Design Results for Rhod

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 4 (Pair 1)
Forward (227,20)CCCACGGTGTTTGAGCGGTAAmplicon SizecDNA: 299 bpgenomic: 4,630
Reverse (525,21)CCGTTTCTTCGGAGCTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.13 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.748 kcal/mol
Amplicon Folding-2.143 kcal/mol outside primersite
Amplicon SequenceCCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTC
CACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCT
GACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATC
TTTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTG
GGCTGCAAGACTGACCTGTGCAAGGACAAATCACTGGTGAACAAGCTCCGAAGAAACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)299227 - 525
Exon 2 To Exon 4 (Pair 2)
Forward (234,22)TGTTTGAGCGGTACATGGTCAAAmplicon SizecDNA: 251 bpgenomic: 4,582
Reverse (484,20)CAGGTCAGTCTTGCAGCCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.069 kcal/mol in 3' area
Forward Dimers-0.994 kcal/mol
Reverse Loops1.413 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-0.818 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCT
GGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCA
GCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACC
GGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
AGACTGACCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)251234 - 484
Exon 2 To Exon 4 (Pair 3)
Forward (227,20)CCCACGGTGTTTGAGCGGTAAmplicon SizecDNA: 264 bpgenomic: 4,595
Reverse (490,21)CTTGCACAGGTCAGTCTTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.018 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTC
CACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCT
GACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATC
TTTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTG
GGCTGCAAGACTGACCTGTGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)264227 - 490
Exon 2 To Exon 4 (Pair 4)
Forward (228,20)CCACGGTGTTTGAGCGGTACAmplicon SizecDNA: 243 bpgenomic: 4,574
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.57 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCC
ACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTG
ACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCT
TTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGG
GCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)243228 - 470
Exon 2 To Exon 4 (Pair 5)
Forward (234,22)TGTTTGAGCGGTACATGGTCAAAmplicon SizecDNA: 250 bpgenomic: 4,581
Reverse (483,20)AGGTCAGTCTTGCAGCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.069 kcal/mol in 3' area
Forward Dimers-0.994 kcal/mol
Reverse Loops1.887 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-0.818 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCT
GGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCA
GCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACC
GGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
AGACTGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)250234 - 483
Exon 2 To Exon 4 (Pair 6)
Forward (228,20)CCACGGTGTTTGAGCGGTACAmplicon SizecDNA: 298 bpgenomic: 4,629
Reverse (525,21)CCGTTTCTTCGGAGCTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.13 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.748 kcal/mol
Amplicon Folding-2.143 kcal/mol outside primersite
Amplicon SequenceCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCC
ACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTG
ACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCT
TTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGG
GCTGCAAGACTGACCTGTGCAAGGACAAATCACTGGTGAACAAGCTCCGAAGAAACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)298228 - 525
Exon 2 To Exon 4 (Pair 7)
Forward (227,20)CCCACGGTGTTTGAGCGGTAAmplicon SizecDNA: 244 bpgenomic: 4,575
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.57 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTC
CACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCT
GACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATC
TTTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTG
GGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)244227 - 470
Exon 2 To Exon 4 (Pair 8)
Forward (228,20)CCACGGTGTTTGAGCGGTACAmplicon SizecDNA: 246 bpgenomic: 4,577
Reverse (473,20)TGCAGCCCACGACGATGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops1.711 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.57 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCC
ACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTG
ACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCT
TTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGG
GCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)246228 - 473
Exon 2 To Exon 4 (Pair 9)
Forward (228,20)CCACGGTGTTTGAGCGGTACAmplicon SizecDNA: 241 bpgenomic: 4,572
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.57 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCC
ACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTG
ACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCT
TTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)241228 - 468
Exon 2 To Exon 4 (Pair 10)
Forward (242,21)CGGTACATGGTCAACCTGCAAAmplicon SizecDNA: 227 bpgenomic: 4,558
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-1.252 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.932 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCTGGGACACA
GCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCAGCGTCCTG
CTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTAC
CCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)227242 - 468
Exon 2 To Exon 4 (Pair 11)
Forward (228,20)CCACGGTGTTTGAGCGGTACAmplicon SizecDNA: 263 bpgenomic: 4,594
Reverse (490,21)CTTGCACAGGTCAGTCTTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.018 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCC
ACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTG
ACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCT
TTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGG
GCTGCAAGACTGACCTGTGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)263228 - 490
Exon 2 To Exon 4 (Pair 12)
Forward (228,20)CCACGGTGTTTGAGCGGTACAmplicon SizecDNA: 242 bpgenomic: 4,573
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.57 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCC
ACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTG
ACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCT
TTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGG
GC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)242228 - 469
Exon 2 To Exon 4 (Pair 13)
Forward (242,21)CGGTACATGGTCAACCTGCAAAmplicon SizecDNA: 284 bpgenomic: 4,615
Reverse (525,21)CCGTTTCTTCGGAGCTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-1.252 kcal/mol
Reverse Loops0.13 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-0.807 kcal/mol
Amplicon Folding-2.143 kcal/mol outside primersite
Amplicon SequenceCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCTGGGACACA
GCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCAGCGTCCTG
CTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTAC
CCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGAC
CTGTGCAAGGACAAATCACTGGTGAACAAGCTCCGAAGAAACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)284242 - 525
Exon 2 To Exon 4 (Pair 14)
Forward (234,22)TGTTTGAGCGGTACATGGTCAAAmplicon SizecDNA: 256 bpgenomic: 4,587
Reverse (489,21)TTGCACAGGTCAGTCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.069 kcal/mol in 3' area
Forward Dimers-0.994 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-0.982 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCT
GGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCA
GCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACC
GGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
AGACTGACCTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)256234 - 489
Exon 2 To Exon 4 (Pair 15)
Forward (234,22)TGTTTGAGCGGTACATGGTCAAAmplicon SizecDNA: 257 bpgenomic: 4,588
Reverse (490,21)CTTGCACAGGTCAGTCTTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.069 kcal/mol in 3' area
Forward Dimers-0.994 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-0.982 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCT
GGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCA
GCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACC
GGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
AGACTGACCTGTGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)257234 - 490
Exon 2 To Exon 4 (Pair 16)
Forward (234,22)TGTTTGAGCGGTACATGGTCAAAmplicon SizecDNA: 292 bpgenomic: 4,623
Reverse (525,21)CCGTTTCTTCGGAGCTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.069 kcal/mol in 3' area
Forward Dimers-0.994 kcal/mol
Reverse Loops0.13 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-1.803 kcal/mol
Amplicon Folding-2.143 kcal/mol outside primersite
Amplicon SequenceTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCT
GGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCA
GCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACC
GGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
AGACTGACCTGTGCAAGGACAAATCACTGGTGAACAAGCTCCGAAGAAACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)292234 - 525
Exon 2 To Exon 4 (Pair 17)
Forward (227,20)CCCACGGTGTTTGAGCGGTAAmplicon SizecDNA: 242 bpgenomic: 4,573
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.57 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTC
CACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCT
GACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATC
TTTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTG
GG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)242227 - 468
Exon 2 To Exon 4 (Pair 18)
Forward (243,21)GGTACATGGTCAACCTGCAAGAmplicon SizecDNA: 226 bpgenomic: 4,557
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-1.252 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.932 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCTGGGACACAG
CAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCAGCGTCCTGC
TGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACC
CAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)226243 - 468
Exon 2 To Exon 4 (Pair 19)
Forward (228,20)CCACGGTGTTTGAGCGGTACAmplicon SizecDNA: 262 bpgenomic: 4,593
Reverse (489,21)TTGCACAGGTCAGTCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.018 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCC
ACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTG
ACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCT
TTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGG
GCTGCAAGACTGACCTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)262228 - 489
Exon 2 To Exon 4 (Pair 20)
Forward (242,21)CGGTACATGGTCAACCTGCAAAmplicon SizecDNA: 228 bpgenomic: 4,559
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-1.252 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.932 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCTGGGACACA
GCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCAGCGTCCTG
CTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTAC
CCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)228242 - 469
Exon 2 To Exon 4 (Pair 21)
Forward (227,20)CCCACGGTGTTTGAGCGGTAAmplicon SizecDNA: 263 bpgenomic: 4,594
Reverse (489,21)TTGCACAGGTCAGTCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.018 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTC
CACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCT
GACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATC
TTTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTG
GGCTGCAAGACTGACCTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)263227 - 489
Exon 2 To Exon 4 (Pair 22)
Forward (243,21)GGTACATGGTCAACCTGCAAGAmplicon SizecDNA: 228 bpgenomic: 4,559
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-1.252 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.932 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCTGGGACACAG
CAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCAGCGTCCTGC
TGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACC
CAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)228243 - 470
Exon 2 To Exon 4 (Pair 23)
Forward (227,20)CCCACGGTGTTTGAGCGGTAAmplicon SizecDNA: 247 bpgenomic: 4,578
Reverse (473,20)TGCAGCCCACGACGATGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops1.711 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.57 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTC
CACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCT
GACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATC
TTTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTG
GGCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)247227 - 473
Exon 2 To Exon 4 (Pair 24)
Forward (243,21)GGTACATGGTCAACCTGCAAGAmplicon SizecDNA: 227 bpgenomic: 4,558
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-1.252 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.932 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCTGGGACACAG
CAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCAGCGTCCTGC
TGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACC
CAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)227243 - 469
Exon 2 To Exon 4 (Pair 25)
Forward (227,20)CCCACGGTGTTTGAGCGGTAAmplicon SizecDNA: 243 bpgenomic: 4,574
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.644 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.57 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCCCACGGTGTTTGAGCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTC
CACATCTGGGACACAGCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCT
GACGCCAGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATC
TTTAACCGGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTG
GGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)243227 - 469
Exon 2 To Exon 4 (Pair 26)
Forward (242,21)CGGTACATGGTCAACCTGCAAAmplicon SizecDNA: 229 bpgenomic: 4,560
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.369 kcal/mol
Forward Dimers-1.252 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.932 kcal/mol
Amplicon Folding-1.736 kcal/mol outside primersite
Amplicon SequenceCGGTACATGGTCAACCTGCAAGTGAAAGGCAAACCTGTGCACCTCCACATCTGGGACACA
GCAGGGCAAGATGACTATGACCGCCTGCGGCCCCTGTTCTACCCTGACGCCAGCGTCCTG
CTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTAC
CCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)229242 - 470
Exon 3 To Exon 4 (Pair 1)
Forward (381,20)CCAGCCCGAACAGCTTTGACAmplicon SizecDNA: 93 bpgenomic: 3,670
Reverse (473,20)TGCAGCCCACGACGATGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.46 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops1.711 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.833 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAATCATTTCT
GCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)93381 - 473
Exon 3 To Exon 4 (Pair 2)
Forward (361,21)GCTGCTTTGCTTCGATGTCACAmplicon SizecDNA: 165 bpgenomic: 3,742
Reverse (525,21)CCGTTTCTTCGGAGCTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.13 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.95 kcal/mol
Amplicon Folding-0.407 kcal/mol outside primersite
Amplicon SequenceGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTA
CCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGA
CCTGTGCAAGGACAAATCACTGGTGAACAAGCTCCGAAGAAACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)165361 - 525
Exon 3 To Exon 4 (Pair 3)
Forward (374,20)GATGTCACCAGCCCGAACAGAmplicon SizecDNA: 97 bpgenomic: 3,674
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.007 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.787 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAAT
CATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)97374 - 470
Exon 3 To Exon 4 (Pair 4)
Forward (361,21)GCTGCTTTGCTTCGATGTCACAmplicon SizecDNA: 109 bpgenomic: 3,686
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTA
CCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)109361 - 469
Exon 3 To Exon 4 (Pair 5)
Forward (372,20)TCGATGTCACCAGCCCGAACAmplicon SizecDNA: 112 bpgenomic: 3,689
Reverse (483,20)AGGTCAGTCTTGCAGCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops1.887 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGA
ATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)112372 - 483
Exon 3 To Exon 4 (Pair 6)
Forward (362,21)CTGCTTTGCTTCGATGTCACCAmplicon SizecDNA: 112 bpgenomic: 3,689
Reverse (473,20)TGCAGCCCACGACGATGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.711 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTAC
CCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)112362 - 473
Exon 3 To Exon 4 (Pair 7)
Forward (361,21)GCTGCTTTGCTTCGATGTCACAmplicon SizecDNA: 110 bpgenomic: 3,687
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTA
CCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)110361 - 470
Exon 3 To Exon 4 (Pair 8)
Forward (362,21)CTGCTTTGCTTCGATGTCACCAmplicon SizecDNA: 109 bpgenomic: 3,686
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTAC
CCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)109362 - 470
Exon 3 To Exon 4 (Pair 9)
Forward (372,20)TCGATGTCACCAGCCCGAACAmplicon SizecDNA: 119 bpgenomic: 3,696
Reverse (490,21)CTTGCACAGGTCAGTCTTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol outside primersite
Amplicon SequenceTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGA
ATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTGTGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)119372 - 490
Exon 3 To Exon 4 (Pair 10)
Forward (362,21)CTGCTTTGCTTCGATGTCACCAmplicon SizecDNA: 164 bpgenomic: 3,741
Reverse (525,21)CCGTTTCTTCGGAGCTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.13 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.95 kcal/mol
Amplicon Folding-0.407 kcal/mol outside primersite
Amplicon SequenceCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTAC
CCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGAC
CTGTGCAAGGACAAATCACTGGTGAACAAGCTCCGAAGAAACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)164362 - 525
Exon 3 To Exon 4 (Pair 11)
Forward (375,20)ATGTCACCAGCCCGAACAGCAmplicon SizecDNA: 110 bpgenomic: 3,687
Reverse (484,20)CAGGTCAGTCTTGCAGCCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.975 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.413 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAATC
ATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)110375 - 484
Exon 3 To Exon 4 (Pair 12)
Forward (354,20)GCGTCCTGCTGCTTTGCTTCAmplicon SizecDNA: 116 bpgenomic: 3,693
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.899 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.658 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACC
GGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)116354 - 469
Exon 3 To Exon 4 (Pair 13)
Forward (374,20)GATGTCACCAGCCCGAACAGAmplicon SizecDNA: 100 bpgenomic: 3,677
Reverse (473,20)TGCAGCCCACGACGATGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.007 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.711 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.787 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAAT
CATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)100374 - 473
Exon 3 To Exon 4 (Pair 14)
Forward (370,20)CTTCGATGTCACCAGCCCGAAmplicon SizecDNA: 100 bpgenomic: 3,677
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGT
GAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)100370 - 469
Exon 3 To Exon 4 (Pair 15)
Forward (372,20)TCGATGTCACCAGCCCGAACAmplicon SizecDNA: 102 bpgenomic: 3,679
Reverse (473,20)TGCAGCCCACGACGATGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops1.711 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGA
ATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)102372 - 473
Exon 3 To Exon 4 (Pair 16)
Forward (381,20)CCAGCCCGAACAGCTTTGACAmplicon SizecDNA: 90 bpgenomic: 3,667
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.46 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.787 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAATCATTTCT
GCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)90381 - 470
Exon 3 To Exon 4 (Pair 17)
Forward (362,21)CTGCTTTGCTTCGATGTCACCAmplicon SizecDNA: 107 bpgenomic: 3,684
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.116 kcal/mol inside primersite
Amplicon SequenceCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTAC
CCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)107362 - 468
Exon 3 To Exon 4 (Pair 18)
Forward (375,20)ATGTCACCAGCCCGAACAGCAmplicon SizecDNA: 99 bpgenomic: 3,676
Reverse (473,20)TGCAGCCCACGACGATGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.975 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.711 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.787 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAATC
ATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)99375 - 473
Exon 3 To Exon 4 (Pair 19)
Forward (355,20)CGTCCTGCTGCTTTGCTTCGAmplicon SizecDNA: 115 bpgenomic: 3,692
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.284 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCG
GTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)115355 - 469
Exon 3 To Exon 4 (Pair 20)
Forward (370,20)CTTCGATGTCACCAGCCCGAAmplicon SizecDNA: 99 bpgenomic: 3,676
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.116 kcal/mol inside primersite
Amplicon SequenceCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGT
GAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)99370 - 468
Exon 3 To Exon 4 (Pair 21)
Forward (361,21)GCTGCTTTGCTTCGATGTCACAmplicon SizecDNA: 108 bpgenomic: 3,685
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.116 kcal/mol inside primersite
Amplicon SequenceGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTA
CCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)108361 - 468
Exon 3 To Exon 4 (Pair 22)
Forward (364,21)GCTTTGCTTCGATGTCACCAGAmplicon SizecDNA: 106 bpgenomic: 3,683
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCC
AGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)106364 - 469
Exon 3 To Exon 4 (Pair 23)
Forward (370,20)CTTCGATGTCACCAGCCCGAAmplicon SizecDNA: 104 bpgenomic: 3,681
Reverse (473,20)TGCAGCCCACGACGATGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops1.711 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGT
GAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)104370 - 473
Exon 3 To Exon 4 (Pair 24)
Forward (362,21)CTGCTTTGCTTCGATGTCACCAmplicon SizecDNA: 108 bpgenomic: 3,685
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTAC
CCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)108362 - 469
Exon 3 To Exon 4 (Pair 25)
Forward (355,20)CGTCCTGCTGCTTTGCTTCGAmplicon SizecDNA: 136 bpgenomic: 3,713
Reverse (490,21)CTTGCACAGGTCAGTCTTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding0.024 kcal/mol outside primersite
Amplicon SequenceCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCG
GTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAA
GACTGACCTGTGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)136355 - 490
Exon 3 To Exon 4 (Pair 26)
Forward (364,21)GCTTTGCTTCGATGTCACCAGAmplicon SizecDNA: 162 bpgenomic: 3,739
Reverse (525,21)CCGTTTCTTCGGAGCTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.13 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.95 kcal/mol
Amplicon Folding-0.407 kcal/mol outside primersite
Amplicon SequenceGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCC
AGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCT
GTGCAAGGACAAATCACTGGTGAACAAGCTCCGAAGAAACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)162364 - 525
Exon 3 To Exon 4 (Pair 27)
Forward (374,20)GATGTCACCAGCCCGAACAGAmplicon SizecDNA: 116 bpgenomic: 3,693
Reverse (489,21)TTGCACAGGTCAGTCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.007 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol outside primersite
Amplicon SequenceGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAAT
CATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)116374 - 489
Exon 3 To Exon 4 (Pair 28)
Forward (355,20)CGTCCTGCTGCTTTGCTTCGAmplicon SizecDNA: 116 bpgenomic: 3,693
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.284 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCG
GTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)116355 - 470
Exon 3 To Exon 4 (Pair 29)
Forward (372,20)TCGATGTCACCAGCCCGAACAmplicon SizecDNA: 113 bpgenomic: 3,690
Reverse (484,20)CAGGTCAGTCTTGCAGCCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops1.413 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGA
ATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)113372 - 484
Exon 3 To Exon 4 (Pair 30)
Forward (375,20)ATGTCACCAGCCCGAACAGCAmplicon SizecDNA: 109 bpgenomic: 3,686
Reverse (483,20)AGGTCAGTCTTGCAGCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.975 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.887 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAATC
ATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)109375 - 483
Exon 3 To Exon 4 (Pair 31)
Forward (375,20)ATGTCACCAGCCCGAACAGCAmplicon SizecDNA: 116 bpgenomic: 3,693
Reverse (490,21)CTTGCACAGGTCAGTCTTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.975 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol outside primersite
Amplicon SequenceATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAATC
ATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTGTGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)116375 - 490
Exon 3 To Exon 4 (Pair 32)
Forward (354,20)GCGTCCTGCTGCTTTGCTTCAmplicon SizecDNA: 117 bpgenomic: 3,694
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.899 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.658 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACC
GGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)117354 - 470
Exon 3 To Exon 4 (Pair 33)
Forward (364,21)GCTTTGCTTCGATGTCACCAGAmplicon SizecDNA: 107 bpgenomic: 3,684
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCC
AGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)107364 - 470
Exon 3 To Exon 4 (Pair 34)
Forward (359,21)CTGCTGCTTTGCTTCGATGTCAmplicon SizecDNA: 112 bpgenomic: 3,689
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGG
TACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)112359 - 470
Exon 3 To Exon 4 (Pair 35)
Forward (370,20)CTTCGATGTCACCAGCCCGAAmplicon SizecDNA: 120 bpgenomic: 3,697
Reverse (489,21)TTGCACAGGTCAGTCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol outside primersite
Amplicon SequenceCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGT
GAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)120370 - 489
Exon 3 To Exon 4 (Pair 36)
Forward (374,20)GATGTCACCAGCCCGAACAGAmplicon SizecDNA: 111 bpgenomic: 3,688
Reverse (484,20)CAGGTCAGTCTTGCAGCCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.007 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.413 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAAT
CATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)111374 - 484
Exon 3 To Exon 4 (Pair 37)
Forward (370,20)CTTCGATGTCACCAGCCCGAAmplicon SizecDNA: 101 bpgenomic: 3,678
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGT
GAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)101370 - 470
Exon 3 To Exon 4 (Pair 38)
Forward (375,20)ATGTCACCAGCCCGAACAGCAmplicon SizecDNA: 115 bpgenomic: 3,692
Reverse (489,21)TTGCACAGGTCAGTCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.975 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol outside primersite
Amplicon SequenceATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAATC
ATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)115375 - 489
Exon 3 To Exon 4 (Pair 39)
Forward (372,20)TCGATGTCACCAGCCCGAACAmplicon SizecDNA: 97 bpgenomic: 3,674
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.116 kcal/mol inside primersite
Amplicon SequenceTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGA
ATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)97372 - 468
Exon 3 To Exon 4 (Pair 40)
Forward (370,20)CTTCGATGTCACCAGCCCGAAmplicon SizecDNA: 121 bpgenomic: 3,698
Reverse (490,21)CTTGCACAGGTCAGTCTTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol outside primersite
Amplicon SequenceCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGT
GAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTGTGCAA
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)121370 - 490
Exon 3 To Exon 4 (Pair 41)
Forward (354,20)GCGTCCTGCTGCTTTGCTTCAmplicon SizecDNA: 172 bpgenomic: 3,749
Reverse (525,21)CCGTTTCTTCGGAGCTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.899 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.13 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-1.898 kcal/mol
Amplicon Folding-0.407 kcal/mol outside primersite
Amplicon SequenceGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACC
GGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
AGACTGACCTGTGCAAGGACAAATCACTGGTGAACAAGCTCCGAAGAAACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)172354 - 525
Exon 3 To Exon 4 (Pair 42)
Forward (362,21)CTGCTTTGCTTCGATGTCACCAmplicon SizecDNA: 122 bpgenomic: 3,699
Reverse (483,20)AGGTCAGTCTTGCAGCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.702 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.887 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.816 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTAC
CCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGAC
CT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)122362 - 483
Exon 3 To Exon 4 (Pair 43)
Forward (359,21)CTGCTGCTTTGCTTCGATGTCAmplicon SizecDNA: 111 bpgenomic: 3,688
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGG
TACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)111359 - 469
Exon 3 To Exon 4 (Pair 44)
Forward (364,21)GCTTTGCTTCGATGTCACCAGAmplicon SizecDNA: 105 bpgenomic: 3,682
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.116 kcal/mol inside primersite
Amplicon SequenceGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCC
AGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)105364 - 468
Exon 3 To Exon 4 (Pair 45)
Forward (375,20)ATGTCACCAGCCCGAACAGCAmplicon SizecDNA: 96 bpgenomic: 3,673
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.975 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.787 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAATC
ATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)96375 - 470
Exon 3 To Exon 4 (Pair 46)
Forward (381,20)CCAGCCCGAACAGCTTTGACAmplicon SizecDNA: 89 bpgenomic: 3,666
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.46 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.787 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAATCATTTCT
GCAAGAAGGTACCCATCATCGTCGTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)89381 - 469
Exon 3 To Exon 4 (Pair 47)
Forward (374,20)GATGTCACCAGCCCGAACAGAmplicon SizecDNA: 110 bpgenomic: 3,687
Reverse (483,20)AGGTCAGTCTTGCAGCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.007 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.887 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAAT
CATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)110374 - 483
Exon 3 To Exon 4 (Pair 48)
Forward (359,21)CTGCTGCTTTGCTTCGATGTCAmplicon SizecDNA: 110 bpgenomic: 3,687
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.116 kcal/mol inside primersite
Amplicon SequenceCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGG
TACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)110359 - 468
Exon 3 To Exon 4 (Pair 49)
Forward (354,20)GCGTCCTGCTGCTTTGCTTCAmplicon SizecDNA: 115 bpgenomic: 3,692
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.899 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.658 kcal/mol
Amplicon Folding0.116 kcal/mol inside primersite
Amplicon SequenceGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACC
GGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)115354 - 468
Exon 3 To Exon 4 (Pair 50)
Forward (364,21)GCTTTGCTTCGATGTCACCAGAmplicon SizecDNA: 110 bpgenomic: 3,687
Reverse (473,20)TGCAGCCCACGACGATGATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.973 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops1.711 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCC
AGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)110364 - 473
Exon 3 To Exon 4 (Pair 51)
Forward (370,20)CTTCGATGTCACCAGCCCGAAmplicon SizecDNA: 114 bpgenomic: 3,691
Reverse (483,20)AGGTCAGTCTTGCAGCCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops1.887 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGT
GAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)114370 - 483
Exon 3 To Exon 4 (Pair 52)
Forward (370,20)CTTCGATGTCACCAGCCCGAAmplicon SizecDNA: 115 bpgenomic: 3,692
Reverse (484,20)CAGGTCAGTCTTGCAGCCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops1.413 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGT
GAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)115370 - 484
Exon 3 To Exon 4 (Pair 53)
Forward (372,20)TCGATGTCACCAGCCCGAACAmplicon SizecDNA: 99 bpgenomic: 3,676
Reverse (470,20)AGCCCACGACGATGATGGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.121 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGA
ATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)99372 - 470
Exon 3 To Exon 4 (Pair 54)
Forward (374,20)GATGTCACCAGCCCGAACAGAmplicon SizecDNA: 117 bpgenomic: 3,694
Reverse (490,21)CTTGCACAGGTCAGTCTTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.007 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol outside primersite
Amplicon SequenceGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAAT
CATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTGTGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)117374 - 490
Exon 3 To Exon 4 (Pair 55)
Forward (372,20)TCGATGTCACCAGCCCGAACAmplicon SizecDNA: 98 bpgenomic: 3,675
Reverse (469,20)GCCCACGACGATGATGGGTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.021 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding0.024 kcal/mol inside primersite
Amplicon SequenceTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGA
ATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)98372 - 469
Exon 3 To Exon 4 (Pair 56)
Forward (354,20)GCGTCCTGCTGCTTTGCTTCAmplicon SizecDNA: 137 bpgenomic: 3,714
Reverse (490,21)CTTGCACAGGTCAGTCTTGCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.899 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.973 kcal/mol
Amplicon Folding0.024 kcal/mol outside primersite
Amplicon SequenceGCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACC
GGTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCA
AGACTGACCTGTGCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)137354 - 490
Exon 3 To Exon 4 (Pair 57)
Forward (359,21)CTGCTGCTTTGCTTCGATGTCAmplicon SizecDNA: 167 bpgenomic: 3,744
Reverse (525,21)CCGTTTCTTCGGAGCTTGTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops0.13 kcal/mol
Reverse Dimers-2.948 kcal/mol
Forward-Reverse Dimers-2.95 kcal/mol
Amplicon Folding-0.407 kcal/mol outside primersite
Amplicon SequenceCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGG
TACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACT
GACCTGTGCAAGGACAAATCACTGGTGAACAAGCTCCGAAGAAACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)167359 - 525
Exon 3 To Exon 4 (Pair 58)
Forward (355,20)CGTCCTGCTGCTTTGCTTCGAmplicon SizecDNA: 114 bpgenomic: 3,691
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.665 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-2.284 kcal/mol
Amplicon Folding0.116 kcal/mol inside primersite
Amplicon SequenceCGTCCTGCTGCTTTGCTTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCG
GTGGTACCCAGAAGTGAATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)114355 - 468
Exon 3 To Exon 4 (Pair 59)
Forward (381,20)CCAGCCCGAACAGCTTTGACAmplicon SizecDNA: 88 bpgenomic: 3,665
Reverse (468,20)CCCACGACGATGATGGGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.46 kcal/mol
Forward Dimers-2.77 kcal/mol
Reverse Loops0.546 kcal/mol in 3' area
Reverse Dimers-2.288 kcal/mol
Forward-Reverse Dimers-1.787 kcal/mol
Amplicon Folding0.116 kcal/mol inside primersite
Amplicon SequenceCCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGAATCATTTCT
GCAAGAAGGTACCCATCATCGTCGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)88381 - 468
Exon 3 To Exon 4 (Pair 60)
Forward (372,20)TCGATGTCACCAGCCCGAACAmplicon SizecDNA: 118 bpgenomic: 3,695
Reverse (489,21)TTGCACAGGTCAGTCTTGCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.761 kcal/mol in 3' area
Forward Dimers-1.184 kcal/mol
Reverse Loops0.909 kcal/mol in 3' area
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.971 kcal/mol
Amplicon Folding0.024 kcal/mol outside primersite
Amplicon SequenceTCGATGTCACCAGCCCGAACAGCTTTGACAACATCTTTAACCGGTGGTACCCAGAAGTGA
ATCATTTCTGCAAGAAGGTACCCATCATCGTCGTGGGCTGCAAGACTGACCTGTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014578 (RHOD)118372 - 489
 

See below for some more details.

Program Output:

Loading ...