Design Results for RAB3B

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size90Maximal Amplicon Size125
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 4 (Pair 1)
Forward (533,22)AAGAGTCCTTCAATGCTGTCCAAmplicon SizecDNA: 117 bpgenomic: 3,968
Reverse (649,21)GAACAACCCTCTCTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.396 kcal/mol
Forward Dimers-0.436 kcal/mol
Reverse Loops2.815 kcal/mol
Reverse Dimers0.789 kcal/mol
Forward-Reverse Dimers-1.65 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACA
ATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)117533 - 649
Exon 3 To Exon 4 (Pair 2)
Forward (534,22)AGAGTCCTTCAATGCTGTCCAAAmplicon SizecDNA: 103 bpgenomic: 3,954
Reverse (636,22)TTCCTCCATGTCACACTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.722 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACAA
TGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)103534 - 636
Exon 3 To Exon 4 (Pair 3)
Forward (534,22)AGAGTCCTTCAATGCTGTCCAAAmplicon SizecDNA: 116 bpgenomic: 3,967
Reverse (649,21)GAACAACCCTCTCTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.722 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops2.815 kcal/mol
Reverse Dimers0.789 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACAA
TGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)116534 - 649
Exon 3 To Exon 4 (Pair 4)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 106 bpgenomic: 3,957
Reverse (636,22)TTCCTCCATGTCACACTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)106531 - 636
Exon 3 To Exon 4 (Pair 5)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 103 bpgenomic: 3,954
Reverse (633,21)CTCCATGTCACACTTGTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)103531 - 633
Exon 3 To Exon 4 (Pair 6)
Forward (533,22)AAGAGTCCTTCAATGCTGTCCAAmplicon SizecDNA: 104 bpgenomic: 3,955
Reverse (636,22)TTCCTCCATGTCACACTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.396 kcal/mol
Forward Dimers-0.436 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACA
ATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)104533 - 636
Exon 3 To Exon 4 (Pair 7)
Forward (534,22)AGAGTCCTTCAATGCTGTCCAAAmplicon SizecDNA: 100 bpgenomic: 3,951
Reverse (633,21)CTCCATGTCACACTTGTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.722 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACAA
TGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)100534 - 633
Exon 3 To Exon 4 (Pair 8)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 119 bpgenomic: 3,970
Reverse (649,21)GAACAACCCTCTCTTCCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops2.815 kcal/mol
Reverse Dimers0.789 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)119531 - 649
Exon 3 To Exon 4 (Pair 9)
Forward (531,22)TGAAGAGTCCTTCAATGCTGTCAmplicon SizecDNA: 104 bpgenomic: 3,955
Reverse (634,21)CCTCCATGTCACACTTGTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.479 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceTGAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGA
CAATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)104531 - 634
Exon 3 To Exon 4 (Pair 10)
Forward (533,22)AAGAGTCCTTCAATGCTGTCCAAmplicon SizecDNA: 102 bpgenomic: 3,953
Reverse (634,21)CCTCCATGTCACACTTGTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.396 kcal/mol
Forward Dimers-0.436 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACA
ATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)102533 - 634
Exon 3 To Exon 4 (Pair 11)
Forward (533,22)AAGAGTCCTTCAATGCTGTCCAAmplicon SizecDNA: 101 bpgenomic: 3,952
Reverse (633,21)CTCCATGTCACACTTGTTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.396 kcal/mol
Forward Dimers-0.436 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceAAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACA
ATGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)101533 - 633
Exon 3 To Exon 4 (Pair 12)
Forward (534,22)AGAGTCCTTCAATGCTGTCCAAAmplicon SizecDNA: 101 bpgenomic: 3,952
Reverse (634,21)CCTCCATGTCACACTTGTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.722 kcal/mol in 3' area
Forward Dimers0.07 kcal/mol
Reverse Loops1.162 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.092 kcal/mol outside primersite
Amplicon SequenceAGAGTCCTTCAATGCTGTCCAAGACTGGGCTACTCAGATCAAGACCTACTCCTGGGACAA
TGCACAAGTTATTCTGGTGGGGAACAAGTGTGACATGGAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)101534 - 634
Exon 4 To Exon 5 (Pair 1)
Forward (615,22)GAACAAGTGTGACATGGAGGAAAmplicon SizecDNA: 97 bpgenomic: 13,300
Reverse (711,23)TGCACTGGCTTCAAAGAAATCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.106 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGC
AGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002867 (RAB3B)97615 - 711
NM_004283 (RAB3D)96663 - 758
Exon 4 To Exon 5 (Pair 2)
Forward (616,22)AACAAGTGTGACATGGAGGAAGAmplicon SizecDNA: 93 bpgenomic: 13,296
Reverse (708,23)ACTGGCTTCAAAGAAATCAAACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops1.332 kcal/mol
Reverse Dimers-0.993 kcal/mol
Forward-Reverse Dimers-1.097 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGCA
GAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)93616 - 708
Exon 4 To Exon 5 (Pair 3)
Forward (615,22)GAACAAGTGTGACATGGAGGAAAmplicon SizecDNA: 95 bpgenomic: 13,298
Reverse (709,23)CACTGGCTTCAAAGAAATCAAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops1.332 kcal/mol
Reverse Dimers-0.993 kcal/mol
Forward-Reverse Dimers-1.571 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGC
AGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)95615 - 709
Exon 4 To Exon 5 (Pair 4)
Forward (616,22)AACAAGTGTGACATGGAGGAAGAmplicon SizecDNA: 96 bpgenomic: 13,299
Reverse (711,23)TGCACTGGCTTCAAAGAAATCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.106 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGCA
GAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004283 (RAB3D)95664 - 758
NM_002867 (RAB3B)96616 - 711
Exon 4 To Exon 5 (Pair 5)
Forward (615,22)GAACAAGTGTGACATGGAGGAAAmplicon SizecDNA: 94 bpgenomic: 13,297
Reverse (708,23)ACTGGCTTCAAAGAAATCAAACCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops1.332 kcal/mol
Reverse Dimers-0.993 kcal/mol
Forward-Reverse Dimers-1.097 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGC
AGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)94615 - 708
Exon 4 To Exon 5 (Pair 6)
Forward (615,22)GAACAAGTGTGACATGGAGGAAAmplicon SizecDNA: 98 bpgenomic: 13,301
Reverse (712,23)TTGCACTGGCTTCAAAGAAATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.106 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGC
AGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002867 (RAB3B)98615 - 712
NM_004283 (RAB3D)96663 - 758
Exon 4 To Exon 5 (Pair 7)
Forward (616,22)AACAAGTGTGACATGGAGGAAGAmplicon SizecDNA: 97 bpgenomic: 13,300
Reverse (712,23)TTGCACTGGCTTCAAAGAAATCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.106 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGCA
GAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_002867 (RAB3B)97616 - 712
NM_004283 (RAB3D)95664 - 758
Exon 4 To Exon 5 (Pair 8)
Forward (616,22)AACAAGTGTGACATGGAGGAAGAmplicon SizecDNA: 95 bpgenomic: 13,298
Reverse (710,23)GCACTGGCTTCAAAGAAATCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops1.229 kcal/mol
Reverse Dimers-0.993 kcal/mol
Forward-Reverse Dimers-2.028 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGCA
GAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)95616 - 710
Exon 4 To Exon 5 (Pair 9)
Forward (616,22)AACAAGTGTGACATGGAGGAAGAmplicon SizecDNA: 98 bpgenomic: 13,301
Reverse (713,23)TTTGCACTGGCTTCAAAGAAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.106 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGCA
GAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)98616 - 713
Exon 4 To Exon 5 (Pair 10)
Forward (615,22)GAACAAGTGTGACATGGAGGAAAmplicon SizecDNA: 96 bpgenomic: 13,299
Reverse (710,23)GCACTGGCTTCAAAGAAATCAAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops1.229 kcal/mol
Reverse Dimers-0.993 kcal/mol
Forward-Reverse Dimers-2.028 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGC
AGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)96615 - 710
Exon 4 To Exon 5 (Pair 11)
Forward (615,22)GAACAAGTGTGACATGGAGGAAAmplicon SizecDNA: 99 bpgenomic: 13,302
Reverse (713,23)TTTGCACTGGCTTCAAAGAAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops0.958 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.106 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceGAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGC
AGAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)99615 - 713
Exon 4 To Exon 5 (Pair 12)
Forward (616,22)AACAAGTGTGACATGGAGGAAGAmplicon SizecDNA: 94 bpgenomic: 13,297
Reverse (709,23)CACTGGCTTCAAAGAAATCAAACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.155 kcal/mol
Forward Dimers-0.994 kcal/mol
Reverse Loops1.332 kcal/mol
Reverse Dimers-0.993 kcal/mol
Forward-Reverse Dimers-1.571 kcal/mol
Amplicon Folding-0.935 kcal/mol outside primersite
Amplicon SequenceAACAAGTGTGACATGGAGGAAGAGAGGGTTGTTCCCACTGAGAAGGGCCAGCTCCTTGCA
GAGCAGCTTGGGTTTGATTTCTTTGAAGCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_002867 (RAB3B)94616 - 709
 

See below for some more details.

Program Output:

Loading ...