Design Results for SCN2A

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 16 To Exon 17 (Pair 1)
Forward (2899,23)ATTTGGGACTGTTGTAAACCATGAmplicon SizecDNA: 213 bpgenomic: 10,940
Reverse (3111,23)GAGAAACATTTCTGCTGTGAAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.191 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.275 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTTGTAATG
GACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCT
ATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTC
TTCACAGGGATCTTCACAGCAGAAATGTTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2132263 - 2475
NM_021007 (SCN2A)2132568 - 2780
NM_001040142 (SCN2A)2132502 - 2714
Exon 16 To Exon 17 (Pair 2)
Forward (3012,21)CATGGCTATGGAGCACTATCCAmplicon SizecDNA: 204 bpgenomic: 10,931
Reverse (3215,23)ACATTTGCCAAACCAAGTTCCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-2.671 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAA
CCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCC
ATATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTT
AATGGAACTTGGTTTGGCAAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2042615 - 2818
NM_001040143 (SCN2A)2042376 - 2579
NM_021007 (SCN2A)2042681 - 2884
Exon 16 To Exon 17 (Pair 3)
Forward (2885,24)CTAATATGTGTTTGATTTGGGACTAmplicon SizecDNA: 230 bpgenomic: 10,957
Reverse (3114,23)CTTGAGAAACATTTCTGCTGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.408 kcal/mol
Forward Dimers-0.326 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.933 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceCTAATATGTGTTTGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCA
ACCTGGTTGTAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATA
CACTCTTCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTG
TTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2302488 - 2717
NM_021007 (SCN2A)2302554 - 2783
NM_001040143 (SCN2A)2302249 - 2478
Exon 16 To Exon 17 (Pair 4)
Forward (3024,20)GCACTATCCCATGACGGAGCAmplicon SizecDNA: 192 bpgenomic: 10,919
Reverse (3215,23)ACATTTGCCAAACCAAGTTCCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.724 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCAC
AGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTT
TCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGG
TTTGGCAAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1922627 - 2818
NM_001040143 (SCN2A)1922388 - 2579
NM_021007 (SCN2A)1922693 - 2884
Exon 16 To Exon 17 (Pair 5)
Forward (2980,24)ATCACCATCTGCATTGTCTTAAATAmplicon SizecDNA: 255 bpgenomic: 10,982
Reverse (3234,22)GAGAACTGACAATCCTTCCACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-2.76 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGACG
GAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCA
GAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAAT
ATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAA
GGATTGTCAGTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2552583 - 2837
NM_001040143 (SCN2A)2552344 - 2598
NM_021007 (SCN2A)2552649 - 2903
Exon 16 To Exon 17 (Pair 6)
Forward (2979,23)CATCACCATCTGCATTGTCTTAAAmplicon SizecDNA: 139 bpgenomic: 10,866
Reverse (3117,24)TATCTTGAGAAACATTTCTGCTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.013 kcal/mol
Amplicon Folding-0.002 kcal/mol outside primersite
Amplicon SequenceCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGAC
GGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGC
AGAAATGTTTCTCAAGATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1392582 - 2720
NM_001040143 (SCN2A)1392343 - 2481
NM_021007 (SCN2A)1392648 - 2786
Exon 16 To Exon 17 (Pair 7)
Forward (3012,21)CATGGCTATGGAGCACTATCCAmplicon SizecDNA: 92 bpgenomic: 10,819
Reverse (3103,22)TTTCTGCTGTGAAGATCCCTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-2.387 kcal/mol
Amplicon Folding0.159 kcal/mol inside primersite
Amplicon SequenceCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAA
CCTGGTCTTCACAGGGATCTTCACAGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)922615 - 2706
NM_001040143 (SCN2A)922376 - 2467
NM_021007 (SCN2A)922681 - 2772
Exon 16 To Exon 17 (Pair 8)
Forward (2979,23)CATCACCATCTGCATTGTCTTAAAmplicon SizecDNA: 249 bpgenomic: 10,976
Reverse (3227,22)GACAATCCTTCCACATTTGCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.443 kcal/mol
Forward-Reverse Dimers-2.76 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGAC
GGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGC
AGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAA
TATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGA
AGGATTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2492343 - 2591
NM_021007 (SCN2A)2492648 - 2896
NM_001040142 (SCN2A)2492582 - 2830
Exon 16 To Exon 17 (Pair 9)
Forward (2978,22)CCATCACCATCTGCATTGTCTTAmplicon SizecDNA: 126 bpgenomic: 10,853
Reverse (3103,22)TTTCTGCTGTGAAGATCCCTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-0.002 kcal/mol outside primersite
Amplicon SequenceCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGA
CGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAG
CAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1262581 - 2706
NM_001040143 (SCN2A)1262342 - 2467
NM_021007 (SCN2A)1262647 - 2772
Exon 16 To Exon 17 (Pair 10)
Forward (3012,21)CATGGCTATGGAGCACTATCCAmplicon SizecDNA: 95 bpgenomic: 10,822
Reverse (3106,22)ACATTTCTGCTGTGAAGATCCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-2.387 kcal/mol
Amplicon Folding0.159 kcal/mol inside primersite
Amplicon SequenceCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAA
CCTGGTCTTCACAGGGATCTTCACAGCAGAAATGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_006920 (SCN1A)952337 - 2431
NM_001040142 (SCN2A)952615 - 2709
NM_001040143 (SCN2A)952376 - 2470
NM_001165963 (SCN1A)952370 - 2464
NM_001165964 (SCN1A)952286 - 2380
NM_021007 (SCN2A)952681 - 2775
NM_001202435 (SCN1A)952579 - 2673
Exon 16 To Exon 17 (Pair 11)
Forward (2979,23)CATCACCATCTGCATTGTCTTAAAmplicon SizecDNA: 266 bpgenomic: 10,993
Reverse (3244,22)GGAATGATCGGAGAACTGACAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.535 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-1.86 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGAC
GGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGC
AGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAA
TATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGA
AGGATTGTCAGTTCTCCGATCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2662343 - 2608
NM_021007 (SCN2A)2662648 - 2913
NM_001040142 (SCN2A)2662582 - 2847
Exon 16 To Exon 17 (Pair 12)
Forward (2955,22)AATGGACCCATTTGTTGACCTGAmplicon SizecDNA: 158 bpgenomic: 10,885
Reverse (3112,23)TGAGAAACATTTCTGCTGTGAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.798 kcal/mol
Forward Dimers-2.611 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.346 kcal/mol
Amplicon Folding-0.002 kcal/mol outside primersite
Amplicon SequenceAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCAT
GGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCT
GGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001165964 (SCN1A)1552230 - 2384
NM_001040143 (SCN2A)1582319 - 2476
NM_001165963 (SCN1A)1552314 - 2468
NM_001202435 (SCN1A)1552523 - 2677
NM_021007 (SCN2A)1582624 - 2781
NM_006920 (SCN1A)1552281 - 2435
NM_001040142 (SCN2A)1582558 - 2715
Exon 16 To Exon 17 (Pair 13)
Forward (2951,23)TTGTAATGGACCCATTTGTTGACAmplicon SizecDNA: 151 bpgenomic: 10,878
Reverse (3101,21)TCTGCTGTGAAGATCCCTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.664 kcal/mol
Forward Dimers-2.879 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-0.819 kcal/mol
Amplicon Folding-0.002 kcal/mol outside primersite
Amplicon SequenceTTGTAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCT
TCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAA
ACCTGGTCTTCACAGGGATCTTCACAGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1512554 - 2704
NM_001040143 (SCN2A)1512315 - 2465
NM_021007 (SCN2A)1512620 - 2770
Exon 16 To Exon 17 (Pair 14)
Forward (3051,22)CAGTGTACTGTCTGTTGGAAACAmplicon SizecDNA: 184 bpgenomic: 10,911
Reverse (3234,22)GAGAACTGACAATCCTTCCACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol in 3' area
Forward Dimers-0.8 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-2.423 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCT
CAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGG
TTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAAGGATTGTCAGT
TCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1842415 - 2598
NM_021007 (SCN2A)1842720 - 2903
NM_001040142 (SCN2A)1842654 - 2837
Exon 16 To Exon 17 (Pair 15)
Forward (3014,21)TGGCTATGGAGCACTATCCCAAmplicon SizecDNA: 99 bpgenomic: 10,826
Reverse (3112,23)TGAGAAACATTTCTGCTGTGAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-2.387 kcal/mol
Amplicon Folding0.128 kcal/mol inside primersite
Amplicon SequenceTGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACC
TGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)992683 - 2781
NM_001040143 (SCN2A)992378 - 2476
NM_001040142 (SCN2A)992617 - 2715
Exon 16 To Exon 17 (Pair 16)
Forward (2887,24)AATATGTGTTTGATTTGGGACTGTAmplicon SizecDNA: 231 bpgenomic: 10,958
Reverse (3117,24)TATCTTGAGAAACATTTCTGCTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.542 kcal/mol
Forward Dimers-0.326 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.933 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceAATATGTGTTTGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAAC
CTGGTTGTAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACA
CTCTTCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTT
GGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2312490 - 2720
NM_001040143 (SCN2A)2312251 - 2481
NM_021007 (SCN2A)2312556 - 2786
Exon 16 To Exon 17 (Pair 17)
Forward (2898,23)GATTTGGGACTGTTGTAAACCATAmplicon SizecDNA: 214 bpgenomic: 10,941
Reverse (3111,23)GAGAAACATTTCTGCTGTGAAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.191 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.275 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTTGTAAT
GGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGC
TATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGT
CTTCACAGGGATCTTCACAGCAGAAATGTTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2142262 - 2475
NM_021007 (SCN2A)2142567 - 2780
NM_001040142 (SCN2A)2142501 - 2714
Exon 16 To Exon 17 (Pair 18)
Forward (2953,22)GTAATGGACCCATTTGTTGACCAmplicon SizecDNA: 292 bpgenomic: 11,019
Reverse (3244,22)GGAATGATCGGAGAACTGACAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.664 kcal/mol
Forward Dimers-2.879 kcal/mol
Reverse Loops0.535 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-1.805 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceGTAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTC
ATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAAC
CTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCA
TATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTA
ATGGAACTTGGTTTGGCAAATGTGGAAGGATTGTCAGTTCTCCGATCATTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2922622 - 2913
NM_001040143 (SCN2A)2922317 - 2608
NM_001040142 (SCN2A)2922556 - 2847
Exon 16 To Exon 17 (Pair 19)
Forward (3024,20)GCACTATCCCATGACGGAGCAmplicon SizecDNA: 190 bpgenomic: 10,917
Reverse (3213,24)ATTTGCCAAACCAAGTTCCATTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.724 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCAC
AGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTT
TCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGG
TTTGGCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)1902693 - 2882
NM_001040143 (SCN2A)1902388 - 2577
NM_001040142 (SCN2A)1902627 - 2816
Exon 16 To Exon 17 (Pair 20)
Forward (2978,22)CCATCACCATCTGCATTGTCTTAmplicon SizecDNA: 236 bpgenomic: 10,963
Reverse (3213,24)ATTTGCCAAACCAAGTTCCATTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-0.998 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGA
CGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAG
CAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGA
ATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2362647 - 2882
NM_001040143 (SCN2A)2362342 - 2577
NM_001040142 (SCN2A)2362581 - 2816
Exon 16 To Exon 17 (Pair 21)
Forward (2957,21)TGGACCCATTTGTTGACCTGGAmplicon SizecDNA: 277 bpgenomic: 11,004
Reverse (3233,23)AGAACTGACAATCCTTCCACATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.387 kcal/mol
Forward Dimers-0.805 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.136 kcal/mol
Forward-Reverse Dimers-1.476 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceTGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGG
CTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGG
TCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATT
ATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGG
AACTTGGTTTGGCAAATGTGGAAGGATTGTCAGTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2772626 - 2902
NM_001040143 (SCN2A)2772321 - 2597
NM_001040142 (SCN2A)2772560 - 2836
Exon 16 To Exon 17 (Pair 22)
Forward (2955,22)AATGGACCCATTTGTTGACCTGAmplicon SizecDNA: 282 bpgenomic: 11,009
Reverse (3236,21)CGGAGAACTGACAATCCTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.798 kcal/mol
Forward Dimers-2.611 kcal/mol
Reverse Loops1.857 kcal/mol in 3' area
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-1.476 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCAT
GGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCT
GGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATA
TTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAAT
GGAACTTGGTTTGGCAAATGTGGAAGGATTGTCAGTTCTCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2822319 - 2600
NM_021007 (SCN2A)2822624 - 2905
NM_001040142 (SCN2A)2822558 - 2839
Exon 16 To Exon 17 (Pair 23)
Forward (3046,22)TTCAGCAGTGTACTGTCTGTTGAmplicon SizecDNA: 168 bpgenomic: 10,895
Reverse (3213,24)ATTTGCCAAACCAAGTTCCATTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.862 kcal/mol
Forward Dimers-1.752 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.435 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATG
TTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAATATTTTT
GATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1682649 - 2816
NM_021007 (SCN2A)1682715 - 2882
NM_001040143 (SCN2A)1682410 - 2577
Exon 16 To Exon 17 (Pair 24)
Forward (2955,22)AATGGACCCATTTGTTGACCTGAmplicon SizecDNA: 160 bpgenomic: 10,887
Reverse (3114,23)CTTGAGAAACATTTCTGCTGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.798 kcal/mol
Forward Dimers-2.611 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.346 kcal/mol
Amplicon Folding-0.002 kcal/mol outside primersite
Amplicon SequenceAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCAT
GGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCT
GGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1602319 - 2478
NM_001165963 (SCN1A)1582314 - 2471
NM_001165964 (SCN1A)1582230 - 2387
NM_021007 (SCN2A)1602624 - 2783
NM_001202435 (SCN1A)1582523 - 2680
NM_006920 (SCN1A)1582281 - 2438
NM_001040142 (SCN2A)1602558 - 2717
Exon 16 To Exon 17 (Pair 25)
Forward (2893,24)TGTTTGATTTGGGACTGTTGTAAAAmplicon SizecDNA: 223 bpgenomic: 10,950
Reverse (3115,23)TCTTGAGAAACATTTCTGCTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.191 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.742 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceTGTTTGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTT
GTAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTC
ATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAAC
CTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2232562 - 2784
NM_001040143 (SCN2A)2232257 - 2479
NM_001040142 (SCN2A)2232496 - 2718
Exon 16 To Exon 17 (Pair 26)
Forward (2957,21)TGGACCCATTTGTTGACCTGGAmplicon SizecDNA: 254 bpgenomic: 10,981
Reverse (3210,23)TGCCAAACCAAGTTCCATTAAACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.387 kcal/mol
Forward Dimers-0.805 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.381 kcal/mol
Forward-Reverse Dimers-1.666 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceTGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGG
CTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGG
TCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATT
ATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGG
AACTTGGTTTGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2542560 - 2813
NM_021007 (SCN2A)2542626 - 2879
NM_001040143 (SCN2A)2542321 - 2574
Exon 16 To Exon 17 (Pair 27)
Forward (3026,21)ACTATCCCATGACGGAGCAGTAmplicon SizecDNA: 190 bpgenomic: 10,917
Reverse (3215,23)ACATTTGCCAAACCAAGTTCCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol
Forward Dimers-1.63 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAG
GGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTC
AAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTT
TGGCAAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)1902695 - 2884
NM_001040143 (SCN2A)1902390 - 2579
NM_001040142 (SCN2A)1902629 - 2818
Exon 16 To Exon 17 (Pair 28)
Forward (3012,21)CATGGCTATGGAGCACTATCCAmplicon SizecDNA: 202 bpgenomic: 10,929
Reverse (3213,24)ATTTGCCAAACCAAGTTCCATTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-2.671 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAA
CCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCC
ATATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTT
AATGGAACTTGGTTTGGCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2022615 - 2816
NM_021007 (SCN2A)2022681 - 2882
NM_001040143 (SCN2A)2022376 - 2577
Exon 16 To Exon 17 (Pair 29)
Forward (3015,21)GGCTATGGAGCACTATCCCATAmplicon SizecDNA: 201 bpgenomic: 10,928
Reverse (3215,23)ACATTTGCCAAACCAAGTTCCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCT
GGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATA
TTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAAT
GGAACTTGGTTTGGCAAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2012618 - 2818
NM_001040143 (SCN2A)2012379 - 2579
NM_021007 (SCN2A)2012684 - 2884
Exon 16 To Exon 17 (Pair 30)
Forward (3037,21)ACGGAGCAGTTCAGCAGTGTAAmplicon SizecDNA: 174 bpgenomic: 10,901
Reverse (3210,23)TGCCAAACCAAGTTCCATTAAACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.045 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.381 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACA
GCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGG
AATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1742640 - 2813
NM_001040143 (SCN2A)1742401 - 2574
NM_021007 (SCN2A)1742706 - 2879
Exon 16 To Exon 17 (Pair 31)
Forward (2957,21)TGGACCCATTTGTTGACCTGGAmplicon SizecDNA: 278 bpgenomic: 11,005
Reverse (3234,22)GAGAACTGACAATCCTTCCACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.387 kcal/mol
Forward Dimers-0.805 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-1.476 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceTGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGG
CTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGG
TCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATT
ATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGG
AACTTGGTTTGGCAAATGTGGAAGGATTGTCAGTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2782560 - 2837
NM_021007 (SCN2A)2782626 - 2903
NM_001040143 (SCN2A)2782321 - 2598
Exon 16 To Exon 17 (Pair 32)
Forward (3046,22)TTCAGCAGTGTACTGTCTGTTGAmplicon SizecDNA: 191 bpgenomic: 10,918
Reverse (3236,21)CGGAGAACTGACAATCCTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.862 kcal/mol
Forward Dimers-1.752 kcal/mol
Reverse Loops1.857 kcal/mol in 3' area
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-2.66 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATG
TTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAATATTTTT
GATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAAGGATTG
TCAGTTCTCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)1912715 - 2905
NM_001040143 (SCN2A)1912410 - 2600
NM_001040142 (SCN2A)1912649 - 2839
Exon 16 To Exon 17 (Pair 33)
Forward (3039,21)GGAGCAGTTCAGCAGTGTACTAmplicon SizecDNA: 178 bpgenomic: 10,905
Reverse (3216,22)CACATTTGCCAAACCAAGTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.045 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.055 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGC
AGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAA
TATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1782403 - 2580
NM_021007 (SCN2A)1782708 - 2885
NM_001040142 (SCN2A)1782642 - 2819
Exon 16 To Exon 17 (Pair 34)
Forward (3051,22)CAGTGTACTGTCTGTTGGAAACAmplicon SizecDNA: 188 bpgenomic: 10,915
Reverse (3238,22)ATCGGAGAACTGACAATCCTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.055 kcal/mol in 3' area
Forward Dimers-0.8 kcal/mol
Reverse Loops0.535 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-2.423 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCT
CAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGG
TTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAAGGATTGTCAGT
TCTCCGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1882415 - 2602
NM_021007 (SCN2A)1882720 - 2907
NM_001040142 (SCN2A)1882654 - 2841
Exon 16 To Exon 17 (Pair 35)
Forward (3026,21)ACTATCCCATGACGGAGCAGTAmplicon SizecDNA: 202 bpgenomic: 10,929
Reverse (3227,22)GACAATCCTTCCACATTTGCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol
Forward Dimers-1.63 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.443 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAG
GGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTC
AAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTT
TGGCAAATGTGGAAGGATTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2022629 - 2830
NM_001040143 (SCN2A)2022390 - 2591
NM_021007 (SCN2A)2022695 - 2896
Exon 16 To Exon 17 (Pair 36)
Forward (3031,20)CCCATGACGGAGCAGTTCAGAmplicon SizecDNA: 189 bpgenomic: 10,916
Reverse (3219,23)TTCCACATTTGCCAAACCAAGTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol
Forward Dimers-1.63 kcal/mol
Reverse Loops1.724 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATC
TTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAA
GGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCA
AATGTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1892634 - 2822
NM_021007 (SCN2A)1892700 - 2888
NM_001040143 (SCN2A)1892395 - 2583
Exon 16 To Exon 17 (Pair 37)
Forward (3024,20)GCACTATCCCATGACGGAGCAmplicon SizecDNA: 187 bpgenomic: 10,914
Reverse (3210,23)TGCCAAACCAAGTTCCATTAAACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.381 kcal/mol
Forward-Reverse Dimers-1.724 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCAC
AGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTT
TCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGG
TTTGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1872627 - 2813
NM_001040143 (SCN2A)1872388 - 2574
NM_021007 (SCN2A)1872693 - 2879
Exon 16 To Exon 17 (Pair 38)
Forward (2957,21)TGGACCCATTTGTTGACCTGGAmplicon SizecDNA: 159 bpgenomic: 10,886
Reverse (3115,23)TCTTGAGAAACATTTCTGCTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.387 kcal/mol
Forward Dimers-0.805 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.346 kcal/mol
Amplicon Folding-0.002 kcal/mol outside primersite
Amplicon SequenceTGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGG
CTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGG
TCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_006920 (SCN1A)1572282 - 2438
NM_001040142 (SCN2A)1592560 - 2718
NM_001165963 (SCN1A)1572315 - 2471
NM_001040143 (SCN2A)1592321 - 2479
NM_001165964 (SCN1A)1572231 - 2387
NM_021007 (SCN2A)1592626 - 2784
NM_001202435 (SCN1A)1572524 - 2680
Exon 16 To Exon 17 (Pair 39)
Forward (2843,22)AAGAATCCAGACAGAAATGCCCAmplicon SizecDNA: 259 bpgenomic: 10,986
Reverse (3101,21)TCTGCTGTGAAGATCCCTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.579 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-2.072 kcal/mol outside primersite
Amplicon SequenceAAGAATCCAGACAGAAATGCCCACCATGCTGGTATAAATTTGCTAATATGTGTTTGATTT
GGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTTGTAATGGACC
CATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGG
AGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCA
CAGGGATCTTCACAGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2592512 - 2770
NM_001040143 (SCN2A)2592207 - 2465
NM_001040142 (SCN2A)2592446 - 2704
Exon 16 To Exon 17 (Pair 40)
Forward (3024,20)GCACTATCCCATGACGGAGCAmplicon SizecDNA: 211 bpgenomic: 10,938
Reverse (3234,22)GAGAACTGACAATCCTTCCACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-1.131 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCAC
AGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTT
TCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGG
TTTGGCAAATGTGGAAGGATTGTCAGTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2112388 - 2598
NM_021007 (SCN2A)2112693 - 2903
NM_001040142 (SCN2A)2112627 - 2837
Exon 16 To Exon 17 (Pair 41)
Forward (2897,23)TGATTTGGGACTGTTGTAAACCAAmplicon SizecDNA: 215 bpgenomic: 10,942
Reverse (3111,23)GAGAAACATTTCTGCTGTGAAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.191 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.275 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceTGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTTGTAA
TGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGG
CTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGG
TCTTCACAGGGATCTTCACAGCAGAAATGTTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2152500 - 2714
NM_021007 (SCN2A)2152566 - 2780
NM_001040143 (SCN2A)2152261 - 2475
Exon 16 To Exon 17 (Pair 42)
Forward (2980,24)ATCACCATCTGCATTGTCTTAAATAmplicon SizecDNA: 124 bpgenomic: 10,851
Reverse (3103,22)TTTCTGCTGTGAAGATCCCTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-0.002 kcal/mol outside primersite
Amplicon SequenceATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGACG
GAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCA
GAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1242344 - 2467
NM_021007 (SCN2A)1242649 - 2772
NM_001040142 (SCN2A)1242583 - 2706
Exon 16 To Exon 17 (Pair 43)
Forward (3014,21)TGGCTATGGAGCACTATCCCAAmplicon SizecDNA: 207 bpgenomic: 10,934
Reverse (3220,22)CTTCCACATTTGCCAAACCAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-2.37 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACC
TGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCAT
ATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAA
TGGAACTTGGTTTGGCAAATGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2072683 - 2889
NM_001040143 (SCN2A)2072378 - 2584
NM_001040142 (SCN2A)2072617 - 2823
Exon 16 To Exon 17 (Pair 44)
Forward (2980,24)ATCACCATCTGCATTGTCTTAAATAmplicon SizecDNA: 248 bpgenomic: 10,975
Reverse (3227,22)GACAATCCTTCCACATTTGCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.443 kcal/mol
Forward-Reverse Dimers-2.76 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGACG
GAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCA
GAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAAT
ATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAA
GGATTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2482649 - 2896
NM_001040143 (SCN2A)2482344 - 2591
NM_001040142 (SCN2A)2482583 - 2830
Exon 16 To Exon 17 (Pair 45)
Forward (2979,23)CATCACCATCTGCATTGTCTTAAAmplicon SizecDNA: 260 bpgenomic: 10,987
Reverse (3238,22)ATCGGAGAACTGACAATCCTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.535 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-2.76 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGAC
GGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGC
AGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAA
TATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGA
AGGATTGTCAGTTCTCCGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2602648 - 2907
NM_001040143 (SCN2A)2602343 - 2602
NM_001040142 (SCN2A)2602582 - 2841
Exon 16 To Exon 17 (Pair 46)
Forward (2976,21)GGCCATCACCATCTGCATTGTAmplicon SizecDNA: 125 bpgenomic: 10,852
Reverse (3100,21)CTGCTGTGAAGATCCCTGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.668 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-1.915 kcal/mol
Amplicon Folding-0.002 kcal/mol outside primersite
Amplicon SequenceGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCAT
GACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCAC
AGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)1252645 - 2769
NM_001040143 (SCN2A)1252340 - 2464
NM_001040142 (SCN2A)1252579 - 2703
Exon 16 To Exon 17 (Pair 47)
Forward (3012,21)CATGGCTATGGAGCACTATCCAmplicon SizecDNA: 205 bpgenomic: 10,932
Reverse (3216,22)CACATTTGCCAAACCAAGTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-2.671 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAA
CCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCC
ATATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTT
AATGGAACTTGGTTTGGCAAATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2052681 - 2885
NM_001040143 (SCN2A)2052376 - 2580
NM_001040142 (SCN2A)2052615 - 2819
Exon 16 To Exon 17 (Pair 48)
Forward (3013,21)ATGGCTATGGAGCACTATCCCAmplicon SizecDNA: 227 bpgenomic: 10,954
Reverse (3239,22)GATCGGAGAACTGACAATCCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops0.535 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-1.131 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAAC
CTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCA
TATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTA
ATGGAACTTGGTTTGGCAAATGTGGAAGGATTGTCAGTTCTCCGATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2272682 - 2908
NM_001040143 (SCN2A)2272377 - 2603
NM_001040142 (SCN2A)2272616 - 2842
Exon 16 To Exon 17 (Pair 49)
Forward (2885,24)CTAATATGTGTTTGATTTGGGACTAmplicon SizecDNA: 231 bpgenomic: 10,958
Reverse (3115,23)TCTTGAGAAACATTTCTGCTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.408 kcal/mol
Forward Dimers-0.326 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.933 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceCTAATATGTGTTTGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCA
ACCTGGTTGTAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATA
CACTCTTCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTG
TTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2312488 - 2718
NM_021007 (SCN2A)2312554 - 2784
NM_001040143 (SCN2A)2312249 - 2479
Exon 16 To Exon 17 (Pair 50)
Forward (2840,23)TTGAAGAATCCAGACAGAAATGCAmplicon SizecDNA: 261 bpgenomic: 10,988
Reverse (3100,21)CTGCTGTGAAGATCCCTGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.579 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-2.072 kcal/mol outside primersite
Amplicon SequenceTTGAAGAATCCAGACAGAAATGCCCACCATGCTGGTATAAATTTGCTAATATGTGTTTGA
TTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTTGTAATGG
ACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTA
TGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCT
TCACAGGGATCTTCACAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2612443 - 2703
NM_001040143 (SCN2A)2612204 - 2464
NM_021007 (SCN2A)2612509 - 2769
Exon 16 To Exon 17 (Pair 51)
Forward (3045,22)GTTCAGCAGTGTACTGTCTGTTAmplicon SizecDNA: 171 bpgenomic: 10,898
Reverse (3215,23)ACATTTGCCAAACCAAGTTCCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.862 kcal/mol
Forward Dimers-1.752 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.435 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAAT
GTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAATATTTT
TGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1712648 - 2818
NM_001040143 (SCN2A)1712409 - 2579
NM_021007 (SCN2A)1712714 - 2884
Exon 16 To Exon 17 (Pair 52)
Forward (3029,21)ATCCCATGACGGAGCAGTTCAAmplicon SizecDNA: 192 bpgenomic: 10,919
Reverse (3220,22)CTTCCACATTTGCCAAACCAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol
Forward Dimers-1.63 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGA
TCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAG
AAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGG
CAAATGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1922393 - 2584
NM_021007 (SCN2A)1922698 - 2889
NM_001040142 (SCN2A)1922632 - 2823
Exon 16 To Exon 17 (Pair 53)
Forward (3027,21)CTATCCCATGACGGAGCAGTTAmplicon SizecDNA: 194 bpgenomic: 10,921
Reverse (3220,22)CTTCCACATTTGCCAAACCAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol
Forward Dimers-1.63 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceCTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGG
GATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCA
AGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTT
GGCAAATGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1942391 - 2584
NM_021007 (SCN2A)1942696 - 2889
NM_001040142 (SCN2A)1942630 - 2823
Exon 16 To Exon 17 (Pair 54)
Forward (3049,22)AGCAGTGTACTGTCTGTTGGAAAmplicon SizecDNA: 192 bpgenomic: 10,919
Reverse (3240,22)TGATCGGAGAACTGACAATCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.862 kcal/mol
Forward Dimers-1.752 kcal/mol
Reverse Loops0.535 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-2.66 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTT
CTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAATATTTTTGAT
GGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAAGGATTGTCA
GTTCTCCGATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1922413 - 2604
NM_021007 (SCN2A)1922718 - 2909
NM_001040142 (SCN2A)1922652 - 2843
Exon 16 To Exon 17 (Pair 55)
Forward (3013,21)ATGGCTATGGAGCACTATCCCAmplicon SizecDNA: 203 bpgenomic: 10,930
Reverse (3215,23)ACATTTGCCAAACCAAGTTCCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-2.671 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAAC
CTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCA
TATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTA
ATGGAACTTGGTTTGGCAAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2032616 - 2818
NM_021007 (SCN2A)2032682 - 2884
NM_001040143 (SCN2A)2032377 - 2579
Exon 16 To Exon 17 (Pair 56)
Forward (3028,21)TATCCCATGACGGAGCAGTTCAmplicon SizecDNA: 188 bpgenomic: 10,915
Reverse (3215,23)ACATTTGCCAAACCAAGTTCCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol
Forward Dimers-1.63 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGG
ATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAA
GAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTG
GCAAATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1882392 - 2579
NM_021007 (SCN2A)1882697 - 2884
NM_001040142 (SCN2A)1882631 - 2818
Exon 16 To Exon 17 (Pair 57)
Forward (3013,21)ATGGCTATGGAGCACTATCCCAmplicon SizecDNA: 201 bpgenomic: 10,928
Reverse (3213,24)ATTTGCCAAACCAAGTTCCATTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-2.671 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAAC
CTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCA
TATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTA
ATGGAACTTGGTTTGGCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2012616 - 2816
NM_021007 (SCN2A)2012682 - 2882
NM_001040143 (SCN2A)2012377 - 2577
Exon 16 To Exon 17 (Pair 58)
Forward (2886,24)TAATATGTGTTTGATTTGGGACTGAmplicon SizecDNA: 229 bpgenomic: 10,956
Reverse (3114,23)CTTGAGAAACATTTCTGCTGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.408 kcal/mol
Forward Dimers-0.326 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.933 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceTAATATGTGTTTGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAA
CCTGGTTGTAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATAC
ACTCTTCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGT
TGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2292489 - 2717
NM_021007 (SCN2A)2292555 - 2783
NM_001040143 (SCN2A)2292250 - 2478
Exon 16 To Exon 17 (Pair 59)
Forward (2882,24)TTGCTAATATGTGTTTGATTTGGGAmplicon SizecDNA: 230 bpgenomic: 10,957
Reverse (3111,23)GAGAAACATTTCTGCTGTGAAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.408 kcal/mol
Forward Dimers-0.326 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.933 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceTTGCTAATATGTGTTTGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTG
TCAACCTGGTTGTAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAA
ATACACTCTTCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGT
CTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2302246 - 2475
NM_021007 (SCN2A)2302551 - 2780
NM_001040142 (SCN2A)2302485 - 2714
Exon 16 To Exon 17 (Pair 60)
Forward (2843,22)AAGAATCCAGACAGAAATGCCCAmplicon SizecDNA: 256 bpgenomic: 10,983
Reverse (3098,21)GCTGTGAAGATCCCTGTGAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.579 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-2.072 kcal/mol outside primersite
Amplicon SequenceAAGAATCCAGACAGAAATGCCCACCATGCTGGTATAAATTTGCTAATATGTGTTTGATTT
GGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTTGTAATGGACC
CATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGG
AGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCA
CAGGGATCTTCACAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2562446 - 2701
NM_021007 (SCN2A)2562512 - 2767
NM_001040143 (SCN2A)2562207 - 2462
Exon 16 To Exon 17 (Pair 61)
Forward (2882,24)TTGCTAATATGTGTTTGATTTGGGAmplicon SizecDNA: 234 bpgenomic: 10,961
Reverse (3115,23)TCTTGAGAAACATTTCTGCTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.408 kcal/mol
Forward Dimers-0.326 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.933 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceTTGCTAATATGTGTTTGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTG
TCAACCTGGTTGTAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAA
ATACACTCTTCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGT
CTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2342485 - 2718
NM_001040143 (SCN2A)2342246 - 2479
NM_021007 (SCN2A)2342551 - 2784
Exon 16 To Exon 17 (Pair 62)
Forward (2899,23)ATTTGGGACTGTTGTAAACCATGAmplicon SizecDNA: 216 bpgenomic: 10,943
Reverse (3114,23)CTTGAGAAACATTTCTGCTGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.191 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.275 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTTGTAATG
GACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCT
ATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTC
TTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2162568 - 2783
NM_001040143 (SCN2A)2162263 - 2478
NM_001040142 (SCN2A)2162502 - 2717
Exon 16 To Exon 17 (Pair 63)
Forward (3014,21)TGGCTATGGAGCACTATCCCAAmplicon SizecDNA: 206 bpgenomic: 10,933
Reverse (3219,23)TTCCACATTTGCCAAACCAAGTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops1.724 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-2.37 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACC
TGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCAT
ATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAA
TGGAACTTGGTTTGGCAAATGTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2062617 - 2822
NM_021007 (SCN2A)2062683 - 2888
NM_001040143 (SCN2A)2062378 - 2583
Exon 16 To Exon 17 (Pair 64)
Forward (3046,22)TTCAGCAGTGTACTGTCTGTTGAmplicon SizecDNA: 193 bpgenomic: 10,920
Reverse (3238,22)ATCGGAGAACTGACAATCCTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.862 kcal/mol
Forward Dimers-1.752 kcal/mol
Reverse Loops0.535 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-2.66 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATG
TTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAATATTTTT
GATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAAGGATTG
TCAGTTCTCCGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1932649 - 2841
NM_001040143 (SCN2A)1932410 - 2602
NM_021007 (SCN2A)1932715 - 2907
Exon 16 To Exon 17 (Pair 65)
Forward (2957,21)TGGACCCATTTGTTGACCTGGAmplicon SizecDNA: 260 bpgenomic: 10,987
Reverse (3216,22)CACATTTGCCAAACCAAGTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.387 kcal/mol
Forward Dimers-0.805 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.666 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceTGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGG
CTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGG
TCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATT
ATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGG
AACTTGGTTTGGCAAATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2602560 - 2819
NM_021007 (SCN2A)2602626 - 2885
NM_001040143 (SCN2A)2602321 - 2580
Exon 16 To Exon 17 (Pair 66)
Forward (3024,20)GCACTATCCCATGACGGAGCAmplicon SizecDNA: 217 bpgenomic: 10,944
Reverse (3240,22)TGATCGGAGAACTGACAATCCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops0.535 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-1.131 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCAC
AGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTT
TCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGG
TTTGGCAAATGTGGAAGGATTGTCAGTTCTCCGATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2172627 - 2843
NM_001040143 (SCN2A)2172388 - 2604
NM_021007 (SCN2A)2172693 - 2909
Exon 16 To Exon 17 (Pair 67)
Forward (3014,21)TGGCTATGGAGCACTATCCCAAmplicon SizecDNA: 223 bpgenomic: 10,950
Reverse (3236,21)CGGAGAACTGACAATCCTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops1.857 kcal/mol in 3' area
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-1.131 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACC
TGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCAT
ATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAA
TGGAACTTGGTTTGGCAAATGTGGAAGGATTGTCAGTTCTCCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2232683 - 2905
NM_001040143 (SCN2A)2232378 - 2600
NM_001040142 (SCN2A)2232617 - 2839
Exon 16 To Exon 17 (Pair 68)
Forward (3045,22)GTTCAGCAGTGTACTGTCTGTTAmplicon SizecDNA: 190 bpgenomic: 10,917
Reverse (3234,22)GAGAACTGACAATCCTTCCACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.862 kcal/mol
Forward Dimers-1.752 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-2.66 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAAT
GTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAATATTTT
TGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAAGGATT
GTCAGTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1902648 - 2837
NM_021007 (SCN2A)1902714 - 2903
NM_001040143 (SCN2A)1902409 - 2598
Exon 16 To Exon 17 (Pair 69)
Forward (3012,21)CATGGCTATGGAGCACTATCCAmplicon SizecDNA: 90 bpgenomic: 10,817
Reverse (3101,21)TCTGCTGTGAAGATCCCTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-2.387 kcal/mol
Amplicon Folding0.159 kcal/mol inside primersite
Amplicon SequenceCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAA
CCTGGTCTTCACAGGGATCTTCACAGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)902615 - 2704
NM_021007 (SCN2A)902681 - 2770
NM_001040143 (SCN2A)902376 - 2465
Exon 16 To Exon 17 (Pair 70)
Forward (3028,21)TATCCCATGACGGAGCAGTTCAmplicon SizecDNA: 189 bpgenomic: 10,916
Reverse (3216,22)CACATTTGCCAAACCAAGTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol
Forward Dimers-1.63 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGG
ATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAA
GAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTG
GCAAATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1892631 - 2819
NM_001040143 (SCN2A)1892392 - 2580
NM_021007 (SCN2A)1892697 - 2885
Exon 16 To Exon 17 (Pair 71)
Forward (3024,20)GCACTATCCCATGACGGAGCAmplicon SizecDNA: 191 bpgenomic: 10,918
Reverse (3214,23)CATTTGCCAAACCAAGTTCCATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol in 3' area
Forward Dimers-1.63 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.724 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCAC
AGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTT
TCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGG
TTTGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1912388 - 2578
NM_021007 (SCN2A)1912693 - 2883
NM_001040142 (SCN2A)1912627 - 2817
Exon 16 To Exon 17 (Pair 72)
Forward (2898,23)GATTTGGGACTGTTGTAAACCATAmplicon SizecDNA: 217 bpgenomic: 10,944
Reverse (3114,23)CTTGAGAAACATTTCTGCTGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.191 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.275 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTTGTAAT
GGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGC
TATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGT
CTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2172262 - 2478
NM_021007 (SCN2A)2172567 - 2783
NM_001040142 (SCN2A)2172501 - 2717
Exon 16 To Exon 17 (Pair 73)
Forward (2980,24)ATCACCATCTGCATTGTCTTAAATAmplicon SizecDNA: 259 bpgenomic: 10,986
Reverse (3238,22)ATCGGAGAACTGACAATCCTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.535 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-2.76 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGACG
GAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCA
GAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAAT
ATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAA
GGATTGTCAGTTCTCCGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2592344 - 2602
NM_021007 (SCN2A)2592649 - 2907
NM_001040142 (SCN2A)2592583 - 2841
Exon 16 To Exon 17 (Pair 74)
Forward (2979,23)CATCACCATCTGCATTGTCTTAAAmplicon SizecDNA: 235 bpgenomic: 10,962
Reverse (3213,24)ATTTGCCAAACCAAGTTCCATTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-0.998 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGAC
GGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGC
AGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAA
TATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2352582 - 2816
NM_001040143 (SCN2A)2352343 - 2577
NM_021007 (SCN2A)2352648 - 2882
Exon 16 To Exon 17 (Pair 75)
Forward (3013,21)ATGGCTATGGAGCACTATCCCAmplicon SizecDNA: 207 bpgenomic: 10,934
Reverse (3219,23)TTCCACATTTGCCAAACCAAGTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops1.724 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-2.671 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAAC
CTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCA
TATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTA
ATGGAACTTGGTTTGGCAAATGTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2072377 - 2583
NM_021007 (SCN2A)2072682 - 2888
NM_001040142 (SCN2A)2072616 - 2822
Exon 16 To Exon 17 (Pair 76)
Forward (3015,21)GGCTATGGAGCACTATCCCATAmplicon SizecDNA: 90 bpgenomic: 10,817
Reverse (3104,22)ATTTCTGCTGTGAAGATCCCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-2.387 kcal/mol
Amplicon Folding0.159 kcal/mol inside primersite
Amplicon SequenceGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCT
GGTCTTCACAGGGATCTTCACAGCAGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)902618 - 2707
NM_021007 (SCN2A)902684 - 2773
NM_001040143 (SCN2A)902379 - 2468
Exon 16 To Exon 17 (Pair 77)
Forward (2980,24)ATCACCATCTGCATTGTCTTAAATAmplicon SizecDNA: 238 bpgenomic: 10,965
Reverse (3217,22)CCACATTTGCCAAACCAAGTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.23 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGACG
GAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCA
GAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAAT
ATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2382583 - 2820
NM_001040143 (SCN2A)2382344 - 2581
NM_021007 (SCN2A)2382649 - 2886
Exon 16 To Exon 17 (Pair 78)
Forward (2897,23)TGATTTGGGACTGTTGTAAACCAAmplicon SizecDNA: 218 bpgenomic: 10,945
Reverse (3114,23)CTTGAGAAACATTTCTGCTGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.191 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.275 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceTGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTTGTAA
TGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGG
CTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGG
TCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2182261 - 2478
NM_021007 (SCN2A)2182566 - 2783
NM_001040142 (SCN2A)2182500 - 2717
Exon 16 To Exon 17 (Pair 79)
Forward (2977,21)GCCATCACCATCTGCATTGTCAmplicon SizecDNA: 237 bpgenomic: 10,964
Reverse (3213,24)ATTTGCCAAACCAAGTTCCATTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-0.998 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATG
ACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACA
GCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGG
AATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2372646 - 2882
NM_001040143 (SCN2A)2372341 - 2577
NM_001040142 (SCN2A)2372580 - 2816
Exon 16 To Exon 17 (Pair 80)
Forward (3039,21)GGAGCAGTTCAGCAGTGTACTAmplicon SizecDNA: 175 bpgenomic: 10,902
Reverse (3213,24)ATTTGCCAAACCAAGTTCCATTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.045 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.055 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGC
AGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAA
TATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)1752708 - 2882
NM_001040143 (SCN2A)1752403 - 2577
NM_001040142 (SCN2A)1752642 - 2816
Exon 16 To Exon 17 (Pair 81)
Forward (3014,21)TGGCTATGGAGCACTATCCCAAmplicon SizecDNA: 91 bpgenomic: 10,818
Reverse (3104,22)ATTTCTGCTGTGAAGATCCCTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-2.387 kcal/mol
Amplicon Folding0.159 kcal/mol inside primersite
Amplicon SequenceTGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACC
TGGTCTTCACAGGGATCTTCACAGCAGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)912378 - 2468
NM_021007 (SCN2A)912683 - 2773
NM_001040142 (SCN2A)912617 - 2707
Exon 16 To Exon 17 (Pair 82)
Forward (3014,21)TGGCTATGGAGCACTATCCCAAmplicon SizecDNA: 87 bpgenomic: 10,814
Reverse (3100,21)CTGCTGTGAAGATCCCTGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-2.387 kcal/mol
Amplicon Folding0.159 kcal/mol inside primersite
Amplicon SequenceTGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACC
TGGTCTTCACAGGGATCTTCACAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)872617 - 2703
NM_001040143 (SCN2A)872378 - 2464
NM_021007 (SCN2A)872683 - 2769
Exon 16 To Exon 17 (Pair 83)
Forward (2957,21)TGGACCCATTTGTTGACCTGGAmplicon SizecDNA: 144 bpgenomic: 10,871
Reverse (3100,21)CTGCTGTGAAGATCCCTGTGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.387 kcal/mol
Forward Dimers-0.805 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-0.819 kcal/mol
Amplicon Folding-0.002 kcal/mol outside primersite
Amplicon SequenceTGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGG
CTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGG
TCTTCACAGGGATCTTCACAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1442321 - 2464
NM_021007 (SCN2A)1442626 - 2769
NM_001040142 (SCN2A)1442560 - 2703
Exon 16 To Exon 17 (Pair 84)
Forward (2951,23)TTGTAATGGACCCATTTGTTGACAmplicon SizecDNA: 156 bpgenomic: 10,883
Reverse (3106,22)ACATTTCTGCTGTGAAGATCCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.664 kcal/mol
Forward Dimers-2.879 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-1.154 kcal/mol
Amplicon Folding-0.002 kcal/mol outside primersite
Amplicon SequenceTTGTAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCT
TCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAA
ACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1562554 - 2709
NM_006920 (SCN1A)1562276 - 2431
NM_021007 (SCN2A)1562620 - 2775
NM_001202435 (SCN1A)1562518 - 2673
NM_001040143 (SCN2A)1562315 - 2470
NM_001165963 (SCN1A)1562309 - 2464
NM_001165964 (SCN1A)1562225 - 2380
Exon 16 To Exon 17 (Pair 85)
Forward (3015,21)GGCTATGGAGCACTATCCCATAmplicon SizecDNA: 97 bpgenomic: 10,824
Reverse (3111,23)GAGAAACATTTCTGCTGTGAAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-2.387 kcal/mol
Amplicon Folding0.128 kcal/mol inside primersite
Amplicon SequenceGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCT
GGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)972618 - 2714
NM_021007 (SCN2A)972684 - 2780
NM_001040143 (SCN2A)972379 - 2475
Exon 16 To Exon 17 (Pair 86)
Forward (3013,21)ATGGCTATGGAGCACTATCCCAmplicon SizecDNA: 202 bpgenomic: 10,929
Reverse (3214,23)CATTTGCCAAACCAAGTTCCATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-2.671 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAAC
CTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCA
TATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTA
ATGGAACTTGGTTTGGCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2022616 - 2817
NM_001040143 (SCN2A)2022377 - 2578
NM_021007 (SCN2A)2022682 - 2883
Exon 16 To Exon 17 (Pair 87)
Forward (3012,21)CATGGCTATGGAGCACTATCCAmplicon SizecDNA: 206 bpgenomic: 10,933
Reverse (3217,22)CCACATTTGCCAAACCAAGTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.298 kcal/mol
Forward Dimers-1.667 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-2.671 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceCATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAA
CCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCC
ATATTATTACTTTCAAGAAGGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTT
AATGGAACTTGGTTTGGCAAATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2062615 - 2820
NM_021007 (SCN2A)2062681 - 2886
NM_001040143 (SCN2A)2062376 - 2581
Exon 16 To Exon 17 (Pair 88)
Forward (3050,22)GCAGTGTACTGTCTGTTGGAAAAmplicon SizecDNA: 192 bpgenomic: 10,919
Reverse (3241,22)ATGATCGGAGAACTGACAATCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.94 kcal/mol
Forward Dimers-1.596 kcal/mol
Reverse Loops0.535 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-2.66 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTC
TCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAATATTTTTGATG
GTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAAGGATTGTCAG
TTCTCCGATCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1922414 - 2605
NM_021007 (SCN2A)1922719 - 2910
NM_001040142 (SCN2A)1922653 - 2844
Exon 16 To Exon 17 (Pair 89)
Forward (2980,24)ATCACCATCTGCATTGTCTTAAATAmplicon SizecDNA: 138 bpgenomic: 10,865
Reverse (3117,24)TATCTTGAGAAACATTTCTGCTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.013 kcal/mol
Amplicon Folding-0.002 kcal/mol outside primersite
Amplicon SequenceATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGACG
GAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCA
GAAATGTTTCTCAAGATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)1382344 - 2481
NM_021007 (SCN2A)1382649 - 2786
NM_001040142 (SCN2A)1382583 - 2720
Exon 16 To Exon 17 (Pair 90)
Forward (3039,21)GGAGCAGTTCAGCAGTGTACTAmplicon SizecDNA: 181 bpgenomic: 10,908
Reverse (3219,23)TTCCACATTTGCCAAACCAAGTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.045 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.724 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.055 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGC
AGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAA
TATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGA
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1812642 - 2822
NM_021007 (SCN2A)1812708 - 2888
NM_001040143 (SCN2A)1812403 - 2583
Exon 16 To Exon 17 (Pair 91)
Forward (2980,24)ATCACCATCTGCATTGTCTTAAATAmplicon SizecDNA: 241 bpgenomic: 10,968
Reverse (3220,22)CTTCCACATTTGCCAAACCAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.23 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGACG
GAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCA
GAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAAT
ATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAA
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2412583 - 2823
NM_001040143 (SCN2A)2412344 - 2584
NM_021007 (SCN2A)2412649 - 2889
Exon 16 To Exon 17 (Pair 92)
Forward (3037,21)ACGGAGCAGTTCAGCAGTGTAAmplicon SizecDNA: 180 bpgenomic: 10,907
Reverse (3216,22)CACATTTGCCAAACCAAGTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.045 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.072 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACA
GCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGG
AATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1802640 - 2819
NM_001040143 (SCN2A)1802401 - 2580
NM_021007 (SCN2A)1802706 - 2885
Exon 16 To Exon 17 (Pair 93)
Forward (2976,21)GGCCATCACCATCTGCATTGTAmplicon SizecDNA: 237 bpgenomic: 10,964
Reverse (3212,24)TTTGCCAAACCAAGTTCCATTAAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.668 kcal/mol
Forward Dimers-2.61 kcal/mol
Reverse Loops1.275 kcal/mol
Reverse Dimers-0.381 kcal/mol
Forward-Reverse Dimers-1.696 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCAT
GACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCAC
AGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTG
GAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)2372645 - 2881
NM_001040143 (SCN2A)2372340 - 2576
NM_001040142 (SCN2A)2372579 - 2815
Exon 16 To Exon 17 (Pair 94)
Forward (3031,20)CCCATGACGGAGCAGTTCAGAmplicon SizecDNA: 187 bpgenomic: 10,914
Reverse (3217,22)CCACATTTGCCAAACCAAGTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.472 kcal/mol
Forward Dimers-1.63 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.603 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATC
TTCACAGCAGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAA
GGCTGGAATATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCA
AATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1872634 - 2820
NM_021007 (SCN2A)1872700 - 2886
NM_001040143 (SCN2A)1872395 - 2581
Exon 16 To Exon 17 (Pair 95)
Forward (2899,23)ATTTGGGACTGTTGTAAACCATGAmplicon SizecDNA: 214 bpgenomic: 10,941
Reverse (3112,23)TGAGAAACATTTCTGCTGTGAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.191 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.275 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTTGTAATG
GACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCT
ATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTC
TTCACAGGGATCTTCACAGCAGAAATGTTTCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2142502 - 2715
NM_001040143 (SCN2A)2142263 - 2476
NM_021007 (SCN2A)2142568 - 2781
Exon 16 To Exon 17 (Pair 96)
Forward (2979,23)CATCACCATCTGCATTGTCTTAAAmplicon SizecDNA: 238 bpgenomic: 10,965
Reverse (3216,22)CACATTTGCCAAACCAAGTTCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.967 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.275 kcal/mol in 3' area
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.23 kcal/mol
Amplicon Folding-0.133 kcal/mol outside primersite
Amplicon SequenceCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATGGAGCACTATCCCATGAC
GGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGC
AGAAATGTTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAA
TATTTTTGATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2382582 - 2819
NM_021007 (SCN2A)2382648 - 2885
NM_001040143 (SCN2A)2382343 - 2580
Exon 16 To Exon 17 (Pair 97)
Forward (3046,22)TTCAGCAGTGTACTGTCTGTTGAmplicon SizecDNA: 175 bpgenomic: 10,902
Reverse (3220,22)CTTCCACATTTGCCAAACCAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.862 kcal/mol
Forward Dimers-1.752 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.613 kcal/mol
Forward-Reverse Dimers-1.055 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATG
TTTCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAATATTTTT
GATGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)1752649 - 2823
NM_001040143 (SCN2A)1752410 - 2584
NM_021007 (SCN2A)1752715 - 2889
Exon 16 To Exon 17 (Pair 98)
Forward (2842,22)GAAGAATCCAGACAGAAATGCCAmplicon SizecDNA: 260 bpgenomic: 10,987
Reverse (3101,21)TCTGCTGTGAAGATCCCTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.579 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.217 kcal/mol
Reverse Dimers-0.436 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-2.072 kcal/mol outside primersite
Amplicon SequenceGAAGAATCCAGACAGAAATGCCCACCATGCTGGTATAAATTTGCTAATATGTGTTTGATT
TGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTTGTAATGGAC
CCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTCATGGCTATG
GAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTC
ACAGGGATCTTCACAGCAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040143 (SCN2A)2602206 - 2465
NM_021007 (SCN2A)2602511 - 2770
NM_001040142 (SCN2A)2602445 - 2704
Exon 16 To Exon 17 (Pair 99)
Forward (2893,24)TGTTTGATTTGGGACTGTTGTAAAAmplicon SizecDNA: 220 bpgenomic: 10,947
Reverse (3112,23)TGAGAAACATTTCTGCTGTGAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.191 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops0.151 kcal/mol
Reverse Dimers-1.685 kcal/mol
Forward-Reverse Dimers-1.742 kcal/mol
Amplicon Folding-1.593 kcal/mol outside primersite
Amplicon SequenceTGTTTGATTTGGGACTGTTGTAAACCATGGTTAAAGGTGAAACACCTTGTCAACCTGGTT
GTAATGGACCCATTTGTTGACCTGGCCATCACCATCTGCATTGTCTTAAATACACTCTTC
ATGGCTATGGAGCACTATCCCATGACGGAGCAGTTCAGCAGTGTACTGTCTGTTGGAAAC
CTGGTCTTCACAGGGATCTTCACAGCAGAAATGTTTCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040142 (SCN2A)2202496 - 2715
NM_021007 (SCN2A)2202562 - 2781
NM_001040143 (SCN2A)2202257 - 2476
Exon 16 To Exon 17 (Pair 100)
Forward (3048,21)CAGCAGTGTACTGTCTGTTGGAmplicon SizecDNA: 191 bpgenomic: 10,918
Reverse (3238,22)ATCGGAGAACTGACAATCCTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.862 kcal/mol
Forward Dimers-1.752 kcal/mol
Reverse Loops0.535 kcal/mol
Reverse Dimers-0.627 kcal/mol
Forward-Reverse Dimers-2.66 kcal/mol
Amplicon Folding-0.131 kcal/mol outside primersite
Amplicon SequenceCAGCAGTGTACTGTCTGTTGGAAACCTGGTCTTCACAGGGATCTTCACAGCAGAAATGTT
TCTCAAGATAATTGCCATGGATCCATATTATTACTTTCAAGAAGGCTGGAATATTTTTGA
TGGTTTTATTGTGAGCCTTAGTTTAATGGAACTTGGTTTGGCAAATGTGGAAGGATTGTC
AGTTCTCCGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_021007 (SCN2A)1912717 - 2907
NM_001040143 (SCN2A)1912412 - 2602
NM_001040142 (SCN2A)1912651 - 2841
 

See below for some more details.

Program Output:

Loading ...