Design Results for RELB

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 5 To Exon 7 (Pair 1)
Forward (809,21)CAGTGTGTGAGGAAGAAGGAGAmplicon SizecDNA: 231 bpgenomic: 3,566
Reverse (1039,21)CCGCAGCTCTGATGTGTTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.517 kcal/mol
Forward Dimers0.746 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATT
GACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGG
ATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTG
CTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)231813 - 1043
Exon 5 To Exon 7 (Pair 2)
Forward (810,22)AGTGTGTGAGGAAGAAGGAGATAmplicon SizecDNA: 233 bpgenomic: 3,568
Reverse (1042,22)AATCCGCAGCTCTGATGTGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops4.514 kcal/mol in 3' area
Forward Dimers0.838 kcal/mol in 3' area
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTG
ACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGA
TCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGC
TTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)233814 - 1046
Exon 5 To Exon 7 (Pair 3)
Forward (800,20)CTGGGCATCCAGTGTGTGAGAmplicon SizecDNA: 240 bpgenomic: 3,575
Reverse (1039,21)CCGCAGCTCTGATGTGTTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-0.938 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-0.973 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCTGGGCATCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAA
CTGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAAT
GTGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATG
GATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)240804 - 1043
Exon 5 To Exon 7 (Pair 4)
Forward (807,21)TCCAGTGTGTGAGGAAGAAGGAmplicon SizecDNA: 237 bpgenomic: 3,572
Reverse (1043,22)AAATCCGCAGCTCTGATGTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.296 kcal/mol
Forward Dimers-0.655 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceTCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCA
TTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGA
GGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTG
TGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)237811 - 1047
Exon 5 To Exon 7 (Pair 5)
Forward (807,21)TCCAGTGTGTGAGGAAGAAGGAmplicon SizecDNA: 234 bpgenomic: 3,569
Reverse (1040,21)TCCGCAGCTCTGATGTGTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.296 kcal/mol
Forward Dimers-0.655 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.081 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceTCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCA
TTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGA
GGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTG
TGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)234811 - 1044
Exon 5 To Exon 7 (Pair 6)
Forward (810,22)AGTGTGTGAGGAAGAAGGAGATAmplicon SizecDNA: 234 bpgenomic: 3,569
Reverse (1043,22)AAATCCGCAGCTCTGATGTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops4.514 kcal/mol in 3' area
Forward Dimers0.838 kcal/mol in 3' area
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTG
ACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGA
TCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGC
TTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)234814 - 1047
Exon 5 To Exon 7 (Pair 7)
Forward (809,21)CAGTGTGTGAGGAAGAAGGAGAmplicon SizecDNA: 230 bpgenomic: 3,565
Reverse (1038,21)CGCAGCTCTGATGTGTTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.517 kcal/mol
Forward Dimers0.746 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATT
GACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGG
ATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTG
CTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)230813 - 1042
Exon 5 To Exon 7 (Pair 8)
Forward (817,21)GAGGAAGAAGGAGATTGAGGCAmplicon SizecDNA: 229 bpgenomic: 3,564
Reverse (1045,21)GCAAATCCGCAGCTCTGATGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.587 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.062 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.052 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTA
CAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTT
CCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGCTTTCCGA
GCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)229821 - 1049
Exon 5 To Exon 7 (Pair 9)
Forward (807,21)TCCAGTGTGTGAGGAAGAAGGAmplicon SizecDNA: 263 bpgenomic: 3,598
Reverse (1069,21)CGGCCCGCTTTCCTTGTTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.296 kcal/mol
Forward Dimers-0.655 kcal/mol
Reverse Loops2.047 kcal/mol
Reverse Dimers-2.299 kcal/mol
Forward-Reverse Dimers-2.55 kcal/mol
Amplicon Folding-2.292 kcal/mol outside primersite
Amplicon SequenceTCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCA
TTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGA
GGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTG
TGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTGCC
GAATTAACAAGGAAAGCGGGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)263811 - 1073
Exon 5 To Exon 7 (Pair 10)
Forward (817,21)GAGGAAGAAGGAGATTGAGGCAmplicon SizecDNA: 222 bpgenomic: 3,557
Reverse (1038,21)CGCAGCTCTGATGTGTTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.587 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.052 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTA
CAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTT
CCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGCTTTCCGA
GCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)222821 - 1042
Exon 5 To Exon 7 (Pair 11)
Forward (817,21)GAGGAAGAAGGAGATTGAGGCAmplicon SizecDNA: 228 bpgenomic: 3,563
Reverse (1044,21)CAAATCCGCAGCTCTGATGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.587 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.052 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTA
CAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTT
CCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGCTTTCCGA
GCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)228821 - 1048
Exon 5 To Exon 7 (Pair 12)
Forward (801,20)TGGGCATCCAGTGTGTGAGGAmplicon SizecDNA: 237 bpgenomic: 3,572
Reverse (1037,21)GCAGCTCTGATGTGTTTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.842 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-0.973 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceTGGGCATCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAAC
TGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATG
TGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGG
ATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)237805 - 1041
Exon 5 To Exon 7 (Pair 13)
Forward (801,20)TGGGCATCCAGTGTGTGAGGAmplicon SizecDNA: 245 bpgenomic: 3,580
Reverse (1045,21)GCAAATCCGCAGCTCTGATGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.842 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.062 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-0.925 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceTGGGCATCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAAC
TGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATG
TGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGG
ATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGA
TTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)245805 - 1049
Exon 5 To Exon 7 (Pair 14)
Forward (817,21)GAGGAAGAAGGAGATTGAGGCAmplicon SizecDNA: 221 bpgenomic: 3,556
Reverse (1037,21)GCAGCTCTGATGTGTTTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.587 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.052 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTA
CAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTT
CCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGCTTTCCGA
GCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)221821 - 1041
Exon 5 To Exon 7 (Pair 15)
Forward (817,21)GAGGAAGAAGGAGATTGAGGCAmplicon SizecDNA: 220 bpgenomic: 3,555
Reverse (1036,22)CAGCTCTGATGTGTTTGTGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.587 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.436 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.052 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTA
CAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTT
CCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGCTTTCCGA
GCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)220821 - 1040
Exon 5 To Exon 7 (Pair 16)
Forward (800,20)CTGGGCATCCAGTGTGTGAGAmplicon SizecDNA: 246 bpgenomic: 3,581
Reverse (1045,21)GCAAATCCGCAGCTCTGATGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-0.938 kcal/mol
Reverse Loops1.062 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-0.925 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCTGGGCATCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAA
CTGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAAT
GTGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATG
GATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGG
ATTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)246804 - 1049
Exon 5 To Exon 7 (Pair 17)
Forward (817,21)GAGGAAGAAGGAGATTGAGGCAmplicon SizecDNA: 224 bpgenomic: 3,559
Reverse (1040,21)TCCGCAGCTCTGATGTGTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.587 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.052 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTA
CAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTT
CCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGCTTTCCGA
GCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)224821 - 1044
Exon 5 To Exon 7 (Pair 18)
Forward (817,21)GAGGAAGAAGGAGATTGAGGCAmplicon SizecDNA: 223 bpgenomic: 3,558
Reverse (1039,21)CCGCAGCTCTGATGTGTTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.587 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.052 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTA
CAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTT
CCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGCTTTCCGA
GCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)223821 - 1043
Exon 5 To Exon 7 (Pair 19)
Forward (809,21)CAGTGTGTGAGGAAGAAGGAGAmplicon SizecDNA: 236 bpgenomic: 3,571
Reverse (1044,21)CAAATCCGCAGCTCTGATGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.517 kcal/mol
Forward Dimers0.746 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATT
GACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGG
ATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTG
CTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)236813 - 1048
Exon 5 To Exon 7 (Pair 20)
Forward (809,21)CAGTGTGTGAGGAAGAAGGAGAmplicon SizecDNA: 232 bpgenomic: 3,567
Reverse (1040,21)TCCGCAGCTCTGATGTGTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.517 kcal/mol
Forward Dimers0.746 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.081 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATT
GACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGG
ATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTG
CTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)232813 - 1044
Exon 5 To Exon 7 (Pair 21)
Forward (817,21)GAGGAAGAAGGAGATTGAGGCAmplicon SizecDNA: 226 bpgenomic: 3,561
Reverse (1042,22)AATCCGCAGCTCTGATGTGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.587 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.052 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTA
CAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTT
CCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGCTTTCCGA
GCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)226821 - 1046
Exon 5 To Exon 7 (Pair 22)
Forward (807,21)TCCAGTGTGTGAGGAAGAAGGAmplicon SizecDNA: 239 bpgenomic: 3,574
Reverse (1045,21)GCAAATCCGCAGCTCTGATGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.296 kcal/mol
Forward Dimers-0.655 kcal/mol
Reverse Loops1.062 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceTCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCA
TTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGA
GGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTG
TGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)239811 - 1049
Exon 5 To Exon 7 (Pair 23)
Forward (817,21)GAGGAAGAAGGAGATTGAGGCAmplicon SizecDNA: 253 bpgenomic: 3,588
Reverse (1069,21)CGGCCCGCTTTCCTTGTTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.587 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops2.047 kcal/mol
Reverse Dimers-2.299 kcal/mol
Forward-Reverse Dimers-2.633 kcal/mol
Amplicon Folding-2.292 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTA
CAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTT
CCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGCTTTCCGA
GCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTGCCGAATTAACAA
GGAAAGCGGGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)253821 - 1073
Exon 5 To Exon 7 (Pair 24)
Forward (800,20)CTGGGCATCCAGTGTGTGAGAmplicon SizecDNA: 238 bpgenomic: 3,573
Reverse (1037,21)GCAGCTCTGATGTGTTTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-0.938 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-0.973 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCTGGGCATCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAA
CTGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAAT
GTGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATG
GATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)238804 - 1041
Exon 5 To Exon 7 (Pair 25)
Forward (809,21)CAGTGTGTGAGGAAGAAGGAGAmplicon SizecDNA: 234 bpgenomic: 3,569
Reverse (1042,22)AATCCGCAGCTCTGATGTGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.517 kcal/mol
Forward Dimers0.746 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATT
GACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGG
ATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTG
CTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)234813 - 1046
Exon 5 To Exon 7 (Pair 26)
Forward (810,22)AGTGTGTGAGGAAGAAGGAGATAmplicon SizecDNA: 231 bpgenomic: 3,566
Reverse (1040,21)TCCGCAGCTCTGATGTGTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops4.514 kcal/mol in 3' area
Forward Dimers0.838 kcal/mol in 3' area
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.081 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTG
ACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGA
TCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGC
TTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)231814 - 1044
Exon 5 To Exon 7 (Pair 27)
Forward (807,21)TCCAGTGTGTGAGGAAGAAGGAmplicon SizecDNA: 236 bpgenomic: 3,571
Reverse (1042,22)AATCCGCAGCTCTGATGTGTTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.296 kcal/mol
Forward Dimers-0.655 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceTCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCA
TTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGA
GGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTG
TGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)236811 - 1046
Exon 5 To Exon 7 (Pair 28)
Forward (817,21)GAGGAAGAAGGAGATTGAGGCAmplicon SizecDNA: 227 bpgenomic: 3,562
Reverse (1043,22)AAATCCGCAGCTCTGATGTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.587 kcal/mol
Forward Dimers-0.172 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.052 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTGACCCCTA
CAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGATCTGCTT
CCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGCTTTCCGA
GCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)227821 - 1047
Exon 5 To Exon 7 (Pair 29)
Forward (810,22)AGTGTGTGAGGAAGAAGGAGATAmplicon SizecDNA: 236 bpgenomic: 3,571
Reverse (1045,21)GCAAATCCGCAGCTCTGATGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops4.514 kcal/mol in 3' area
Forward Dimers0.838 kcal/mol in 3' area
Reverse Loops1.062 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTG
ACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGA
TCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGC
TTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)236814 - 1049
Exon 5 To Exon 7 (Pair 30)
Forward (801,20)TGGGCATCCAGTGTGTGAGGAmplicon SizecDNA: 240 bpgenomic: 3,575
Reverse (1040,21)TCCGCAGCTCTGATGTGTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.842 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-0.973 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceTGGGCATCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAAC
TGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATG
TGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGG
ATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)240805 - 1044
Exon 5 To Exon 7 (Pair 31)
Forward (809,21)CAGTGTGTGAGGAAGAAGGAGAmplicon SizecDNA: 228 bpgenomic: 3,563
Reverse (1036,22)CAGCTCTGATGTGTTTGTGGATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.517 kcal/mol
Forward Dimers0.746 kcal/mol
Reverse Loops1.436 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATT
GACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGG
ATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTG
CTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)228813 - 1040
Exon 5 To Exon 7 (Pair 32)
Forward (809,21)CAGTGTGTGAGGAAGAAGGAGAmplicon SizecDNA: 235 bpgenomic: 3,570
Reverse (1043,22)AAATCCGCAGCTCTGATGTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.517 kcal/mol
Forward Dimers0.746 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATT
GACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGG
ATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTG
CTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)235813 - 1047
Exon 5 To Exon 7 (Pair 33)
Forward (810,22)AGTGTGTGAGGAAGAAGGAGATAmplicon SizecDNA: 235 bpgenomic: 3,570
Reverse (1044,21)CAAATCCGCAGCTCTGATGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops4.514 kcal/mol in 3' area
Forward Dimers0.838 kcal/mol in 3' area
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATTG
ACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGGA
TCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTGC
TTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)235814 - 1048
Exon 5 To Exon 7 (Pair 34)
Forward (801,20)TGGGCATCCAGTGTGTGAGGAmplicon SizecDNA: 239 bpgenomic: 3,574
Reverse (1039,21)CCGCAGCTCTGATGTGTTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.842 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-0.973 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceTGGGCATCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAAC
TGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATG
TGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGG
ATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)239805 - 1043
Exon 5 To Exon 7 (Pair 35)
Forward (809,21)CAGTGTGTGAGGAAGAAGGAGAmplicon SizecDNA: 229 bpgenomic: 3,564
Reverse (1037,21)GCAGCTCTGATGTGTTTGTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.517 kcal/mol
Forward Dimers0.746 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATT
GACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGG
ATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTG
CTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)229813 - 1041
Exon 5 To Exon 7 (Pair 36)
Forward (800,20)CTGGGCATCCAGTGTGTGAGAmplicon SizecDNA: 241 bpgenomic: 3,576
Reverse (1040,21)TCCGCAGCTCTGATGTGTTTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-0.938 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-0.973 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCTGGGCATCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAA
CTGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAAT
GTGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATG
GATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)241804 - 1044
Exon 5 To Exon 7 (Pair 37)
Forward (800,20)CTGGGCATCCAGTGTGTGAGAmplicon SizecDNA: 239 bpgenomic: 3,574
Reverse (1038,21)CGCAGCTCTGATGTGTTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.169 kcal/mol
Forward Dimers-0.938 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-0.973 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCTGGGCATCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAA
CTGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAAT
GTGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATG
GATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)239804 - 1042
Exon 5 To Exon 7 (Pair 38)
Forward (801,20)TGGGCATCCAGTGTGTGAGGAmplicon SizecDNA: 238 bpgenomic: 3,573
Reverse (1038,21)CGCAGCTCTGATGTGTTTGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.842 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-0.973 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceTGGGCATCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAAC
TGGGCATTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATG
TGGTGAGGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGG
ATCCTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)238805 - 1042
Exon 5 To Exon 7 (Pair 39)
Forward (807,21)TCCAGTGTGTGAGGAAGAAGGAmplicon SizecDNA: 238 bpgenomic: 3,573
Reverse (1044,21)CAAATCCGCAGCTCTGATGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.296 kcal/mol
Forward Dimers-0.655 kcal/mol
Reverse Loops1.062 kcal/mol
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceTCCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCA
TTGACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGA
GGATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTG
TGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)238811 - 1048
Exon 5 To Exon 7 (Pair 40)
Forward (809,21)CAGTGTGTGAGGAAGAAGGAGAmplicon SizecDNA: 237 bpgenomic: 3,572
Reverse (1045,21)GCAAATCCGCAGCTCTGATGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.517 kcal/mol
Forward Dimers0.746 kcal/mol
Reverse Loops1.062 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-1.203 kcal/mol outside primersite
Amplicon SequenceCAGTGTGTGAGGAAGAAGGAGATTGAGGCTGCCATTGAGCGGAAGATTCAACTGGGCATT
GACCCCTACAACGCTGGGTCCCTGAAGAACCATCAGGAAGTAGACATGAATGTGGTGAGG
ATCTGCTTCCAGGCCTCATATCGGGACCAGCAGGGACAGATGCGCCGGATGGATCCTGTG
CTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)237813 - 1049
Exon 6 To Exon 7 (Pair 1)
Forward (990,21)TTTCCGAGCCCGTCTATGACAAmplicon SizecDNA: 80 bpgenomic: 3,230
Reverse (1069,21)CGGCCCGCTTTCCTTGTTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.17 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops2.047 kcal/mol
Reverse Dimers-2.299 kcal/mol
Forward-Reverse Dimers-2.078 kcal/mol
Amplicon Folding-1.089 kcal/mol outside primersite
Amplicon SequenceTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTGCCGAA
TTAACAAGGAAAGCGGGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)80994 - 1073
Exon 6 To Exon 7 (Pair 2)
Forward (988,20)GCTTTCCGAGCCCGTCTATGAmplicon SizecDNA: 82 bpgenomic: 3,232
Reverse (1069,21)CGGCCCGCTTTCCTTGTTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.666 kcal/mol
Forward Dimers-1.136 kcal/mol
Reverse Loops2.047 kcal/mol
Reverse Dimers-2.299 kcal/mol
Forward-Reverse Dimers-2.078 kcal/mol
Amplicon Folding-1.089 kcal/mol outside primersite
Amplicon SequenceGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTGCCG
AATTAACAAGGAAAGCGGGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)82992 - 1073
Exon 6 To Exon 7 (Pair 3)
Forward (986,20)GTGCTTTCCGAGCCCGTCTAAmplicon SizecDNA: 84 bpgenomic: 3,234
Reverse (1069,21)CGGCCCGCTTTCCTTGTTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.396 kcal/mol
Forward Dimers-1.406 kcal/mol
Reverse Loops2.047 kcal/mol
Reverse Dimers-2.299 kcal/mol
Forward-Reverse Dimers-2.078 kcal/mol
Amplicon Folding-1.089 kcal/mol outside primersite
Amplicon SequenceGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTGC
CGAATTAACAAGGAAAGCGGGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)84990 - 1073
Exon 6 To Exon 7 (Pair 4)
Forward (985,20)TGTGCTTTCCGAGCCCGTCTAmplicon SizecDNA: 85 bpgenomic: 3,235
Reverse (1069,21)CGGCCCGCTTTCCTTGTTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.396 kcal/mol
Forward Dimers-1.406 kcal/mol
Reverse Loops2.047 kcal/mol
Reverse Dimers-2.299 kcal/mol
Forward-Reverse Dimers-2.078 kcal/mol
Amplicon Folding-1.089 kcal/mol outside primersite
Amplicon SequenceTGTGCTTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTG
CCGAATTAACAAGGAAAGCGGGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)85989 - 1073
Exon 6 To Exon 7 (Pair 5)
Forward (991,21)TTCCGAGCCCGTCTATGACAAAmplicon SizecDNA: 79 bpgenomic: 3,229
Reverse (1069,21)CGGCCCGCTTTCCTTGTTAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.17 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops2.047 kcal/mol
Reverse Dimers-2.299 kcal/mol
Forward-Reverse Dimers-2.078 kcal/mol
Amplicon Folding-1.089 kcal/mol outside primersite
Amplicon SequenceTTCCGAGCCCGTCTATGACAAGAAATCCACAAACACATCAGAGCTGCGGATTTGCCGAAT
TAACAAGGAAAGCGGGCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006509 (RELB)79995 - 1073
 

See below for some more details.

Program Output:

Loading ...