Design Results for SCN1A

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 22 To Exon 23 (Pair 136)
Forward (4029,23)GAAAGACAGTTGTATGTCCAATCAmplicon SizecDNA: 296 bpgenomic: 9,114
Reverse (4324,24)GGCATTCAATAACCACTTAATAACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.897 kcal/mol
Forward Dimers-0.816 kcal/mol
Reverse Loops1.99 kcal/mol
Reverse Dimers-0.512 kcal/mol
Forward-Reverse Dimers-1.72 kcal/mol
Amplicon Folding-0.487 kcal/mol outside primersite
Amplicon SequenceGAAAGACAGTTGTATGTCCAATCATACAGCAGAAATTGGGAAAGATCTTGACTATCTTAA
AGATGTAAATGGAACTACAAGTGGTATAGGAACTGGCAGCAGTGTTGAAAAATACATTAT
TGATGAAAGTGATTACATGTCATTCATAAACAACCCCAGTCTTACTGTGACTGTACCAAT
TGCTGTAGGAGAATCTGACTTTGAAAATTTAAACACGGAAGACTTTAGTAGTGAATCGGA
TCTGGAAGAAAGCAAAGAGCATCAGGGTTGTAGTTATTAAGTGGTTATTGAATGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 29 To Exon 31 (Pair 1)
Forward (5179,21)CTGGTGACAGGTTTGACATCGAmplicon SizecDNA: 238 bpgenomic: 4,480
Reverse (5416,24)TACATGTACAGACTTTCTTCATACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.082 kcal/mol
Forward Dimers-0.221 kcal/mol
Reverse Loops1.064 kcal/mol
Reverse Dimers-2.91 kcal/mol
Forward-Reverse Dimers-2.27 kcal/mol
Amplicon Folding0.082 kcal/mol inside primersite
Amplicon SequenceCTGGTGACAGGTTTGACATCGAAGACGTGAATAATCATACTGATTGCCTAAAACTAATAG
AAAGAAATGAGACTGCTCGATGGAAAAATGTGAAAGTAAACTTTGATAATGTAGGATTTG
GGTATCTCTCTTTGCTTCAAGTTGCCACATTCAAAGGATGGATGGATATAATGTATGCAG
CAGTTGATTCCAGAAATGTGGAACTCCAGCCTAAGTATGAAGAAAGTCTGTACATGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001165963 (SCN1A)2384160 - 4397
NM_001202435 (SCN1A)2384369 - 4606
NM_001165964 (SCN1A)2384076 - 4313
NM_006920 (SCN1A)2384127 - 4364
Exon 31 To Exon 33 (Pair 1)
Forward (5478,24)GTCATCATAGATAATTTCAACCAGAmplicon SizecDNA: 239 bpgenomic: 3,755
Reverse (5716,23)ACCATCATTGTGACCATGTTAAGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.396 kcal/mol
Reverse Loops1.586 kcal/mol
Reverse Dimers-0.123 kcal/mol
Forward-Reverse Dimers-0.796 kcal/mol
Amplicon Folding-0.081 kcal/mol outside primersite
Amplicon SequenceGTCATCATAGATAATTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTTATG
ACAGAAGAACAGAAGAAATACTATAATGCAATGAAAAAATTAGGATCGAAAAAACCGCAA
AAGCCTATACCTCGACCAGGAAACAAATTTCAAGGAATGGTCTTTGACTTCGTAACCAGA
CAAGTTTTTGACATAAGCATCATGATTCTCATCTGTCTTAACATGGTCACAATGATGGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001165964 (SCN1A)2394375 - 4613
NM_001040142 (SCN2A)2394701 - 4939
NM_021007 (SCN2A)2394767 - 5005
NM_006920 (SCN1A)2394426 - 4664
NM_001202435 (SCN1A)2394668 - 4906
NM_001165963 (SCN1A)2394459 - 4697
NM_001040143 (SCN2A)2394462 - 4700
Exon 31 To Exon 33 (Pair 2)
Forward (5478,24)GTCATCATAGATAATTTCAACCAGAmplicon SizecDNA: 243 bpgenomic: 3,759
Reverse (5720,22)TTCCACCATCATTGTGACCATGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.396 kcal/mol
Reverse Loops1.258 kcal/mol
Reverse Dimers-0.626 kcal/mol
Forward-Reverse Dimers-0.796 kcal/mol
Amplicon Folding-0.081 kcal/mol outside primersite
Amplicon SequenceGTCATCATAGATAATTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTTATG
ACAGAAGAACAGAAGAAATACTATAATGCAATGAAAAAATTAGGATCGAAAAAACCGCAA
AAGCCTATACCTCGACCAGGAAACAAATTTCAAGGAATGGTCTTTGACTTCGTAACCAGA
CAAGTTTTTGACATAAGCATCATGATTCTCATCTGTCTTAACATGGTCACAATGATGGTG
GAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2434462 - 4704
NM_001165963 (SCN1A)2434459 - 4701
NM_001202435 (SCN1A)2434668 - 4910
NM_006920 (SCN1A)2434426 - 4668
NM_021007 (SCN2A)2434767 - 5009
NM_001081677 (SCN3A)2434741 - 4983
NM_006922 (SCN3A)2434888 - 5130
NM_001040142 (SCN2A)2434701 - 4943
NM_001165964 (SCN1A)2434375 - 4617
NM_001081676 (SCN3A)2434741 - 4983
Exon 31 To Exon 33 (Pair 3)
Forward (5478,24)GTCATCATAGATAATTTCAACCAGAmplicon SizecDNA: 240 bpgenomic: 3,756
Reverse (5717,23)CACCATCATTGTGACCATGTTAANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.396 kcal/mol
Reverse Loops1.469 kcal/mol
Reverse Dimers-0.415 kcal/mol
Forward-Reverse Dimers-0.796 kcal/mol
Amplicon Folding-0.081 kcal/mol outside primersite
Amplicon SequenceGTCATCATAGATAATTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTTATG
ACAGAAGAACAGAAGAAATACTATAATGCAATGAAAAAATTAGGATCGAAAAAACCGCAA
AAGCCTATACCTCGACCAGGAAACAAATTTCAAGGAATGGTCTTTGACTTCGTAACCAGA
CAAGTTTTTGACATAAGCATCATGATTCTCATCTGTCTTAACATGGTCACAATGATGGTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001165964 (SCN1A)2404375 - 4614
NM_001081676 (SCN3A)2404741 - 4980
NM_001040142 (SCN2A)2404701 - 4940
NM_006922 (SCN3A)2404888 - 5127
NM_001081677 (SCN3A)2404741 - 4980
NM_021007 (SCN2A)2404767 - 5006
NM_006920 (SCN1A)2404426 - 4665
NM_001202435 (SCN1A)2404668 - 4907
NM_001165963 (SCN1A)2404459 - 4698
NM_001040143 (SCN2A)2404462 - 4701
Exon 31 To Exon 33 (Pair 4)
Forward (5478,24)GTCATCATAGATAATTTCAACCAGAmplicon SizecDNA: 241 bpgenomic: 3,757
Reverse (5718,22)CCACCATCATTGTGACCATGTTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.396 kcal/mol
Reverse Loops1.258 kcal/mol
Reverse Dimers-0.626 kcal/mol
Forward-Reverse Dimers-0.796 kcal/mol
Amplicon Folding-0.081 kcal/mol outside primersite
Amplicon SequenceGTCATCATAGATAATTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTTATG
ACAGAAGAACAGAAGAAATACTATAATGCAATGAAAAAATTAGGATCGAAAAAACCGCAA
AAGCCTATACCTCGACCAGGAAACAAATTTCAAGGAATGGTCTTTGACTTCGTAACCAGA
CAAGTTTTTGACATAAGCATCATGATTCTCATCTGTCTTAACATGGTCACAATGATGGTG
G
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2414462 - 4702
NM_001165963 (SCN1A)2414459 - 4699
NM_001202435 (SCN1A)2414668 - 4908
NM_006920 (SCN1A)2414426 - 4666
NM_021007 (SCN2A)2414767 - 5007
NM_001081677 (SCN3A)2414741 - 4981
NM_006922 (SCN3A)2414888 - 5128
NM_001040142 (SCN2A)2414701 - 4941
NM_001081676 (SCN3A)2414741 - 4981
NM_001165964 (SCN1A)2414375 - 4615
Exon 31 To Exon 33 (Pair 5)
Forward (5478,24)GTCATCATAGATAATTTCAACCAGAmplicon SizecDNA: 251 bpgenomic: 3,767
Reverse (5728,23)TCATCTGTTTCCACCATCATTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.396 kcal/mol
Reverse Loops2.272 kcal/mol
Reverse Dimers-0.002 kcal/mol
Forward-Reverse Dimers-1.536 kcal/mol
Amplicon Folding-0.081 kcal/mol outside primersite
Amplicon SequenceGTCATCATAGATAATTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTTATG
ACAGAAGAACAGAAGAAATACTATAATGCAATGAAAAAATTAGGATCGAAAAAACCGCAA
AAGCCTATACCTCGACCAGGAAACAAATTTCAAGGAATGGTCTTTGACTTCGTAACCAGA
CAAGTTTTTGACATAAGCATCATGATTCTCATCTGTCTTAACATGGTCACAATGATGGTG
GAAACAGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001202435 (SCN1A)2514668 - 4918
NM_001165963 (SCN1A)2514459 - 4709
NM_001165964 (SCN1A)2514375 - 4625
NM_006920 (SCN1A)2514426 - 4676
Exon 31 To Exon 33 (Pair 6)
Forward (5478,24)GTCATCATAGATAATTTCAACCAGAmplicon SizecDNA: 237 bpgenomic: 3,753
Reverse (5714,23)CATCATTGTGACCATGTTAAGACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.396 kcal/mol
Reverse Loops1.586 kcal/mol
Reverse Dimers-0.123 kcal/mol
Forward-Reverse Dimers-0.796 kcal/mol
Amplicon Folding-0.081 kcal/mol outside primersite
Amplicon SequenceGTCATCATAGATAATTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTTATG
ACAGAAGAACAGAAGAAATACTATAATGCAATGAAAAAATTAGGATCGAAAAAACCGCAA
AAGCCTATACCTCGACCAGGAAACAAATTTCAAGGAATGGTCTTTGACTTCGTAACCAGA
CAAGTTTTTGACATAAGCATCATGATTCTCATCTGTCTTAACATGGTCACAATGATG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2374462 - 4698
NM_001165963 (SCN1A)2374459 - 4695
NM_001202435 (SCN1A)2374668 - 4904
NM_021007 (SCN2A)2374767 - 5003
NM_006920 (SCN1A)2374426 - 4662
NM_001040142 (SCN2A)2374701 - 4937
NM_001165964 (SCN1A)2374375 - 4611
Exon 31 To Exon 33 (Pair 7)
Forward (5478,24)GTCATCATAGATAATTTCAACCAGAmplicon SizecDNA: 226 bpgenomic: 3,742
Reverse (5703,23)CCATGTTAAGACAGATGAGAATCNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.396 kcal/mol
Reverse Loops0.607 kcal/mol in 3' area
Reverse Dimers-0.802 kcal/mol
Forward-Reverse Dimers-1.771 kcal/mol
Amplicon Folding-0.081 kcal/mol outside primersite
Amplicon SequenceGTCATCATAGATAATTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTTATG
ACAGAAGAACAGAAGAAATACTATAATGCAATGAAAAAATTAGGATCGAAAAAACCGCAA
AAGCCTATACCTCGACCAGGAAACAAATTTCAAGGAATGGTCTTTGACTTCGTAACCAGA
CAAGTTTTTGACATAAGCATCATGATTCTCATCTGTCTTAACATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001202435 (SCN1A)2264668 - 4893
NM_001165963 (SCN1A)2264459 - 4684
NM_006920 (SCN1A)2264426 - 4651
NM_001165964 (SCN1A)2264375 - 4600
Exon 31 To Exon 33 (Pair 8)
Forward (5478,24)GTCATCATAGATAATTTCAACCAGAmplicon SizecDNA: 242 bpgenomic: 3,758
Reverse (5719,22)TCCACCATCATTGTGACCATGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.396 kcal/mol
Reverse Loops1.258 kcal/mol
Reverse Dimers-0.626 kcal/mol
Forward-Reverse Dimers-0.796 kcal/mol
Amplicon Folding-0.081 kcal/mol outside primersite
Amplicon SequenceGTCATCATAGATAATTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTTATG
ACAGAAGAACAGAAGAAATACTATAATGCAATGAAAAAATTAGGATCGAAAAAACCGCAA
AAGCCTATACCTCGACCAGGAAACAAATTTCAAGGAATGGTCTTTGACTTCGTAACCAGA
CAAGTTTTTGACATAAGCATCATGATTCTCATCTGTCTTAACATGGTCACAATGATGGTG
GA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_006920 (SCN1A)2424426 - 4667
NM_021007 (SCN2A)2424767 - 5008
NM_006922 (SCN3A)2424888 - 5129
NM_001081677 (SCN3A)2424741 - 4982
NM_001040142 (SCN2A)2424701 - 4942
NM_001165964 (SCN1A)2424375 - 4616
NM_001081676 (SCN3A)2424741 - 4982
NM_001040143 (SCN2A)2424462 - 4703
NM_001165963 (SCN1A)2424459 - 4700
NM_001202435 (SCN1A)2424668 - 4909
Exon 31 To Exon 33 (Pair 9)
Forward (5478,24)GTCATCATAGATAATTTCAACCAGAmplicon SizecDNA: 238 bpgenomic: 3,754
Reverse (5715,23)CCATCATTGTGACCATGTTAAGANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.523 kcal/mol
Forward Dimers-0.396 kcal/mol
Reverse Loops1.586 kcal/mol
Reverse Dimers-0.123 kcal/mol
Forward-Reverse Dimers-0.796 kcal/mol
Amplicon Folding-0.081 kcal/mol outside primersite
Amplicon SequenceGTCATCATAGATAATTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTTATG
ACAGAAGAACAGAAGAAATACTATAATGCAATGAAAAAATTAGGATCGAAAAAACCGCAA
AAGCCTATACCTCGACCAGGAAACAAATTTCAAGGAATGGTCTTTGACTTCGTAACCAGA
CAAGTTTTTGACATAAGCATCATGATTCTCATCTGTCTTAACATGGTCACAATGATGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001165964 (SCN1A)2384375 - 4612
NM_001040142 (SCN2A)2384701 - 4938
NM_021007 (SCN2A)2384767 - 5004
NM_006920 (SCN1A)2384426 - 4663
NM_001202435 (SCN1A)2384668 - 4905
NM_001165963 (SCN1A)2384459 - 4696
NM_001040143 (SCN2A)2384462 - 4699
 

See below for some more details.

Program Output:

Loading ...