Design Results for RPS26

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size80Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size200

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (404,19)GCCGCAGCAGTCAGGGACAAmplicon SizecDNA: 102 bpgenomic: 862
Reverse (505,22)GTGAATTGCACAACTCACACAGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.021 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.751 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.795 kcal/mol
Amplicon Folding-0.121 kcal/mol outside primersite
Amplicon SequenceGCCGCAGCAGTCAGGGACATTTCTGAAGCGAGCGTCTTCGATGCCTATGTGCTTCCCAAG
CTGTATGTGAAGCTACATTACTGTGTGAGTTGTGCAATTCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)102404 - 505
NR_002309 (RPS26P11)102275 - 376
Exon 2 To Exon 3 (Pair 2)
Forward (402,19)AGGCCGCAGCAGTCAGGGAAmplicon SizecDNA: 104 bpgenomic: 864
Reverse (505,22)GTGAATTGCACAACTCACACAGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.73 kcal/mol
Forward Dimers-2.42 kcal/mol
Reverse Loops0.751 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.795 kcal/mol
Amplicon Folding-0.121 kcal/mol outside primersite
Amplicon SequenceAGGCCGCAGCAGTCAGGGACATTTCTGAAGCGAGCGTCTTCGATGCCTATGTGCTTCCCA
AGCTGTATGTGAAGCTACATTACTGTGTGAGTTGTGCAATTCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)104273 - 376
NM_001029 (RPS26)104402 - 505
Exon 2 To Exon 3 (Pair 3)
Forward (405,20)CCGCAGCAGTCAGGGACATTAmplicon SizecDNA: 101 bpgenomic: 861
Reverse (505,22)GTGAATTGCACAACTCACACAGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.286 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.751 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.795 kcal/mol
Amplicon Folding-0.121 kcal/mol outside primersite
Amplicon SequenceCCGCAGCAGTCAGGGACATTTCTGAAGCGAGCGTCTTCGATGCCTATGTGCTTCCCAAGC
TGTATGTGAAGCTACATTACTGTGTGAGTTGTGCAATTCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)101276 - 376
NM_001029 (RPS26)101405 - 505
Exon 3 To Exon 4 (Pair 1)
Forward (474,23)AGCTACATTACTGTGTGAGTTGTAmplicon SizecDNA: 143 bpgenomic: 768
Reverse (616,21)TCCTTACATGGGCTTTGGTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.696 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-1.372 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTG
AAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTC
CCCCACCAAAGCCCATGTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)143474 - 616
NR_002309 (RPS26P11)143345 - 487
Exon 3 To Exon 4 (Pair 2)
Forward (474,23)AGCTACATTACTGTGTGAGTTGTAmplicon SizecDNA: 146 bpgenomic: 771
Reverse (619,21)AGCTCCTTACATGGGCTTTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.696 kcal/mol
Reverse Loops0.832 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.222 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTG
AAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTC
CCCCACCAAAGCCCATGTAAGGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)146474 - 619
NR_002309 (RPS26P11)146345 - 490
Exon 3 To Exon 4 (Pair 3)
Forward (472,23)GAAGCTACATTACTGTGTGAGTTAmplicon SizecDNA: 148 bpgenomic: 773
Reverse (619,21)AGCTCCTTACATGGGCTTTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.832 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.763 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCG
TGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACG
TCCCCCACCAAAGCCCATGTAAGGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)148472 - 619
NR_002309 (RPS26P11)148343 - 490
Exon 3 To Exon 4 (Pair 4)
Forward (496,23)TGCAATTCACAGCAAAGTAGTCAAmplicon SizecDNA: 123 bpgenomic: 748
Reverse (618,21)GCTCCTTACATGGGCTTTGGTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.1 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACACC
CCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAAGG
AGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)123367 - 489
NM_001029 (RPS26)123496 - 618
Exon 3 To Exon 4 (Pair 5)
Forward (491,23)AGTTGTGCAATTCACAGCAAAGTAmplicon SizecDNA: 129 bpgenomic: 754
Reverse (619,21)AGCTCCTTACATGGGCTTTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.106 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.832 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGA
ACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATG
TAAGGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)129362 - 490
NM_001029 (RPS26)129491 - 619
Exon 3 To Exon 4 (Pair 6)
Forward (494,23)TGTGCAATTCACAGCAAAGTAGTAmplicon SizecDNA: 126 bpgenomic: 751
Reverse (619,21)AGCTCCTTACATGGGCTTTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.28 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.832 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACA
CCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAA
GGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)126365 - 490
NM_001029 (RPS26)126494 - 619
Exon 3 To Exon 4 (Pair 7)
Forward (471,23)TGAAGCTACATTACTGTGTGAGTAmplicon SizecDNA: 149 bpgenomic: 774
Reverse (619,21)AGCTCCTTACATGGGCTTTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.145 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops0.832 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.763 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTC
GTGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCAC
GTCCCCCACCAAAGCCCATGTAAGGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)149342 - 490
NM_001029 (RPS26)149471 - 619
Exon 3 To Exon 4 (Pair 8)
Forward (496,23)TGCAATTCACAGCAAAGTAGTCAAmplicon SizecDNA: 129 bpgenomic: 754
Reverse (624,21)AACTCAGCTCCTTACATGGGCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.381 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACACC
CCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAAGG
AGCTGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)129496 - 624
NR_002309 (RPS26P11)129367 - 495
Exon 3 To Exon 4 (Pair 9)
Forward (472,23)GAAGCTACATTACTGTGTGAGTTAmplicon SizecDNA: 145 bpgenomic: 770
Reverse (616,21)TCCTTACATGGGCTTTGGTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCG
TGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACG
TCCCCCACCAAAGCCCATGTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)145472 - 616
NR_002309 (RPS26P11)145343 - 487
Exon 3 To Exon 4 (Pair 10)
Forward (492,23)GTTGTGCAATTCACAGCAAAGTAAmplicon SizecDNA: 127 bpgenomic: 752
Reverse (618,21)GCTCCTTACATGGGCTTTGGTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.1 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAA
CACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGT
AAGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)127492 - 618
NR_002309 (RPS26P11)127363 - 489
Exon 3 To Exon 4 (Pair 11)
Forward (493,23)TTGTGCAATTCACAGCAAAGTAGAmplicon SizecDNA: 131 bpgenomic: 756
Reverse (623,21)ACTCAGCTCCTTACATGGGCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.863 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAAC
ACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTA
AGGAGCTGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)131364 - 494
NM_001029 (RPS26)131493 - 623
Exon 3 To Exon 4 (Pair 12)
Forward (492,23)GTTGTGCAATTCACAGCAAAGTAAmplicon SizecDNA: 132 bpgenomic: 757
Reverse (623,21)ACTCAGCTCCTTACATGGGCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.863 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAA
CACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGT
AAGGAGCTGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)132492 - 623
NR_002309 (RPS26P11)132363 - 494
Exon 3 To Exon 4 (Pair 13)
Forward (496,23)TGCAATTCACAGCAAAGTAGTCAAmplicon SizecDNA: 128 bpgenomic: 753
Reverse (623,21)ACTCAGCTCCTTACATGGGCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.863 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACACC
CCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAAGG
AGCTGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)128367 - 494
NM_001029 (RPS26)128496 - 623
Exon 3 To Exon 4 (Pair 14)
Forward (473,23)AAGCTACATTACTGTGTGAGTTGAmplicon SizecDNA: 146 bpgenomic: 771
Reverse (618,21)GCTCCTTACATGGGCTTTGGTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-1.913 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGT
GAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGT
CCCCCACCAAAGCCCATGTAAGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)146344 - 489
NM_001029 (RPS26)146473 - 618
Exon 3 To Exon 4 (Pair 15)
Forward (491,23)AGTTGTGCAATTCACAGCAAAGTAmplicon SizecDNA: 128 bpgenomic: 753
Reverse (618,21)GCTCCTTACATGGGCTTTGGTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.106 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.1 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGA
ACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATG
TAAGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)128491 - 618
NR_002309 (RPS26P11)128362 - 489
Exon 3 To Exon 4 (Pair 16)
Forward (496,23)TGCAATTCACAGCAAAGTAGTCAAmplicon SizecDNA: 124 bpgenomic: 749
Reverse (619,21)AGCTCCTTACATGGGCTTTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.832 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACACC
CCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAAGG
AGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)124367 - 490
NM_001029 (RPS26)124496 - 619
Exon 3 To Exon 4 (Pair 17)
Forward (471,23)TGAAGCTACATTACTGTGTGAGTAmplicon SizecDNA: 146 bpgenomic: 771
Reverse (616,21)TCCTTACATGGGCTTTGGTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.145 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTC
GTGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCAC
GTCCCCCACCAAAGCCCATGTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)146342 - 487
NM_001029 (RPS26)146471 - 616
Exon 3 To Exon 4 (Pair 18)
Forward (493,23)TTGTGCAATTCACAGCAAAGTAGAmplicon SizecDNA: 132 bpgenomic: 757
Reverse (624,21)AACTCAGCTCCTTACATGGGCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.381 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAAC
ACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTA
AGGAGCTGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)132493 - 624
NR_002309 (RPS26P11)132364 - 495
Exon 3 To Exon 4 (Pair 19)
Forward (473,23)AAGCTACATTACTGTGTGAGTTGAmplicon SizecDNA: 147 bpgenomic: 772
Reverse (619,21)AGCTCCTTACATGGGCTTTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.832 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.763 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGT
GAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGT
CCCCCACCAAAGCCCATGTAAGGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)147473 - 619
NR_002309 (RPS26P11)147344 - 490
Exon 3 To Exon 4 (Pair 20)
Forward (493,23)TTGTGCAATTCACAGCAAAGTAGAmplicon SizecDNA: 130 bpgenomic: 755
Reverse (622,21)CTCAGCTCCTTACATGGGCTTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAAC
ACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTA
AGGAGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)130364 - 493
NM_001029 (RPS26)130493 - 622
Exon 3 To Exon 4 (Pair 21)
Forward (494,23)TGTGCAATTCACAGCAAAGTAGTAmplicon SizecDNA: 129 bpgenomic: 754
Reverse (622,21)CTCAGCTCCTTACATGGGCTTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.28 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACA
CCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAA
GGAGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)129365 - 493
NM_001029 (RPS26)129494 - 622
Exon 3 To Exon 4 (Pair 22)
Forward (492,23)GTTGTGCAATTCACAGCAAAGTAAmplicon SizecDNA: 131 bpgenomic: 756
Reverse (622,21)CTCAGCTCCTTACATGGGCTTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAA
CACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGT
AAGGAGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)131492 - 622
NR_002309 (RPS26P11)131363 - 493
Exon 3 To Exon 4 (Pair 23)
Forward (473,23)AAGCTACATTACTGTGTGAGTTGAmplicon SizecDNA: 145 bpgenomic: 770
Reverse (617,21)CTCCTTACATGGGCTTTGGTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-1.913 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGT
GAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGT
CCCCCACCAAAGCCCATGTAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)145473 - 617
NR_002309 (RPS26P11)145344 - 488
Exon 3 To Exon 4 (Pair 24)
Forward (493,23)TTGTGCAATTCACAGCAAAGTAGAmplicon SizecDNA: 128 bpgenomic: 753
Reverse (620,21)CAGCTCCTTACATGGGCTTTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAAC
ACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTA
AGGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)128493 - 620
NR_002309 (RPS26P11)128364 - 491
Exon 3 To Exon 4 (Pair 25)
Forward (496,23)TGCAATTCACAGCAAAGTAGTCAAmplicon SizecDNA: 127 bpgenomic: 752
Reverse (622,21)CTCAGCTCCTTACATGGGCTTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACACC
CCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAAGG
AGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)127496 - 622
NR_002309 (RPS26P11)127367 - 493
Exon 3 To Exon 4 (Pair 26)
Forward (493,23)TTGTGCAATTCACAGCAAAGTAGAmplicon SizecDNA: 126 bpgenomic: 751
Reverse (618,21)GCTCCTTACATGGGCTTTGGTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.1 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAAC
ACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTA
AGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)126364 - 489
NM_001029 (RPS26)126493 - 618
Exon 3 To Exon 4 (Pair 27)
Forward (469,23)TGTGAAGCTACATTACTGTGTGAAmplicon SizecDNA: 151 bpgenomic: 776
Reverse (619,21)AGCTCCTTACATGGGCTTTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.145 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops0.832 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.763 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGTGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATC
TCGTGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCC
ACGTCCCCCACCAAAGCCCATGTAAGGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)151469 - 619
NR_002309 (RPS26P11)151340 - 490
Exon 3 To Exon 4 (Pair 28)
Forward (473,23)AAGCTACATTACTGTGTGAGTTGAmplicon SizecDNA: 144 bpgenomic: 769
Reverse (616,21)TCCTTACATGGGCTTTGGTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-1.913 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGT
GAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGT
CCCCCACCAAAGCCCATGTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)144344 - 487
NM_001029 (RPS26)144473 - 616
Exon 3 To Exon 4 (Pair 29)
Forward (474,23)AGCTACATTACTGTGTGAGTTGTAmplicon SizecDNA: 147 bpgenomic: 772
Reverse (620,21)CAGCTCCTTACATGGGCTTTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.696 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.696 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTG
AAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTC
CCCCACCAAAGCCCATGTAAGGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)147345 - 491
NM_001029 (RPS26)147474 - 620
Exon 3 To Exon 4 (Pair 30)
Forward (492,23)GTTGTGCAATTCACAGCAAAGTAAmplicon SizecDNA: 128 bpgenomic: 753
Reverse (619,21)AGCTCCTTACATGGGCTTTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.832 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAA
CACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGT
AAGGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)128492 - 619
NR_002309 (RPS26P11)128363 - 490
Exon 3 To Exon 4 (Pair 31)
Forward (491,23)AGTTGTGCAATTCACAGCAAAGTAmplicon SizecDNA: 133 bpgenomic: 758
Reverse (623,21)ACTCAGCTCCTTACATGGGCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.106 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.863 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGA
ACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATG
TAAGGAGCTGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)133491 - 623
NR_002309 (RPS26P11)133362 - 494
Exon 3 To Exon 4 (Pair 32)
Forward (492,23)GTTGTGCAATTCACAGCAAAGTAAmplicon SizecDNA: 129 bpgenomic: 754
Reverse (620,21)CAGCTCCTTACATGGGCTTTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAA
CACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGT
AAGGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)129363 - 491
NM_001029 (RPS26)129492 - 620
Exon 3 To Exon 4 (Pair 33)
Forward (468,23)ATGTGAAGCTACATTACTGTGTGAmplicon SizecDNA: 150 bpgenomic: 775
Reverse (617,21)CTCCTTACATGGGCTTTGGTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.145 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceATGTGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGAT
CTCGTGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCC
CACGTCCCCCACCAAAGCCCATGTAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)150339 - 488
NM_001029 (RPS26)150468 - 617
Exon 3 To Exon 4 (Pair 34)
Forward (474,23)AGCTACATTACTGTGTGAGTTGTAmplicon SizecDNA: 144 bpgenomic: 769
Reverse (617,21)CTCCTTACATGGGCTTTGGTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.696 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-1.372 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTG
AAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTC
CCCCACCAAAGCCCATGTAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)144474 - 617
NR_002309 (RPS26P11)144345 - 488
Exon 3 To Exon 4 (Pair 35)
Forward (491,23)AGTTGTGCAATTCACAGCAAAGTAmplicon SizecDNA: 130 bpgenomic: 755
Reverse (620,21)CAGCTCCTTACATGGGCTTTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.106 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGA
ACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATG
TAAGGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)130491 - 620
NR_002309 (RPS26P11)130362 - 491
Exon 3 To Exon 4 (Pair 36)
Forward (494,23)TGTGCAATTCACAGCAAAGTAGTAmplicon SizecDNA: 125 bpgenomic: 750
Reverse (618,21)GCTCCTTACATGGGCTTTGGTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.28 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.1 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACA
CCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAA
GGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)125494 - 618
NR_002309 (RPS26P11)125365 - 489
Exon 3 To Exon 4 (Pair 37)
Forward (492,23)GTTGTGCAATTCACAGCAAAGTAAmplicon SizecDNA: 133 bpgenomic: 758
Reverse (624,21)AACTCAGCTCCTTACATGGGCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.381 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAA
CACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGT
AAGGAGCTGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)133492 - 624
NR_002309 (RPS26P11)133363 - 495
Exon 3 To Exon 4 (Pair 38)
Forward (491,23)AGTTGTGCAATTCACAGCAAAGTAmplicon SizecDNA: 132 bpgenomic: 757
Reverse (622,21)CTCAGCTCCTTACATGGGCTTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.106 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGA
ACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATG
TAAGGAGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)132491 - 622
NR_002309 (RPS26P11)132362 - 493
Exon 3 To Exon 4 (Pair 39)
Forward (496,23)TGCAATTCACAGCAAAGTAGTCAAmplicon SizecDNA: 125 bpgenomic: 750
Reverse (620,21)CAGCTCCTTACATGGGCTTTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.053 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACACC
CCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAAGG
AGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)125496 - 620
NR_002309 (RPS26P11)125367 - 491
Exon 3 To Exon 4 (Pair 40)
Forward (494,23)TGTGCAATTCACAGCAAAGTAGTAmplicon SizecDNA: 127 bpgenomic: 752
Reverse (620,21)CAGCTCCTTACATGGGCTTTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.28 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACA
CCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAA
GGAGCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)127494 - 620
NR_002309 (RPS26P11)127365 - 491
Exon 3 To Exon 4 (Pair 41)
Forward (491,23)AGTTGTGCAATTCACAGCAAAGTAmplicon SizecDNA: 134 bpgenomic: 759
Reverse (624,21)AACTCAGCTCCTTACATGGGCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.106 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.381 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGA
ACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATG
TAAGGAGCTGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)134491 - 624
NR_002309 (RPS26P11)134362 - 495
Exon 3 To Exon 4 (Pair 42)
Forward (489,23)TGAGTTGTGCAATTCACAGCAAAAmplicon SizecDNA: 136 bpgenomic: 761
Reverse (624,21)AACTCAGCTCCTTACATGGGCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.106 kcal/mol in 3' area
Forward Dimers-1.391 kcal/mol
Reverse Loops1.381 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.437 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACC
GAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCA
TGTAAGGAGCTGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)136360 - 495
NM_001029 (RPS26)136489 - 624
Exon 3 To Exon 4 (Pair 43)
Forward (493,23)TTGTGCAATTCACAGCAAAGTAGAmplicon SizecDNA: 127 bpgenomic: 752
Reverse (619,21)AGCTCCTTACATGGGCTTTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.209 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.832 kcal/mol in 3' area
Reverse Dimers-1.83 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAAC
ACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTA
AGGAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)127493 - 619
NR_002309 (RPS26P11)127364 - 490
Exon 3 To Exon 4 (Pair 44)
Forward (474,23)AGCTACATTACTGTGTGAGTTGTAmplicon SizecDNA: 151 bpgenomic: 776
Reverse (624,21)AACTCAGCTCCTTACATGGGCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.696 kcal/mol
Reverse Loops1.381 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.696 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTG
AAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTC
CCCCACCAAAGCCCATGTAAGGAGCTGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)151474 - 624
NR_002309 (RPS26P11)151345 - 495
Exon 3 To Exon 4 (Pair 45)
Forward (472,23)GAAGCTACATTACTGTGTGAGTTAmplicon SizecDNA: 146 bpgenomic: 771
Reverse (617,21)CTCCTTACATGGGCTTTGGTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCG
TGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACG
TCCCCCACCAAAGCCCATGTAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)146472 - 617
NR_002309 (RPS26P11)146343 - 488
Exon 3 To Exon 4 (Pair 46)
Forward (474,23)AGCTACATTACTGTGTGAGTTGTAmplicon SizecDNA: 145 bpgenomic: 770
Reverse (618,21)GCTCCTTACATGGGCTTTGGTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.696 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-1.372 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTG
AAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTC
CCCCACCAAAGCCCATGTAAGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)145474 - 618
NR_002309 (RPS26P11)145345 - 489
Exon 3 To Exon 4 (Pair 47)
Forward (468,23)ATGTGAAGCTACATTACTGTGTGAmplicon SizecDNA: 149 bpgenomic: 774
Reverse (616,21)TCCTTACATGGGCTTTGGTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.145 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceATGTGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGAT
CTCGTGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCC
CACGTCCCCCACCAAAGCCCATGTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)149468 - 616
NR_002309 (RPS26P11)149339 - 487
Exon 3 To Exon 4 (Pair 48)
Forward (469,23)TGTGAAGCTACATTACTGTGTGAAmplicon SizecDNA: 149 bpgenomic: 774
Reverse (617,21)CTCCTTACATGGGCTTTGGTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.145 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGTGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATC
TCGTGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCC
ACGTCCCCCACCAAAGCCCATGTAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)149469 - 617
NR_002309 (RPS26P11)149340 - 488
Exon 3 To Exon 4 (Pair 49)
Forward (469,23)TGTGAAGCTACATTACTGTGTGAAmplicon SizecDNA: 148 bpgenomic: 773
Reverse (616,21)TCCTTACATGGGCTTTGGTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.145 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGTGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATC
TCGTGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCC
ACGTCCCCCACCAAAGCCCATGTAAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)148469 - 616
NR_002309 (RPS26P11)148340 - 487
Exon 3 To Exon 4 (Pair 50)
Forward (466,23)GTATGTGAAGCTACATTACTGTGAmplicon SizecDNA: 151 bpgenomic: 776
Reverse (616,21)TCCTTACATGGGCTTTGGTGGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.953 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceGTATGTGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCG
ATCTCGTGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGC
CCCACGTCCCCCACCAAAGCCCATGTAAGGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_004805 (POLR2D)1491715 - 1863
NR_002309 (RPS26P11)151337 - 487
NM_001029 (RPS26)151466 - 616
Exon 3 To Exon 4 (Pair 51)
Forward (474,23)AGCTACATTACTGTGTGAGTTGTAmplicon SizecDNA: 150 bpgenomic: 775
Reverse (623,21)ACTCAGCTCCTTACATGGGCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.696 kcal/mol
Reverse Loops0.863 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.696 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTG
AAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTC
CCCCACCAAAGCCCATGTAAGGAGCTGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)150345 - 494
NM_001029 (RPS26)150474 - 623
Exon 3 To Exon 4 (Pair 52)
Forward (471,23)TGAAGCTACATTACTGTGTGAGTAmplicon SizecDNA: 147 bpgenomic: 772
Reverse (617,21)CTCCTTACATGGGCTTTGGTGNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.145 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.381 kcal/mol
Reverse Dimers-0.994 kcal/mol
Forward-Reverse Dimers-2.38 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGAAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTC
GTGAAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCAC
GTCCCCCACCAAAGCCCATGTAAGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)147342 - 488
NM_001029 (RPS26)147471 - 617
Exon 3 To Exon 4 (Pair 53)
Forward (474,23)AGCTACATTACTGTGTGAGTTGTAmplicon SizecDNA: 149 bpgenomic: 774
Reverse (622,21)CTCAGCTCCTTACATGGGCTTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.748 kcal/mol in 3' area
Forward Dimers-1.696 kcal/mol
Reverse Loops0.358 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.696 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceAGCTACATTACTGTGTGAGTTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTG
AAGCCCGCAAGGACCGAACACCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTC
CCCCACCAAAGCCCATGTAAGGAGCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NR_002309 (RPS26P11)149345 - 493
NM_001029 (RPS26)149474 - 622
Exon 3 To Exon 4 (Pair 54)
Forward (494,23)TGTGCAATTCACAGCAAAGTAGTAmplicon SizecDNA: 130 bpgenomic: 755
Reverse (623,21)ACTCAGCTCCTTACATGGGCTNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.28 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops0.863 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACA
CCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAA
GGAGCTGAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)130494 - 623
NR_002309 (RPS26P11)130365 - 494
Exon 3 To Exon 4 (Pair 55)
Forward (494,23)TGTGCAATTCACAGCAAAGTAGTAmplicon SizecDNA: 131 bpgenomic: 756
Reverse (624,21)AACTCAGCTCCTTACATGGGCNr. of Isoforms 2 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.28 kcal/mol
Forward Dimers-1.212 kcal/mol
Reverse Loops1.381 kcal/mol in 3' area
Reverse Dimers-2.778 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-1.257 kcal/mol outside primersite
Amplicon SequenceTGTGCAATTCACAGCAAAGTAGTCAGGAATCGATCTCGTGAAGCCCGCAAGGACCGAACA
CCCCCACCCCGATTTAGACCTGCGGGTGCTGCCCCACGTCCCCCACCAAAGCCCATGTAA
GGAGCTGAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001029 (RPS26)131494 - 624
NR_002309 (RPS26P11)131365 - 495
 

See below for some more details.

Program Output:

Loading ...