3 To Exon 5 (Pair 3)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 274 bpgenomic: 17,328
Reverse (804,20)CATCGACGGGTCTGTGTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops1.123 kcal/mol
Reverse Dimers-1.314 kcal/mol
Forward-Reverse Dimers-0.993 kcal/mol
Amplicon Folding-2.85 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCC
CACTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGC
AAAGGAGAACATCAGTGTAAGGCAGGCCTTTGAGCGCCTGGTGGATGCCATTTGTGACAA
GATGTCTGATTCGCTGGACACAGACCCGTCGATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)274531 - 804
Exon 3 To Exon 5 (Pair 4)
Forward (534,22)AGAGTCCTTCAATGCTGTCCAAAmplicon SizecDNA: 175 bpgenomic: 17,229
Reverse (708,23)ACTGGCTTCAAAGAAATCAAACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.722 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.332 kcal/mol
Reverse Dimers-0.993 kcal/mol
Forward-Reverse Dimers-1.289 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACAA
TGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCAC
TGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)175534 - 708
Exon 3 To Exon 4 (Pair 4)
Forward (471,22)CATCACAACAGCCTATTACCGTAmplicon SizecDNA: 179 bpgenomic: 4,030
Reverse (649,21)GAACAACCCTCTCTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.484 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops2.815 kcal/mol
Reverse Dimers0.789 kcal/mol
Forward-Reverse Dimers-0.271 kcal/mol
Amplicon Folding-1.94 kcal/mol outside primersite
Amplicon SequenceCATCACAACAGCCTATTACCGTGGGGCCATGGGCTTCATTCTGATGTATGACATCACCAA
TGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)179471 - 649
Exon 3 To Exon 4 (Pair 5)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 119 bpgenomic: 3,970
Reverse (649,21)GAACAACCCTCTCTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops2.815 kcal/mol
Reverse Dimers0.789 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)119531 - 649
Exon 3 To Exon 4 (Pair 6)
Forward (447,19)AGCTGGGCAGGAGCGGTACAmplicon SizecDNA: 188 bpgenomic: 4,039
Reverse (634,21)CCTCCATGTCACACTTGTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.966 kcal/mol
Forward Dimers-1.606 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.919 kcal/mol
Amplicon Folding-1.94 kcal/mol outside primersite
Amplicon SequenceAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGGGGCCATGGGCTT
CATTCTGATGTATGACATCACCAATGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTAC
TCAGATCAAGACCTACTCCTGGGACAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGA
CATGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)188447 - 634
Exon 3 To Exon 4 (Pair 7)
Forward (534,22)AGAGTCCTTCAATGCTGTCCAAAmplicon SizecDNA: 103 bpgenomic: 3,954
Reverse (636,22)TTCCTCCATGTCACACTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.722 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACAA
TGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)103534 - 636
Exon 3 To Exon 4 (Pair 8)
Forward (533,22)AAGAGTCCTTCAATGCTGTCCAAmplicon SizecDNA: 102 bpgenomic: 3,953
Reverse (634,21)CCTCCATGTCACACTTGTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.396 kcal/mol
Forward Dimers-0.436 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACA
ATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)102533 - 634
Exon 3 To Exon 4 (Pair 9)
Forward (466,21)CGGACCATCACAACAGCCTATAmplicon SizecDNA: 173 bpgenomic: 4,024
Reverse (638,22)TCTTCCTCCATGTCACACTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.193 kcal/mol
Forward Dimers-0.613 kcal/mol
Reverse Loops1.667 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.246 kcal/mol
Amplicon Folding-1.94 kcal/mol outside primersite
Amplicon SequenceCGGACCATCACAACAGCCTATTACCGTGGGGCCATGGGCTTCATTCTGATGTATGACATC
ACCAATGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCC
TGGGACAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)173466 - 638
Exon 3 To Exon 5 (Pair 5)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 190 bpgenomic: 17,244
Reverse (720,21)GTTCTCCTTTGCACTGGCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops0.958 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCC
CACTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGC
AAAGGAGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)190531 - 720
Exon 3 To Exon 5 (Pair 6)
Forward (533,22)AAGAGTCCTTCAATGCTGTCCAAmplicon SizecDNA: 180 bpgenomic: 17,234
Reverse (712,23)TTGCACTGGCTTCAAAGAAATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.396 kcal/mol
Forward Dimers-0.436 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACA
ATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCA
CTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)180533 - 712
Exon 3 To Exon 5 (Pair 7)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 178 bpgenomic: 17,232
Reverse (708,23)ACTGGCTTCAAAGAAATCAAACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops1.332 kcal/mol
Reverse Dimers-0.993 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCC
CACTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)178531 - 708
Exon 3 To Exon 4 (Pair 10)
Forward (446,19)CAGCTGGGCAGGAGCGGTAAmplicon SizecDNA: 189 bpgenomic: 4,040
Reverse (634,21)CCTCCATGTCACACTTGTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.966 kcal/mol in 3' area
Forward Dimers-2.686 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.919 kcal/mol
Amplicon Folding-1.94 kcal/mol outside primersite
Amplicon SequenceCAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGGGGCCATGGGCT
TCATTCTGATGTATGACATCACCAATGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTA
CTCAGATCAAGACCTACTCCTGGGACAATGCACAAGTTATTCTGGTGGGGAACAAGTGTG
ACATGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)189446 - 634
Exon 3 To Exon 4 (Pair 11)
Forward (472,22)ATCACAACAGCCTATTACCGTGAmplicon SizecDNA: 167 bpgenomic: 4,018
Reverse (638,22)TCTTCCTCCATGTCACACTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.087 kcal/mol in 3' area
Forward Dimers0.011 kcal/mol in 3' area
Reverse Loops1.667 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.246 kcal/mol
Amplicon Folding-1.94 kcal/mol outside primersite
Amplicon SequenceATCACAACAGCCTATTACCGTGGGGCCATGGGCTTCATTCTGATGTATGACATCACCAAT
GAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGAC
AATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)167472 - 638
Exon 3 To Exon 5 (Pair 8)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 192 bpgenomic: 17,246
Reverse (722,22)ATGTTCTCCTTTGCACTGGCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops0.958 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCC
CACTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGC
AAAGGAGAACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)192531 - 722
Exon 3 To Exon 5 (Pair 9)
Forward (534,22)AGAGTCCTTCAATGCTGTCCAAAmplicon SizecDNA: 201 bpgenomic: 17,255
Reverse (734,22)TGCCTTACACTGATGTTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.722 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops0.67 kcal/mol
Reverse Dimers-0.495 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACAA
TGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCAC
TGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCAAA
GGAGAACATCAGTGTAAGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)201534 - 734
Exon 3 To Exon 4 (Pair 12)
Forward (534,22)AGAGTCCTTCAATGCTGTCCAAAmplicon SizecDNA: 101 bpgenomic: 3,952
Reverse (634,21)CCTCCATGTCACACTTGTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.722 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACAA
TGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)101534 - 634
Exon 3 To Exon 5 (Pair 10)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 203 bpgenomic: 17,257
Reverse (733,22)GCCTTACACTGATGTTCTCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops0.67 kcal/mol
Reverse Dimers-0.495 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCC
CACTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGC
AAAGGAGAACATCAGTGTAAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)203531 - 733
Exon 3 To Exon 4 (Pair 13)
Forward (446,19)CAGCTGGGCAGGAGCGGTAAmplicon SizecDNA: 188 bpgenomic: 4,039
Reverse (633,21)CTCCATGTCACACTTGTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.966 kcal/mol in 3' area
Forward Dimers-2.686 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.708 kcal/mol
Amplicon Folding-1.94 kcal/mol outside primersite
Amplicon SequenceCAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGGGGCCATGGGCT
TCATTCTGATGTATGACATCACCAATGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTA
CTCAGATCAAGACCTACTCCTGGGACAATGCACAAGTTATTCTGGTGGGGAACAAGTGTG
ACATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)188446 - 633
Exon 3 To Exon 4 (Pair 14)
Forward (471,22)CATCACAACAGCCTATTACCGTAmplicon SizecDNA: 168 bpgenomic: 4,019
Reverse (638,22)TCTTCCTCCATGTCACACTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.484 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops1.667 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.246 kcal/mol
Amplicon Folding-1.94 kcal/mol outside primersite
Amplicon SequenceCATCACAACAGCCTATTACCGTGGGGCCATGGGCTTCATTCTGATGTATGACATCACCAA
TGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)168471 - 638
Exon 3 To Exon 5 (Pair 11)
Forward (533,22)AAGAGTCCTTCAATGCTGTCCAAmplicon SizecDNA: 190 bpgenomic: 17,244
Reverse (722,22)ATGTTCTCCTTTGCACTGGCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.396 kcal/mol
Forward Dimers-0.436 kcal/mol
Reverse Loops0.958 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACA
ATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCA
CTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCAA
AGGAGAACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)190533 - 722
Exon 3 To Exon 5 (Pair 12)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 208 bpgenomic: 17,262
Reverse (738,21)GGCCTGCCTTACACTGATGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops0.67 kcal/mol in 3' area
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCC
CACTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGC
AAAGGAGAACATCAGTGTAAGGCAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)208531 - 738
Exon 3 To Exon 5 (Pair 13)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 180 bpgenomic: 17,234
Reverse (710,23)GCACTGGCTTCAAAGAAATCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops1.229 kcal/mol
Reverse Dimers-0.993 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCC
CACTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)180531 - 710
Exon 3 To Exon 4 (Pair 15)
Forward (447,19)AGCTGGGCAGGAGCGGTACAmplicon SizecDNA: 192 bpgenomic: 4,043
Reverse (638,22)TCTTCCTCCATGTCACACTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.966 kcal/mol
Forward Dimers-1.606 kcal/mol
Reverse Loops1.667 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-2.211 kcal/mol
Amplicon Folding-1.94 kcal/mol outside primersite
Amplicon SequenceAGCTGGGCAGGAGCGGTACCGGACCATCACAACAGCCTATTACCGTGGGGCCATGGGCTT
CATTCTGATGTATGACATCACCAATGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTAC
TCAGATCAAGACCTACTCCTGGGACAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGA
CATGGAGGAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)192447 - 638
Exon 3 To Exon 5 (Pair 14)
Forward (533,22)AAGAGTCCTTCAATGCTGTCCAAmplicon SizecDNA: 202 bpgenomic: 17,256
Reverse (734,22)TGCCTTACACTGATGTTCTCCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.396 kcal/mol
Forward Dimers-0.436 kcal/mol
Reverse Loops0.67 kcal/mol
Reverse Dimers-0.495 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACA
ATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCA
CTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCAA
AGGAGAACATCAGTGTAAGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)202533 - 734
Exon 3 To Exon 5 (Pair 15)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 182 bpgenomic: 17,236
Reverse (712,23)TTGCACTGGCTTCAAAGAAATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCC
CACTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGC
AA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)182531 - 712
Exon 3 To Exon 5 (Pair 16)
Forward (533,22)AAGAGTCCTTCAATGCTGTCCAAmplicon SizecDNA: 177 bpgenomic: 17,231
Reverse (709,23)CACTGGCTTCAAAGAAATCAAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.396 kcal/mol
Forward Dimers-0.436 kcal/mol
Reverse Loops1.332 kcal/mol
Reverse Dimers-0.993 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACA
ATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCA
CTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)177533 - 709
Exon 3 To Exon 5 (Pair 17)
Forward (534,22)AGAGTCCTTCAATGCTGTCCAAAmplicon SizecDNA: 200 bpgenomic: 17,254
Reverse (733,22)GCCTTACACTGATGTTCTCCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.722 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops0.67 kcal/mol
Reverse Dimers-0.495 kcal/mol
Forward-Reverse Dimers-1.705 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACAA
TGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCAC
TGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCAAA
GGAGAACATCAGTGTAAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)200534 - 733
Exon 3 To Exon 5 (Pair 18)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 183 bpgenomic: 17,237
Reverse (713,23)TTTGCACTGGCTTCAAAGAAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.101 kcal/mol
Amplicon Folding-1.886 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCC
CACTGAGAAGGGCCAGCTCCTTGCAGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGC
AAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)183531 - 713
 

See below for some more details.

Program Output:

Loading ...