Design Results for SCN1B

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 6 (Pair 1)
Forward (4956,20)TTTGGGAGGCAGAGGTGGGAAmplicon SizecDNA: 215 bpgenomic: 1,987
Reverse (5170,19)GGACGCCCGTGCAGTTCTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.8 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.081 kcal/mol
Reverse Dimers-1.591 kcal/mol
Forward-Reverse Dimers-2.298 kcal/mol
Amplicon Folding-1.418 kcal/mol outside primersite
Amplicon SequenceTTTGGGAGGCAGAGGTGGGACCAACAGAGACATGGCATCCATCGTGTCTGAGATCATGAT
GTATGTGCTCATTGTGGTGTTGACCATATGGCTCGTGGCAGAGATGATTTACTGCTACAA
GAAGATCGCTGCCGCCACGGAGACTGCTGCACAGGAGAATGCCTCGGAATACCTGGCCAT
CACCTCTGAAAGCAAAGAGAACTGCACGGGCGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 6 (Pair 2)
Forward (4954,20)ACTTTGGGAGGCAGAGGTGGAmplicon SizecDNA: 216 bpgenomic: 1,988
Reverse (5169,20)GACGCCCGTGCAGTTCTCTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.662 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops1.081 kcal/mol
Reverse Dimers-1.591 kcal/mol
Forward-Reverse Dimers-2.298 kcal/mol
Amplicon Folding-1.418 kcal/mol outside primersite
Amplicon SequenceACTTTGGGAGGCAGAGGTGGGACCAACAGAGACATGGCATCCATCGTGTCTGAGATCATG
ATGTATGTGCTCATTGTGGTGTTGACCATATGGCTCGTGGCAGAGATGATTTACTGCTAC
AAGAAGATCGCTGCCGCCACGGAGACTGCTGCACAGGAGAATGCCTCGGAATACCTGGCC
ATCACCTCTGAAAGCAAAGAGAACTGCACGGGCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 6 (Pair 3)
Forward (4954,20)ACTTTGGGAGGCAGAGGTGGAmplicon SizecDNA: 217 bpgenomic: 1,989
Reverse (5170,19)GGACGCCCGTGCAGTTCTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.662 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops1.081 kcal/mol
Reverse Dimers-1.591 kcal/mol
Forward-Reverse Dimers-2.298 kcal/mol
Amplicon Folding-1.418 kcal/mol outside primersite
Amplicon SequenceACTTTGGGAGGCAGAGGTGGGACCAACAGAGACATGGCATCCATCGTGTCTGAGATCATG
ATGTATGTGCTCATTGTGGTGTTGACCATATGGCTCGTGGCAGAGATGATTTACTGCTAC
AAGAAGATCGCTGCCGCCACGGAGACTGCTGCACAGGAGAATGCCTCGGAATACCTGGCC
ATCACCTCTGAAAGCAAAGAGAACTGCACGGGCGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 6 (Pair 4)
Forward (4953,20)CACTTTGGGAGGCAGAGGTGAmplicon SizecDNA: 218 bpgenomic: 1,990
Reverse (5170,19)GGACGCCCGTGCAGTTCTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.662 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops1.081 kcal/mol
Reverse Dimers-1.591 kcal/mol
Forward-Reverse Dimers-2.298 kcal/mol
Amplicon Folding-1.418 kcal/mol outside primersite
Amplicon SequenceCACTTTGGGAGGCAGAGGTGGGACCAACAGAGACATGGCATCCATCGTGTCTGAGATCAT
GATGTATGTGCTCATTGTGGTGTTGACCATATGGCTCGTGGCAGAGATGATTTACTGCTA
CAAGAAGATCGCTGCCGCCACGGAGACTGCTGCACAGGAGAATGCCTCGGAATACCTGGC
CATCACCTCTGAAAGCAAAGAGAACTGCACGGGCGTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 6 (Pair 5)
Forward (4956,20)TTTGGGAGGCAGAGGTGGGAAmplicon SizecDNA: 214 bpgenomic: 1,986
Reverse (5169,20)GACGCCCGTGCAGTTCTCTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.8 kcal/mol
Forward Dimers-0.512 kcal/mol
Reverse Loops1.081 kcal/mol
Reverse Dimers-1.591 kcal/mol
Forward-Reverse Dimers-2.298 kcal/mol
Amplicon Folding-1.418 kcal/mol outside primersite
Amplicon SequenceTTTGGGAGGCAGAGGTGGGACCAACAGAGACATGGCATCCATCGTGTCTGAGATCATGAT
GTATGTGCTCATTGTGGTGTTGACCATATGGCTCGTGGCAGAGATGATTTACTGCTACAA
GAAGATCGCTGCCGCCACGGAGACTGCTGCACAGGAGAATGCCTCGGAATACCTGGCCAT
CACCTCTGAAAGCAAAGAGAACTGCACGGGCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 4 To Exon 6 (Pair 6)
Forward (4953,20)CACTTTGGGAGGCAGAGGTGAmplicon SizecDNA: 217 bpgenomic: 1,989
Reverse (5169,20)GACGCCCGTGCAGTTCTCTTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.662 kcal/mol
Forward Dimers-0.646 kcal/mol
Reverse Loops1.081 kcal/mol
Reverse Dimers-1.591 kcal/mol
Forward-Reverse Dimers-2.298 kcal/mol
Amplicon Folding-1.418 kcal/mol outside primersite
Amplicon SequenceCACTTTGGGAGGCAGAGGTGGGACCAACAGAGACATGGCATCCATCGTGTCTGAGATCAT
GATGTATGTGCTCATTGTGGTGTTGACCATATGGCTCGTGGCAGAGATGATTTACTGCTA
CAAGAAGATCGCTGCCGCCACGGAGACTGCTGCACAGGAGAATGCCTCGGAATACCTGGC
CATCACCTCTGAAAGCAAAGAGAACTGCACGGGCGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
 

See below for some more details.

Program Output:

Loading ...