Design Results for RAI1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size300

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 6 (Pair 4)
Forward (3993,21)AGCTCTTAGGCCCTGAGTGAAAmplicon SizecDNA: 103 bpgenomic: 13,506
Reverse (4095,20)GCGAGGTCTGCTGGTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGG
TGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACCTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 5)
Forward (3993,21)AGCTCTTAGGCCCTGAGTGAAAmplicon SizecDNA: 96 bpgenomic: 13,499
Reverse (4088,22)CTGCTGGTAGTTCTGTTGTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops2.266 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.227 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGG
TGTGGTTTCCATGGCAAACAACAGAACTACCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 11)
Forward (3992,21)AAGCTCTTAGGCCCTGAGTGAAmplicon SizecDNA: 97 bpgenomic: 13,500
Reverse (4088,22)CTGCTGGTAGTTCTGTTGTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.266 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAG
GTGTGGTTTCCATGGCAAACAACAGAACTACCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 13)
Forward (3994,21)GCTCTTAGGCCCTGAGTGAATAmplicon SizecDNA: 95 bpgenomic: 13,498
Reverse (4088,22)CTGCTGGTAGTTCTGTTGTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.697 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops2.266 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.393 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGGT
GTGGTTTCCATGGCAAACAACAGAACTACCAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 16)
Forward (3994,21)GCTCTTAGGCCCTGAGTGAATAmplicon SizecDNA: 97 bpgenomic: 13,500
Reverse (4090,22)GTCTGCTGGTAGTTCTGTTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.697 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.393 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGGT
GTGGTTTCCATGGCAAACAACAGAACTACCAGCAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 19)
Forward (3991,21)AAAGCTCTTAGGCCCTGAGTGAmplicon SizecDNA: 103 bpgenomic: 13,506
Reverse (4093,21)GAGGTCTGCTGGTAGTTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-0.354 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAA
GGTGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 21)
Forward (3945,22)AATGGGACCTGTTAGTCTGTTGAmplicon SizecDNA: 94 bpgenomic: 13,497
Reverse (4038,20)ACTGCATGACTCGGGCTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.531 kcal/mol in 3' area
Forward Dimers-0.603 kcal/mol
Reverse Loops1.262 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-1.572 kcal/mol
Amplicon Folding-0.332 kcal/mol outside primersite
Amplicon SequenceAATGGGACCTGTTAGTCTGTTGTCGGGGAGGGGGATTTAACTGCCCAAAGCTCTTAGGCC
CTGAGTGAATTATAACCAGCCCGAGTCATGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 34)
Forward (3990,21)CAAAGCTCTTAGGCCCTGAGTAmplicon SizecDNA: 106 bpgenomic: 13,509
Reverse (4095,20)GCGAGGTCTGCTGGTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceCAAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAA
AGGTGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACCTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 37)
Forward (3994,21)GCTCTTAGGCCCTGAGTGAATAmplicon SizecDNA: 94 bpgenomic: 13,497
Reverse (4087,22)TGCTGGTAGTTCTGTTGTTTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.697 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops2.266 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.393 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGGT
GTGGTTTCCATGGCAAACAACAGAACTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 38)
Forward (3993,21)AGCTCTTAGGCCCTGAGTGAAAmplicon SizecDNA: 95 bpgenomic: 13,498
Reverse (4087,22)TGCTGGTAGTTCTGTTGTTTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops2.266 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.227 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGG
TGTGGTTTCCATGGCAAACAACAGAACTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 43)
Forward (3992,21)AAGCTCTTAGGCCCTGAGTGAAmplicon SizecDNA: 104 bpgenomic: 13,507
Reverse (4095,20)GCGAGGTCTGCTGGTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAG
GTGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACCTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 44)
Forward (3990,21)CAAAGCTCTTAGGCCCTGAGTAmplicon SizecDNA: 104 bpgenomic: 13,507
Reverse (4093,21)GAGGTCTGCTGGTAGTTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-0.354 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceCAAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAA
AGGTGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 49)
Forward (3994,21)GCTCTTAGGCCCTGAGTGAATAmplicon SizecDNA: 102 bpgenomic: 13,505
Reverse (4095,20)GCGAGGTCTGCTGGTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.697 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGGT
GTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACCTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 54)
Forward (3994,21)GCTCTTAGGCCCTGAGTGAATAmplicon SizecDNA: 98 bpgenomic: 13,501
Reverse (4091,21)GGTCTGCTGGTAGTTCTGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.697 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.238 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGGT
GTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 57)
Forward (3991,21)AAAGCTCTTAGGCCCTGAGTGAmplicon SizecDNA: 100 bpgenomic: 13,503
Reverse (4090,22)GTCTGCTGGTAGTTCTGTTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAA
GGTGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 63)
Forward (3994,21)GCTCTTAGGCCCTGAGTGAATAmplicon SizecDNA: 100 bpgenomic: 13,503
Reverse (4093,21)GAGGTCTGCTGGTAGTTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.697 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-0.354 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGGT
GTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 69)
Forward (3991,21)AAAGCTCTTAGGCCCTGAGTGAmplicon SizecDNA: 105 bpgenomic: 13,508
Reverse (4095,20)GCGAGGTCTGCTGGTAGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAA
GGTGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACCTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 73)
Forward (3992,21)AAGCTCTTAGGCCCTGAGTGAAmplicon SizecDNA: 99 bpgenomic: 13,502
Reverse (4090,22)GTCTGCTGGTAGTTCTGTTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAG
GTGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 76)
Forward (3992,21)AAGCTCTTAGGCCCTGAGTGAAmplicon SizecDNA: 100 bpgenomic: 13,503
Reverse (4091,21)GGTCTGCTGGTAGTTCTGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAG
GTGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 80)
Forward (3946,22)ATGGGACCTGTTAGTCTGTTGTAmplicon SizecDNA: 93 bpgenomic: 13,496
Reverse (4038,20)ACTGCATGACTCGGGCTGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.531 kcal/mol
Forward Dimers-0.603 kcal/mol
Reverse Loops1.262 kcal/mol in 3' area
Reverse Dimers-1.956 kcal/mol
Forward-Reverse Dimers-1.572 kcal/mol
Amplicon Folding-0.332 kcal/mol outside primersite
Amplicon SequenceATGGGACCTGTTAGTCTGTTGTCGGGGAGGGGGATTTAACTGCCCAAAGCTCTTAGGCCC
TGAGTGAATTATAACCAGCCCGAGTCATGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 84)
Forward (3993,21)AGCTCTTAGGCCCTGAGTGAAAmplicon SizecDNA: 101 bpgenomic: 13,504
Reverse (4093,21)GAGGTCTGCTGGTAGTTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-0.354 kcal/mol
Forward-Reverse Dimers-1.565 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGG
TGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 85)
Forward (3993,21)AGCTCTTAGGCCCTGAGTGAAAmplicon SizecDNA: 99 bpgenomic: 13,502
Reverse (4091,21)GGTCTGCTGGTAGTTCTGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.238 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGG
TGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 90)
Forward (3991,21)AAAGCTCTTAGGCCCTGAGTGAmplicon SizecDNA: 101 bpgenomic: 13,504
Reverse (4091,21)GGTCTGCTGGTAGTTCTGTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAA
GGTGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 91)
Forward (3992,21)AAGCTCTTAGGCCCTGAGTGAAmplicon SizecDNA: 96 bpgenomic: 13,499
Reverse (4087,22)TGCTGGTAGTTCTGTTGTTTGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops2.266 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAG
GTGTGGTTTCCATGGCAAACAACAGAACTACCAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 92)
Forward (3993,21)AGCTCTTAGGCCCTGAGTGAAAmplicon SizecDNA: 98 bpgenomic: 13,501
Reverse (4090,22)GTCTGCTGGTAGTTCTGTTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.658 kcal/mol
Reverse Loops1.704 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.227 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAGG
TGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 96)
Forward (3992,21)AAGCTCTTAGGCCCTGAGTGAAmplicon SizecDNA: 102 bpgenomic: 13,505
Reverse (4093,21)GAGGTCTGCTGGTAGTTCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.37 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-0.354 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding1.049 kcal/mol outside primersite
Amplicon SequenceAAGCTCTTAGGCCCTGAGTGAATTATAACCAGCCCGAGTCATGCAGTCTTTTCGAGAAAG
GTGTGGTTTCCATGGCAAACAACAGAACTACCAGCAGACCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
 

See below for some more details.

Program Output:

Loading ...