Design Results for SCN3A

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1500

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 23 To Exon 24 (Pair 1)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 126 bpgenomic: 2,903
Reverse (4650,23)AATTCACACCCATGATGCTAAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.384 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1264433 - 4558
NM_001081677 (SCN3A)1264286 - 4411
NM_001081676 (SCN3A)1264286 - 4411
Exon 23 To Exon 24 (Pair 2)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 217 bpgenomic: 2,994
Reverse (4666,23)AACTTGCCAGCAAACAAATTCACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.493 kcal/mol in 3' area
Reverse Dimers-1.19 kcal/mol
Forward-Reverse Dimers-2.755 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGGCAAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2174211 - 4427
NM_001081677 (SCN3A)2174211 - 4427
NM_006922 (SCN3A)2174358 - 4574
Exon 23 To Exon 24 (Pair 3)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 163 bpgenomic: 2,940
Reverse (4687,23)GTCATGTTAACACAGTGGTAGAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.11 kcal/mol in 3' area
Reverse Dimers-2.788 kcal/mol
Forward-Reverse Dimers-0.792 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)1634286 - 4448
NM_006922 (SCN3A)1634433 - 4595
NM_001081677 (SCN3A)1634286 - 4448
Exon 23 To Exon 24 (Pair 4)
Forward (4527,22)TTATCCCGGTTTGAAGGCATGAAmplicon SizecDNA: 84 bpgenomic: 2,861
Reverse (4610,22)ACAGACCAACAGCACATTCATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops1.866 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCT
ATCATGAATGTGCTGTTGGTCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)844288 - 4371
NM_006922 (SCN3A)844435 - 4518
NM_001081677 (SCN3A)844288 - 4371
Exon 23 To Exon 24 (Pair 5)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 168 bpgenomic: 2,945
Reverse (4692,22)CCGTTGTCATGTTAACACAGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.367 kcal/mol in 3' area
Reverse Dimers-2.788 kcal/mol
Forward-Reverse Dimers-1.018 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGACAACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)1684286 - 4453
NM_006922 (SCN3A)1684433 - 4600
NM_001081677 (SCN3A)1684286 - 4453
Exon 23 To Exon 24 (Pair 6)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 165 bpgenomic: 2,942
Reverse (4689,23)TTGTCATGTTAACACAGTGGTAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.11 kcal/mol in 3' area
Reverse Dimers-2.788 kcal/mol
Forward-Reverse Dimers-0.792 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)1654286 - 4450
NM_006922 (SCN3A)1654433 - 4597
NM_001081676 (SCN3A)1654286 - 4450
Exon 23 To Exon 24 (Pair 7)
Forward (4527,22)TTATCCCGGTTTGAAGGCATGAAmplicon SizecDNA: 85 bpgenomic: 2,862
Reverse (4611,22)GACAGACCAACAGCACATTCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops2.601 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCT
ATCATGAATGTGCTGTTGGTCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)854288 - 4372
NM_001081676 (SCN3A)854288 - 4372
NM_006922 (SCN3A)854435 - 4519
Exon 23 To Exon 24 (Pair 8)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 128 bpgenomic: 2,905
Reverse (4652,23)CAAATTCACACCCATGATGCTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.384 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)1284286 - 4413
NM_001081677 (SCN3A)1284286 - 4413
NM_006922 (SCN3A)1284433 - 4560
Exon 23 To Exon 24 (Pair 9)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 164 bpgenomic: 2,941
Reverse (4688,23)TGTCATGTTAACACAGTGGTAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.11 kcal/mol in 3' area
Reverse Dimers-2.788 kcal/mol
Forward-Reverse Dimers-0.792 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1644433 - 4596
NM_001081676 (SCN3A)1644286 - 4449
NM_001081677 (SCN3A)1644286 - 4449
Exon 23 To Exon 24 (Pair 10)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 237 bpgenomic: 3,014
Reverse (4686,23)TCATGTTAACACAGTGGTAGAACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.11 kcal/mol
Reverse Dimers-2.788 kcal/mol
Forward-Reverse Dimers-1.444 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2374358 - 4594
NM_001081677 (SCN3A)2374211 - 4447
NM_001081676 (SCN3A)2374211 - 4447
Exon 23 To Exon 24 (Pair 11)
Forward (4529,21)ATCCCGGTTTGAAGGCATGAGAmplicon SizecDNA: 270 bpgenomic: 3,047
Reverse (4798,23)GCGCCAACATTATCAAAGTTTACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops1.338 kcal/mol in 3' area
Reverse Dimers-2.462 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.391 kcal/mol outside primersite
Amplicon SequenceATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTAT
CATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTGTGAA
TTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGACAACGGGTAACATGTTTGACAT
TAGTGATGTTAACAATTTGAGTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAA
CGTGAAAGTAAACTTTGATAATGTTGGCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2704437 - 4706
NM_001081677 (SCN3A)2704290 - 4559
NM_001081676 (SCN3A)2704290 - 4559
Exon 23 To Exon 24 (Pair 12)
Forward (4531,20)CCCGGTTTGAAGGCATGAGGAmplicon SizecDNA: 82 bpgenomic: 2,859
Reverse (4612,22)AGACAGACCAACAGCACATTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops2.601 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTATCA
TGAATGTGCTGTTGGTCTGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)824439 - 4520
NM_001081677 (SCN3A)824292 - 4373
NM_001081676 (SCN3A)824292 - 4373
Exon 23 To Exon 24 (Pair 13)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 129 bpgenomic: 2,906
Reverse (4653,23)ACAAATTCACACCCATGATGCTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.384 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATTTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1294433 - 4561
NM_001081676 (SCN3A)1294286 - 4414
NM_001081677 (SCN3A)1294286 - 4414
Exon 23 To Exon 24 (Pair 14)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 161 bpgenomic: 2,938
Reverse (4610,22)ACAGACCAACAGCACATTCATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.866 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.851 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1614358 - 4518
NM_001081676 (SCN3A)1614211 - 4371
NM_001081677 (SCN3A)1614211 - 4371
Exon 23 To Exon 24 (Pair 15)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 216 bpgenomic: 2,993
Reverse (4665,23)ACTTGCCAGCAAACAAATTCACANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.493 kcal/mol in 3' area
Reverse Dimers-1.19 kcal/mol
Forward-Reverse Dimers-2.755 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGGCAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2164211 - 4426
NM_001081677 (SCN3A)2164211 - 4426
NM_006922 (SCN3A)2164358 - 4573
Exon 23 To Exon 24 (Pair 16)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 203 bpgenomic: 2,980
Reverse (4652,23)CAAATTCACACCCATGATGCTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-0.861 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2034358 - 4560
NM_001081677 (SCN3A)2034211 - 4413
NM_001081676 (SCN3A)2034211 - 4413
Exon 23 To Exon 24 (Pair 17)
Forward (4531,20)CCCGGTTTGAAGGCATGAGGAmplicon SizecDNA: 84 bpgenomic: 2,861
Reverse (4614,22)TGAGACAGACCAACAGCACATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops2.767 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTATCA
TGAATGTGCTGTTGGTCTGTCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)844292 - 4375
NM_001081677 (SCN3A)844292 - 4375
NM_006922 (SCN3A)844439 - 4522
Exon 23 To Exon 24 (Pair 18)
Forward (4527,22)TTATCCCGGTTTGAAGGCATGAAmplicon SizecDNA: 88 bpgenomic: 2,865
Reverse (4614,22)TGAGACAGACCAACAGCACATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops2.767 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCT
ATCATGAATGTGCTGTTGGTCTGTCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)884435 - 4522
NM_001081677 (SCN3A)884288 - 4375
NM_001081676 (SCN3A)884288 - 4375
Exon 23 To Exon 24 (Pair 19)
Forward (4529,21)ATCCCGGTTTGAAGGCATGAGAmplicon SizecDNA: 84 bpgenomic: 2,861
Reverse (4612,22)AGACAGACCAACAGCACATTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops2.601 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTAT
CATGAATGTGCTGTTGGTCTGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)844437 - 4520
NM_001081677 (SCN3A)844290 - 4373
NM_001081676 (SCN3A)844290 - 4373
Exon 23 To Exon 24 (Pair 20)
Forward (4531,20)CCCGGTTTGAAGGCATGAGGAmplicon SizecDNA: 81 bpgenomic: 2,858
Reverse (4611,22)GACAGACCAACAGCACATTCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops2.601 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTATCA
TGAATGTGCTGTTGGTCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)814439 - 4519
NM_001081677 (SCN3A)814292 - 4372
NM_001081676 (SCN3A)814292 - 4372
Exon 23 To Exon 24 (Pair 21)
Forward (4527,22)TTATCCCGGTTTGAAGGCATGAAmplicon SizecDNA: 86 bpgenomic: 2,863
Reverse (4612,22)AGACAGACCAACAGCACATTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops2.601 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCT
ATCATGAATGTGCTGTTGGTCTGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)864435 - 4520
NM_001081677 (SCN3A)864288 - 4373
NM_001081676 (SCN3A)864288 - 4373
Exon 23 To Exon 24 (Pair 22)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 82 bpgenomic: 2,859
Reverse (4606,23)ACCAACAGCACATTCATGATAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.055 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-1.213 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)824286 - 4367
NM_001081677 (SCN3A)824286 - 4367
NM_006922 (SCN3A)824433 - 4514
Exon 23 To Exon 24 (Pair 23)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 234 bpgenomic: 3,011
Reverse (4683,23)TGTTAACACAGTGGTAGAACTTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.07 kcal/mol in 3' area
Reverse Dimers-2.186 kcal/mol
Forward-Reverse Dimers-1.444 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2344358 - 4591
NM_001081676 (SCN3A)2344211 - 4444
NM_001081677 (SCN3A)2344211 - 4444
Exon 23 To Exon 24 (Pair 24)
Forward (4529,21)ATCCCGGTTTGAAGGCATGAGAmplicon SizecDNA: 132 bpgenomic: 2,909
Reverse (4660,22)CCAGCAAACAAATTCACACCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops1.493 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.462 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTAT
CATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTGTGAA
TTTGTTTGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)1324290 - 4421
NM_001081677 (SCN3A)1324290 - 4421
NM_006922 (SCN3A)1324437 - 4568
Exon 23 To Exon 24 (Pair 25)
Forward (4527,22)TTATCCCGGTTTGAAGGCATGAAmplicon SizecDNA: 134 bpgenomic: 2,911
Reverse (4660,22)CCAGCAAACAAATTCACACCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops1.493 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.462 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCT
ATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTGTG
AATTTGTTTGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)1344288 - 4421
NM_001081677 (SCN3A)1344288 - 4421
NM_006922 (SCN3A)1344435 - 4568
Exon 23 To Exon 24 (Pair 26)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 167 bpgenomic: 2,944
Reverse (4691,22)CGTTGTCATGTTAACACAGTGGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.367 kcal/mol in 3' area
Reverse Dimers-2.788 kcal/mol
Forward-Reverse Dimers-0.792 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGACAACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)1674286 - 4452
NM_001081677 (SCN3A)1674286 - 4452
NM_006922 (SCN3A)1674433 - 4599
Exon 23 To Exon 24 (Pair 27)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 162 bpgenomic: 2,939
Reverse (4686,23)TCATGTTAACACAGTGGTAGAACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.11 kcal/mol
Reverse Dimers-2.788 kcal/mol
Forward-Reverse Dimers-0.792 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1624433 - 4594
NM_001081676 (SCN3A)1624286 - 4447
NM_001081677 (SCN3A)1624286 - 4447
Exon 23 To Exon 24 (Pair 28)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 163 bpgenomic: 2,940
Reverse (4612,22)AGACAGACCAACAGCACATTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops2.601 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.851 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1634358 - 4520
NM_001081676 (SCN3A)1634211 - 4373
NM_001081677 (SCN3A)1634211 - 4373
Exon 23 To Exon 24 (Pair 29)
Forward (4527,22)TTATCCCGGTTTGAAGGCATGAAmplicon SizecDNA: 214 bpgenomic: 2,991
Reverse (4740,23)CCTGACAGTCACTCAAATTGTTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops1.462 kcal/mol in 3' area
Reverse Dimers-1.604 kcal/mol
Forward-Reverse Dimers-1.261 kcal/mol
Amplicon Folding-1.391 kcal/mol outside primersite
Amplicon SequenceTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCT
ATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTGTG
AATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGACAACGGGTAACATGTTTGAC
ATTAGTGATGTTAACAATTTGAGTGACTGTCAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2144288 - 4501
NM_001081677 (SCN3A)2144288 - 4501
NM_006922 (SCN3A)2144435 - 4648
Exon 23 To Exon 24 (Pair 30)
Forward (4529,21)ATCCCGGTTTGAAGGCATGAGAmplicon SizecDNA: 82 bpgenomic: 2,859
Reverse (4610,22)ACAGACCAACAGCACATTCATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops1.866 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTAT
CATGAATGTGCTGTTGGTCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)824290 - 4371
NM_001081677 (SCN3A)824290 - 4371
NM_006922 (SCN3A)824437 - 4518
Exon 23 To Exon 24 (Pair 31)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 236 bpgenomic: 3,013
Reverse (4685,23)CATGTTAACACAGTGGTAGAACTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.11 kcal/mol
Reverse Dimers-2.788 kcal/mol
Forward-Reverse Dimers-1.444 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2364358 - 4593
NM_001081677 (SCN3A)2364211 - 4446
NM_001081676 (SCN3A)2364211 - 4446
Exon 23 To Exon 24 (Pair 32)
Forward (4531,20)CCCGGTTTGAAGGCATGAGGAmplicon SizecDNA: 80 bpgenomic: 2,857
Reverse (4610,22)ACAGACCAACAGCACATTCATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops1.866 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTATCA
TGAATGTGCTGTTGGTCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)804292 - 4371
NM_001081677 (SCN3A)804292 - 4371
NM_006922 (SCN3A)804439 - 4518
Exon 23 To Exon 24 (Pair 33)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 205 bpgenomic: 2,982
Reverse (4654,23)AACAAATTCACACCCATGATGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-0.861 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2054358 - 4562
NM_001081677 (SCN3A)2054211 - 4415
NM_001081676 (SCN3A)2054211 - 4415
Exon 23 To Exon 24 (Pair 34)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 124 bpgenomic: 2,901
Reverse (4648,23)TTCACACCCATGATGCTAAAGATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.384 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1244433 - 4556
NM_001081677 (SCN3A)1244286 - 4409
NM_001081676 (SCN3A)1244286 - 4409
Exon 23 To Exon 24 (Pair 35)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 218 bpgenomic: 2,995
Reverse (4667,23)GAACTTGCCAGCAAACAAATTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.493 kcal/mol in 3' area
Reverse Dimers-1.19 kcal/mol
Forward-Reverse Dimers-2.755 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGGCAAGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2184211 - 4428
NM_001081676 (SCN3A)2184211 - 4428
NM_006922 (SCN3A)2184358 - 4575
Exon 23 To Exon 24 (Pair 36)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 201 bpgenomic: 2,978
Reverse (4650,23)AATTCACACCCATGATGCTAAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-0.861 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2014211 - 4411
NM_001081676 (SCN3A)2014211 - 4411
NM_006922 (SCN3A)2014358 - 4558
Exon 23 To Exon 24 (Pair 37)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 219 bpgenomic: 2,996
Reverse (4668,23)AGAACTTGCCAGCAAACAAATTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.493 kcal/mol in 3' area
Reverse Dimers-1.19 kcal/mol
Forward-Reverse Dimers-2.755 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGGCAAGTTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2194211 - 4429
NM_001081677 (SCN3A)2194211 - 4429
NM_006922 (SCN3A)2194358 - 4576
Exon 23 To Exon 24 (Pair 38)
Forward (4529,21)ATCCCGGTTTGAAGGCATGAGAmplicon SizecDNA: 83 bpgenomic: 2,860
Reverse (4611,22)GACAGACCAACAGCACATTCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops2.601 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTAT
CATGAATGTGCTGTTGGTCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)834437 - 4519
NM_001081676 (SCN3A)834290 - 4372
NM_001081677 (SCN3A)834290 - 4372
Exon 23 To Exon 24 (Pair 39)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 211 bpgenomic: 2,988
Reverse (4660,22)CCAGCAAACAAATTCACACCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.493 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.755 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2114211 - 4421
NM_001081676 (SCN3A)2114211 - 4421
NM_006922 (SCN3A)2114358 - 4568
Exon 23 To Exon 24 (Pair 40)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 125 bpgenomic: 2,902
Reverse (4649,23)ATTCACACCCATGATGCTAAAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.384 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)1254286 - 4410
NM_001081676 (SCN3A)1254286 - 4410
NM_006922 (SCN3A)1254433 - 4557
Exon 23 To Exon 24 (Pair 41)
Forward (4529,21)ATCCCGGTTTGAAGGCATGAGAmplicon SizecDNA: 86 bpgenomic: 2,863
Reverse (4614,22)TGAGACAGACCAACAGCACATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops2.767 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTAT
CATGAATGTGCTGTTGGTCTGTCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)864290 - 4375
NM_001081677 (SCN3A)864290 - 4375
NM_006922 (SCN3A)864437 - 4522
Exon 23 To Exon 24 (Pair 42)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 166 bpgenomic: 2,943
Reverse (4690,23)GTTGTCATGTTAACACAGTGGTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.11 kcal/mol in 3' area
Reverse Dimers-2.788 kcal/mol
Forward-Reverse Dimers-0.792 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGACAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)1664286 - 4451
NM_001081677 (SCN3A)1664286 - 4451
NM_006922 (SCN3A)1664433 - 4598
Exon 23 To Exon 24 (Pair 43)
Forward (4531,20)CCCGGTTTGAAGGCATGAGGAmplicon SizecDNA: 130 bpgenomic: 2,907
Reverse (4660,22)CCAGCAAACAAATTCACACCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops1.493 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.462 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTATCA
TGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTGTGAATT
TGTTTGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1304439 - 4568
NM_001081677 (SCN3A)1304292 - 4421
NM_001081676 (SCN3A)1304292 - 4421
Exon 23 To Exon 24 (Pair 44)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 136 bpgenomic: 2,913
Reverse (4660,22)CCAGCAAACAAATTCACACCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.493 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.462 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATTTGTTTGCTGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 23 To Exon 24 (Pair 45)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 157 bpgenomic: 2,934
Reverse (4606,23)ACCAACAGCACATTCATGATAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.055 kcal/mol
Reverse Dimers-1.818 kcal/mol
Forward-Reverse Dimers-2.851 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)1574211 - 4367
NM_001081676 (SCN3A)1574211 - 4367
NM_006922 (SCN3A)1574358 - 4514
Exon 23 To Exon 24 (Pair 46)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 204 bpgenomic: 2,981
Reverse (4653,23)ACAAATTCACACCCATGATGCTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-0.861 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2044211 - 4414
NM_001081676 (SCN3A)2044211 - 4414
NM_006922 (SCN3A)2044358 - 4561
Exon 23 To Exon 24 (Pair 47)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 213 bpgenomic: 2,990
Reverse (4662,22)TGCCAGCAAACAAATTCACACCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.493 kcal/mol
Reverse Dimers-1.026 kcal/mol
Forward-Reverse Dimers-2.755 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2134211 - 4423
NM_001081676 (SCN3A)2134211 - 4423
NM_006922 (SCN3A)2134358 - 4570
Exon 23 To Exon 24 (Pair 48)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 293 bpgenomic: 3,070
Reverse (4742,22)AGCCTGACAGTCACTCAAATTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-1.604 kcal/mol
Forward-Reverse Dimers-2.612 kcal/mol
Amplicon Folding-1.948 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGACAA
CGGGTAACATGTTTGACATTAGTGATGTTAACAATTTGAGTGACTGTCAGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2934211 - 4503
NM_001081677 (SCN3A)2934211 - 4503
NM_006922 (SCN3A)2934358 - 4650
Exon 23 To Exon 24 (Pair 49)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 238 bpgenomic: 3,015
Reverse (4687,23)GTCATGTTAACACAGTGGTAGAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.11 kcal/mol in 3' area
Reverse Dimers-2.788 kcal/mol
Forward-Reverse Dimers-1.444 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2384358 - 4595
NM_001081677 (SCN3A)2384211 - 4448
NM_001081676 (SCN3A)2384211 - 4448
Exon 23 To Exon 24 (Pair 50)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 221 bpgenomic: 2,998
Reverse (4670,23)GTAGAACTTGCCAGCAAACAAATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops1.697 kcal/mol
Reverse Dimers-1.19 kcal/mol
Forward-Reverse Dimers-2.755 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCT
TTAGCATCATGGGTGTGAATTTGTTTGCTGGCAAGTTCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2214358 - 4578
NM_001081676 (SCN3A)2214211 - 4431
NM_001081677 (SCN3A)2214211 - 4431
Exon 23 To Exon 24 (Pair 51)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 87 bpgenomic: 2,864
Reverse (4611,22)GACAGACCAACAGCACATTCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops2.601 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)874286 - 4372
NM_001081677 (SCN3A)874286 - 4372
NM_006922 (SCN3A)874433 - 4519
Exon 23 To Exon 24 (Pair 52)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 86 bpgenomic: 2,863
Reverse (4610,22)ACAGACCAACAGCACATTCATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.866 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)864286 - 4371
NM_001081677 (SCN3A)864286 - 4371
NM_006922 (SCN3A)864433 - 4518
Exon 23 To Exon 24 (Pair 53)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 90 bpgenomic: 2,867
Reverse (4614,22)TGAGACAGACCAACAGCACATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops2.767 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)904433 - 4522
NM_001081676 (SCN3A)904286 - 4375
NM_001081677 (SCN3A)904286 - 4375
Exon 23 To Exon 24 (Pair 54)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 130 bpgenomic: 2,907
Reverse (4654,23)AACAAATTCACACCCATGATGCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.384 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTG
TGAATTTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1304433 - 4562
NM_001081677 (SCN3A)1304286 - 4415
NM_001081676 (SCN3A)1304286 - 4415
Exon 23 To Exon 24 (Pair 55)
Forward (4450,21)CCAATGCTCTTGGCTACTCAGAmplicon SizecDNA: 162 bpgenomic: 2,939
Reverse (4611,22)GACAGACCAACAGCACATTCATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.55 kcal/mol
Forward Dimers-0.439 kcal/mol
Reverse Loops2.601 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.851 kcal/mol
Amplicon Folding-1.604 kcal/mol outside primersite
Amplicon SequenceCCAATGCTCTTGGCTACTCAGAACTCGGTGCCATCAAATCATTACGGACATTAAGAGCTT
TAAGACCTCTAAGAGCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTG
TTGGAGCAATTCCCTCTATCATGAATGTGCTGTTGGTCTGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)1624211 - 4372
NM_001081677 (SCN3A)1624211 - 4372
NM_006922 (SCN3A)1624358 - 4519
Exon 23 To Exon 24 (Pair 56)
Forward (4525,21)CCTTATCCCGGTTTGAAGGCAAmplicon SizecDNA: 88 bpgenomic: 2,865
Reverse (4612,22)AGACAGACCAACAGCACATTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.617 kcal/mol in 3' area
Forward Dimers-2.11 kcal/mol
Reverse Loops2.601 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.776 kcal/mol
Amplicon Folding-1.047 kcal/mol outside primersite
Amplicon SequenceCCTTATCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCT
CTATCATGAATGTGCTGTTGGTCTGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)884433 - 4520
NM_001081676 (SCN3A)884286 - 4373
NM_001081677 (SCN3A)884286 - 4373
Exon 23 To Exon 24 (Pair 57)
Forward (4531,20)CCCGGTTTGAAGGCATGAGGAmplicon SizecDNA: 268 bpgenomic: 3,045
Reverse (4798,23)GCGCCAACATTATCAAAGTTTACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.664 kcal/mol
Forward Dimers-2.11 kcal/mol
Reverse Loops1.338 kcal/mol in 3' area
Reverse Dimers-2.462 kcal/mol
Forward-Reverse Dimers-2.103 kcal/mol
Amplicon Folding-1.391 kcal/mol outside primersite
Amplicon SequenceCCCGGTTTGAAGGCATGAGGGTGGTTGTGAATGCTCTTGTTGGAGCAATTCCCTCTATCA
TGAATGTGCTGTTGGTCTGTCTCATCTTCTGGTTGATCTTTAGCATCATGGGTGTGAATT
TGTTTGCTGGCAAGTTCTACCACTGTGTTAACATGACAACGGGTAACATGTTTGACATTA
GTGATGTTAACAATTTGAGTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACG
TGAAAGTAAACTTTGATAATGTTGGCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2684439 - 4706
NM_001081677 (SCN3A)2684292 - 4559
NM_001081676 (SCN3A)2684292 - 4559
Exon 24 To Exon 27 (Pair 1)
Forward (4798,21)CTGGCTATCTTGCACTGCTTCAmplicon SizecDNA: 245 bpgenomic: 2,826
Reverse (5042,23)TGTCATAAAGATGTCTTGACCTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops0.885 kcal/mol
Reverse Dimers-2.119 kcal/mol
Forward-Reverse Dimers-2.003 kcal/mol
Amplicon Folding-0.388 kcal/mol outside primersite
Amplicon SequenceCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATG
CAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGT
ATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCATTG
GTGTCATCATAGATAACTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTTA
TGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2454559 - 4803
NM_006922 (SCN3A)2454706 - 4950
NM_001081677 (SCN3A)2454559 - 4803
Exon 24 To Exon 27 (Pair 2)
Forward (4795,20)GCGCTGGCTATCTTGCACTGAmplicon SizecDNA: 249 bpgenomic: 2,830
Reverse (5043,23)CTGTCATAAAGATGTCTTGACCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.221 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops0.885 kcal/mol
Reverse Dimers-2.119 kcal/mol
Forward-Reverse Dimers-2.003 kcal/mol
Amplicon Folding-0.388 kcal/mol outside primersite
Amplicon SequenceGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGT
ATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACA
TGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCA
TTGGTGTCATCATAGATAACTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCT
TTATGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2494556 - 4804
NM_006922 (SCN3A)2494703 - 4951
NM_001081676 (SCN3A)2494556 - 4804
Exon 24 To Exon 26 (Pair 1)
Forward (4730,21)TGACTGTCAGGCTCTTGGCAAAmplicon SizecDNA: 235 bpgenomic: 1,784
Reverse (4964,22)CAGAGTGAAGAATGACCCAAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-2.499 kcal/mol
Reverse Loops1.956 kcal/mol
Reverse Dimers0.088 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACGTGAAAGTAAACTTTGATAA
TGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATAT
TATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCT
GTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2354638 - 4872
NM_001081677 (SCN3A)2354491 - 4725
NM_001081676 (SCN3A)2354491 - 4725
Exon 24 To Exon 26 (Pair 2)
Forward (4799,22)TGGCTATCTTGCACTGCTTCAAAmplicon SizecDNA: 166 bpgenomic: 1,715
Reverse (4964,22)CAGAGTGAAGAATGACCCAAAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops1.956 kcal/mol
Reverse Dimers0.088 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATGC
AGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGTA
TTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)1664560 - 4725
NM_001081677 (SCN3A)1664560 - 4725
NM_006922 (SCN3A)1664707 - 4872
Exon 24 To Exon 26 (Pair 3)
Forward (4798,21)CTGGCTATCTTGCACTGCTTCAmplicon SizecDNA: 177 bpgenomic: 1,726
Reverse (4974,24)TGAATAGATTCAGAGTGAAGAATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops1.11 kcal/mol
Reverse Dimers-1.115 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATG
CAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGT
ATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)1774559 - 4735
NM_001081677 (SCN3A)1774559 - 4735
NM_006922 (SCN3A)1774706 - 4882
Exon 24 To Exon 26 (Pair 4)
Forward (4744,20)TTGGCAAGCAAGCTCGGTGGAmplicon SizecDNA: 234 bpgenomic: 1,783
Reverse (4977,24)CAATGAATAGATTCAGAGTGAAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.292 kcal/mol
Forward Dimers-2.912 kcal/mol
Reverse Loops0.809 kcal/mol
Reverse Dimers-1.416 kcal/mol
Forward-Reverse Dimers-1.13 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceTTGGCAAGCAAGCTCGGTGGAAAAACGTGAAAGTAAACTTTGATAATGTTGGCGCTGGCT
ATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATGCAGCTG
TTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGTATTTAT
ACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2344652 - 4885
NM_001081677 (SCN3A)2344505 - 4738
NM_001081676 (SCN3A)2344505 - 4738
Exon 24 To Exon 26 (Pair 5)
Forward (4711,24)GTGATGTTAACAATTTGAGTGACTAmplicon SizecDNA: 245 bpgenomic: 1,794
Reverse (4955,24)GAATGACCCAAAGATGATAAAGATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-2.876 kcal/mol
Reverse Loops1.339 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-1.115 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGTGATGTTAACAATTTGAGTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACG
TGAAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACAT
TTAAAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGC
CTGTATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGT
CATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2454472 - 4716
NM_001081677 (SCN3A)2454472 - 4716
NM_006922 (SCN3A)2454619 - 4863
Exon 24 To Exon 26 (Pair 6)
Forward (4795,20)GCGCTGGCTATCTTGCACTGAmplicon SizecDNA: 200 bpgenomic: 1,749
Reverse (4994,24)GTTATCTATGATGACACCAATGAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.221 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops1.041 kcal/mol in 3' area
Reverse Dimers-0.124 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGT
ATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACA
TGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCA
TTGGTGTCATCATAGATAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2004703 - 4902
NM_001081677 (SCN3A)2004556 - 4755
NM_001081676 (SCN3A)2004556 - 4755
Exon 24 To Exon 26 (Pair 7)
Forward (4801,22)GCTATCTTGCACTGCTTCAAGTAmplicon SizecDNA: 174 bpgenomic: 1,723
Reverse (4974,24)TGAATAGATTCAGAGTGAAGAATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.575 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops1.11 kcal/mol
Reverse Dimers-1.115 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATGCAG
CTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGTATT
TATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1744709 - 4882
NM_001081677 (SCN3A)1744562 - 4735
NM_001081676 (SCN3A)1744562 - 4735
Exon 24 To Exon 26 (Pair 8)
Forward (4729,20)GTGACTGTCAGGCTCTTGGCAmplicon SizecDNA: 263 bpgenomic: 1,812
Reverse (4991,24)ATCTATGATGACACCAATGAATAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.089 kcal/mol in 3' area
Forward Dimers-2.499 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-0.124 kcal/mol
Forward-Reverse Dimers-1.848 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACGTGAAAGTAAACTTTGATA
ATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATA
TTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATC
TGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATC
TATTCATTGGTGTCATCATAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2634637 - 4899
NM_001081677 (SCN3A)2634490 - 4752
NM_001081676 (SCN3A)2634490 - 4752
Exon 24 To Exon 26 (Pair 9)
Forward (4798,21)CTGGCTATCTTGCACTGCTTCAmplicon SizecDNA: 159 bpgenomic: 1,708
Reverse (4956,24)AGAATGACCCAAAGATGATAAAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops1.339 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-2.003 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATG
CAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGT
ATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)1594559 - 4717
NM_006922 (SCN3A)1594706 - 4864
NM_001081676 (SCN3A)1594559 - 4717
Exon 24 To Exon 26 (Pair 10)
Forward (4774,24)AAGTAAACTTTGATAATGTTGGCGAmplicon SizecDNA: 225 bpgenomic: 1,774
Reverse (4998,24)TGAAGTTATCTATGATGACACCAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.222 kcal/mol
Forward Dimers-1.332 kcal/mol
Reverse Loops1.4 kcal/mol
Reverse Dimers-0.272 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTA
AAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTG
TATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCAT
TCTTCACTCTGAATCTATTCATTGGTGTCATCATAGATAACTTCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2254682 - 4906
NM_006920 (SCN1A)2254220 - 4444
NM_001165964 (SCN1A)2254169 - 4393
NM_001202435 (SCN1A)2254462 - 4686
NM_001081676 (SCN3A)2254535 - 4759
NM_001081677 (SCN3A)2254535 - 4759
NM_001165963 (SCN1A)2254253 - 4477
Exon 24 To Exon 26 (Pair 11)
Forward (4795,20)GCGCTGGCTATCTTGCACTGAmplicon SizecDNA: 161 bpgenomic: 1,710
Reverse (4955,24)GAATGACCCAAAGATGATAAAGATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.221 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops1.339 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-2.003 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGT
ATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACA
TGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1614703 - 4863
NM_001081677 (SCN3A)1614556 - 4716
NM_001081676 (SCN3A)1614556 - 4716
Exon 24 To Exon 26 (Pair 12)
Forward (4801,22)GCTATCTTGCACTGCTTCAAGTAmplicon SizecDNA: 198 bpgenomic: 1,747
Reverse (4998,24)TGAAGTTATCTATGATGACACCAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.575 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops1.4 kcal/mol
Reverse Dimers-0.272 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATGCAG
CTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGTATT
TATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCATTGGTG
TCATCATAGATAACTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1984709 - 4906
NM_001081676 (SCN3A)1984562 - 4759
NM_001081677 (SCN3A)1984562 - 4759
Exon 24 To Exon 26 (Pair 13)
Forward (4774,24)AAGTAAACTTTGATAATGTTGGCGAmplicon SizecDNA: 233 bpgenomic: 1,782
Reverse (5006,23)CTGCTGGTTGAAGTTATCTATGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.222 kcal/mol
Forward Dimers-1.332 kcal/mol
Reverse Loops1.4 kcal/mol in 3' area
Reverse Dimers-0.272 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTA
AAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTG
TATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCAT
TCTTCACTCTGAATCTATTCATTGGTGTCATCATAGATAACTTCAACCAGCAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2334682 - 4914
NM_001165964 (SCN1A)2334169 - 4401
NM_006920 (SCN1A)2334220 - 4452
NM_001202435 (SCN1A)2334462 - 4694
NM_001081677 (SCN3A)2334535 - 4767
NM_001081676 (SCN3A)2334535 - 4767
NM_001165963 (SCN1A)2334253 - 4485
Exon 24 To Exon 26 (Pair 14)
Forward (4730,21)TGACTGTCAGGCTCTTGGCAAAmplicon SizecDNA: 234 bpgenomic: 1,783
Reverse (4963,23)AGAGTGAAGAATGACCCAAAGATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-2.499 kcal/mol
Reverse Loops2.396 kcal/mol
Reverse Dimers0.088 kcal/mol
Forward-Reverse Dimers-1.682 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACGTGAAAGTAAACTTTGATAA
TGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATAT
TATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCT
GTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2344491 - 4724
NM_001081676 (SCN3A)2344491 - 4724
NM_006922 (SCN3A)2344638 - 4871
Exon 24 To Exon 27 (Pair 3)
Forward (4774,24)AAGTAAACTTTGATAATGTTGGCGAmplicon SizecDNA: 270 bpgenomic: 2,851
Reverse (5043,23)CTGTCATAAAGATGTCTTGACCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.222 kcal/mol
Forward Dimers-1.332 kcal/mol
Reverse Loops0.885 kcal/mol
Reverse Dimers-2.119 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-0.388 kcal/mol outside primersite
Amplicon SequenceAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTA
AAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTG
TATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCAT
TCTTCACTCTGAATCTATTCATTGGTGTCATCATAGATAACTTCAACCAGCAGAAAAAGA
AGTTTGGAGGTCAAGACATCTTTATGACAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_006920 (SCN1A)2704220 - 4489
NM_001165964 (SCN1A)2704169 - 4438
NM_006922 (SCN3A)2704682 - 4951
NM_001202435 (SCN1A)2704462 - 4731
NM_001081676 (SCN3A)2704535 - 4804
NM_001081677 (SCN3A)2704535 - 4804
NM_001165963 (SCN1A)2704253 - 4522
Exon 24 To Exon 26 (Pair 15)
Forward (4798,21)CTGGCTATCTTGCACTGCTTCAmplicon SizecDNA: 194 bpgenomic: 1,743
Reverse (4991,24)ATCTATGATGACACCAATGAATAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-0.124 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATG
CAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGT
ATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCATTG
GTGTCATCATAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)1944559 - 4752
NM_001081676 (SCN3A)1944559 - 4752
NM_006922 (SCN3A)1944706 - 4899
Exon 24 To Exon 26 (Pair 16)
Forward (4730,21)TGACTGTCAGGCTCTTGGCAAAmplicon SizecDNA: 268 bpgenomic: 1,817
Reverse (4997,24)GAAGTTATCTATGATGACACCAATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-2.499 kcal/mol
Reverse Loops1.4 kcal/mol
Reverse Dimers-0.272 kcal/mol
Forward-Reverse Dimers-1.848 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACGTGAAAGTAAACTTTGATAA
TGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATAT
TATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCT
GTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCT
ATTCATTGGTGTCATCATAGATAACTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2684491 - 4758
NM_001081676 (SCN3A)2684491 - 4758
NM_006922 (SCN3A)2684638 - 4905
Exon 24 To Exon 26 (Pair 17)
Forward (4799,22)TGGCTATCTTGCACTGCTTCAAAmplicon SizecDNA: 157 bpgenomic: 1,706
Reverse (4955,24)GAATGACCCAAAGATGATAAAGATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops1.339 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-2.003 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATGC
AGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGTA
TTTATACTTTGTCATCTTTATCATCTTTGGGTCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1574707 - 4863
NM_001081677 (SCN3A)1574560 - 4716
NM_001081676 (SCN3A)1574560 - 4716
Exon 24 To Exon 26 (Pair 18)
Forward (4774,24)AAGTAAACTTTGATAATGTTGGCGAmplicon SizecDNA: 226 bpgenomic: 1,775
Reverse (4999,24)TTGAAGTTATCTATGATGACACCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.222 kcal/mol
Forward Dimers-1.332 kcal/mol
Reverse Loops1.4 kcal/mol
Reverse Dimers-0.272 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTA
AAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTG
TATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCAT
TCTTCACTCTGAATCTATTCATTGGTGTCATCATAGATAACTTCAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2264535 - 4760
NM_001081677 (SCN3A)2264535 - 4760
NM_001165963 (SCN1A)2264253 - 4478
NM_001202435 (SCN1A)2264462 - 4687
NM_006922 (SCN3A)2264682 - 4907
NM_006920 (SCN1A)2264220 - 4445
NM_001165964 (SCN1A)2264169 - 4394
Exon 24 To Exon 26 (Pair 19)
Forward (4799,22)TGGCTATCTTGCACTGCTTCAAAmplicon SizecDNA: 176 bpgenomic: 1,725
Reverse (4974,24)TGAATAGATTCAGAGTGAAGAATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops1.11 kcal/mol
Reverse Dimers-1.115 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATGC
AGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGTA
TTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)1764560 - 4735
NM_001081677 (SCN3A)1764560 - 4735
NM_006922 (SCN3A)1764707 - 4882
Exon 24 To Exon 26 (Pair 20)
Forward (4711,24)GTGATGTTAACAATTTGAGTGACTAmplicon SizecDNA: 244 bpgenomic: 1,793
Reverse (4954,24)AATGACCCAAAGATGATAAAGATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-2.876 kcal/mol
Reverse Loops1.339 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-1.115 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGTGATGTTAACAATTTGAGTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACG
TGAAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACAT
TTAAAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGC
CTGTATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGT
CATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2444472 - 4715
NM_001081676 (SCN3A)2444472 - 4715
NM_006922 (SCN3A)2444619 - 4862
Exon 24 To Exon 26 (Pair 21)
Forward (4797,21)GCTGGCTATCTTGCACTGCTTAmplicon SizecDNA: 159 bpgenomic: 1,708
Reverse (4955,24)GAATGACCCAAAGATGATAAAGATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops1.339 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-2.003 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTAT
GCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATG
TATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1594705 - 4863
NM_001081677 (SCN3A)1594558 - 4716
NM_001081676 (SCN3A)1594558 - 4716
Exon 24 To Exon 27 (Pair 4)
Forward (4774,24)AAGTAAACTTTGATAATGTTGGCGAmplicon SizecDNA: 267 bpgenomic: 2,848
Reverse (5040,23)TCATAAAGATGTCTTGACCTCCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.222 kcal/mol
Forward Dimers-1.332 kcal/mol
Reverse Loops0.885 kcal/mol
Reverse Dimers-2.119 kcal/mol
Forward-Reverse Dimers-1.642 kcal/mol
Amplicon Folding-0.388 kcal/mol outside primersite
Amplicon SequenceAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTA
AAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTG
TATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCAT
TCTTCACTCTGAATCTATTCATTGGTGTCATCATAGATAACTTCAACCAGCAGAAAAAGA
AGTTTGGAGGTCAAGACATCTTTATGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2674682 - 4948
NM_006920 (SCN1A)2674220 - 4486
NM_001165964 (SCN1A)2674169 - 4435
NM_001202435 (SCN1A)2674462 - 4728
NM_001081676 (SCN3A)2674535 - 4801
NM_001081677 (SCN3A)2674535 - 4801
NM_001165963 (SCN1A)2674253 - 4519
Exon 24 To Exon 26 (Pair 22)
Forward (4714,24)ATGTTAACAATTTGAGTGACTGTCAmplicon SizecDNA: 238 bpgenomic: 1,787
Reverse (4951,23)GACCCAAAGATGATAAAGATGACNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-2.876 kcal/mol
Reverse Loops1.339 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-1.115 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceATGTTAACAATTTGAGTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACGTGA
AAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTA
AAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTG
TATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2384622 - 4859
NM_001081677 (SCN3A)2384475 - 4712
NM_001081676 (SCN3A)2384475 - 4712
Exon 24 To Exon 27 (Pair 5)
Forward (4795,20)GCGCTGGCTATCTTGCACTGAmplicon SizecDNA: 248 bpgenomic: 2,829
Reverse (5042,23)TGTCATAAAGATGTCTTGACCTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.221 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops0.885 kcal/mol
Reverse Dimers-2.119 kcal/mol
Forward-Reverse Dimers-2.003 kcal/mol
Amplicon Folding-0.388 kcal/mol outside primersite
Amplicon SequenceGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGT
ATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACA
TGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCA
TTGGTGTCATCATAGATAACTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCT
TTATGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2484703 - 4950
NM_001081676 (SCN3A)2484556 - 4803
NM_001081677 (SCN3A)2484556 - 4803
Exon 24 To Exon 26 (Pair 23)
Forward (4774,24)AAGTAAACTTTGATAATGTTGGCGAmplicon SizecDNA: 183 bpgenomic: 1,732
Reverse (4956,24)AGAATGACCCAAAGATGATAAAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.222 kcal/mol
Forward Dimers-1.332 kcal/mol
Reverse Loops1.339 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-2.813 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTA
AAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTG
TATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCAT
TCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1834682 - 4864
NM_001081676 (SCN3A)1834535 - 4717
NM_001081677 (SCN3A)1834535 - 4717
Exon 24 To Exon 27 (Pair 6)
Forward (4797,21)GCTGGCTATCTTGCACTGCTTAmplicon SizecDNA: 247 bpgenomic: 2,828
Reverse (5043,23)CTGTCATAAAGATGTCTTGACCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops0.885 kcal/mol
Reverse Dimers-2.119 kcal/mol
Forward-Reverse Dimers-2.003 kcal/mol
Amplicon Folding-0.388 kcal/mol outside primersite
Amplicon SequenceGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTAT
GCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATG
TATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCATT
GGTGTCATCATAGATAACTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTT
ATGACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2474705 - 4951
NM_001081676 (SCN3A)2474558 - 4804
NM_001081677 (SCN3A)2474558 - 4804
Exon 24 To Exon 26 (Pair 24)
Forward (4801,22)GCTATCTTGCACTGCTTCAAGTAmplicon SizecDNA: 166 bpgenomic: 1,715
Reverse (4966,23)TTCAGAGTGAAGAATGACCCAAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.575 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops1.468 kcal/mol
Reverse Dimers0.088 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATGCAG
CTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGTATT
TATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1664709 - 4874
NM_001081677 (SCN3A)1664562 - 4727
NM_001081676 (SCN3A)1664562 - 4727
Exon 24 To Exon 27 (Pair 7)
Forward (4801,22)GCTATCTTGCACTGCTTCAAGTAmplicon SizecDNA: 242 bpgenomic: 2,823
Reverse (5042,23)TGTCATAAAGATGTCTTGACCTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.575 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops0.885 kcal/mol
Reverse Dimers-2.119 kcal/mol
Forward-Reverse Dimers-2.003 kcal/mol
Amplicon Folding-0.388 kcal/mol outside primersite
Amplicon SequenceGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATGCAG
CTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGTATT
TATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCATTGGTG
TCATCATAGATAACTTCAACCAGCAGAAAAAGAAGTTTGGAGGTCAAGACATCTTTATGA
CA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2424562 - 4803
NM_001081677 (SCN3A)2424562 - 4803
NM_006922 (SCN3A)2424709 - 4950
Exon 24 To Exon 26 (Pair 25)
Forward (4711,24)GTGATGTTAACAATTTGAGTGACTAmplicon SizecDNA: 251 bpgenomic: 1,800
Reverse (4961,23)AGTGAAGAATGACCCAAAGATGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-2.876 kcal/mol
Reverse Loops1.339 kcal/mol in 3' area
Reverse Dimers0.044 kcal/mol in 3' area
Forward-Reverse Dimers-1.115 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGTGATGTTAACAATTTGAGTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACG
TGAAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACAT
TTAAAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGC
CTGTATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGT
CATTCTTCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2514472 - 4722
NM_001081676 (SCN3A)2514472 - 4722
NM_006922 (SCN3A)2514619 - 4869
Exon 24 To Exon 26 (Pair 26)
Forward (4801,22)GCTATCTTGCACTGCTTCAAGTAmplicon SizecDNA: 163 bpgenomic: 1,712
Reverse (4963,23)AGAGTGAAGAATGACCCAAAGATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.575 kcal/mol in 3' area
Forward Dimers-1.266 kcal/mol
Reverse Loops2.396 kcal/mol
Reverse Dimers0.088 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATGCAG
CTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGTATT
TATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)1634709 - 4871
NM_001081676 (SCN3A)1634562 - 4724
NM_001081677 (SCN3A)1634562 - 4724
Exon 24 To Exon 26 (Pair 27)
Forward (4730,21)TGACTGTCAGGCTCTTGGCAAAmplicon SizecDNA: 280 bpgenomic: 1,829
Reverse (5009,24)TTTCTGCTGGTTGAAGTTATCTATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-2.499 kcal/mol
Reverse Loops1.4 kcal/mol in 3' area
Reverse Dimers-0.272 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACGTGAAAGTAAACTTTGATAA
TGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATAT
TATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCT
GTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCT
ATTCATTGGTGTCATCATAGATAACTTCAACCAGCAGAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2804491 - 4770
NM_001081676 (SCN3A)2804491 - 4770
NM_006922 (SCN3A)2804638 - 4917
Exon 24 To Exon 26 (Pair 28)
Forward (4799,22)TGGCTATCTTGCACTGCTTCAAAmplicon SizecDNA: 170 bpgenomic: 1,719
Reverse (4968,22)GATTCAGAGTGAAGAATGACCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops1.125 kcal/mol
Reverse Dimers-0.826 kcal/mol
Forward-Reverse Dimers-2.682 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATGC
AGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGTA
TTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)1704560 - 4729
NM_001081676 (SCN3A)1704560 - 4729
NM_006922 (SCN3A)1704707 - 4876
Exon 24 To Exon 26 (Pair 29)
Forward (4774,24)AAGTAAACTTTGATAATGTTGGCGAmplicon SizecDNA: 222 bpgenomic: 1,771
Reverse (4995,24)AGTTATCTATGATGACACCAATGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.222 kcal/mol
Forward Dimers-1.332 kcal/mol
Reverse Loops1.041 kcal/mol in 3' area
Reverse Dimers-0.257 kcal/mol
Forward-Reverse Dimers-1.695 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTA
AAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTG
TATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCAT
TCTTCACTCTGAATCTATTCATTGGTGTCATCATAGATAACT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001202435 (SCN1A)2204462 - 4681
NM_001165963 (SCN1A)2204253 - 4472
NM_001081676 (SCN3A)2224535 - 4756
NM_001081677 (SCN3A)2224535 - 4756
NM_006920 (SCN1A)2204220 - 4439
NM_001165964 (SCN1A)2204169 - 4388
NM_006922 (SCN3A)2224682 - 4903
Exon 24 To Exon 26 (Pair 30)
Forward (4711,24)GTGATGTTAACAATTTGAGTGACTAmplicon SizecDNA: 246 bpgenomic: 1,795
Reverse (4956,24)AGAATGACCCAAAGATGATAAAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.413 kcal/mol
Forward Dimers-2.876 kcal/mol
Reverse Loops1.339 kcal/mol
Reverse Dimers-0.046 kcal/mol
Forward-Reverse Dimers-1.115 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGTGATGTTAACAATTTGAGTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACG
TGAAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACAT
TTAAAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGC
CTGTATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGT
CATTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_006922 (SCN3A)2464619 - 4864
NM_001081677 (SCN3A)2464472 - 4717
NM_001081676 (SCN3A)2464472 - 4717
Exon 24 To Exon 26 (Pair 31)
Forward (4730,21)TGACTGTCAGGCTCTTGGCAAAmplicon SizecDNA: 245 bpgenomic: 1,794
Reverse (4974,24)TGAATAGATTCAGAGTGAAGAATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-2.499 kcal/mol
Reverse Loops1.11 kcal/mol
Reverse Dimers-1.115 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACGTGAAAGTAAACTTTGATAA
TGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATAT
TATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCT
GTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCT
ATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2454491 - 4735
NM_001081677 (SCN3A)2454491 - 4735
NM_006922 (SCN3A)2454638 - 4882
Exon 24 To Exon 26 (Pair 32)
Forward (4774,24)AAGTAAACTTTGATAATGTTGGCGAmplicon SizecDNA: 231 bpgenomic: 1,780
Reverse (5004,23)GCTGGTTGAAGTTATCTATGATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.222 kcal/mol
Forward Dimers-1.332 kcal/mol
Reverse Loops1.4 kcal/mol
Reverse Dimers-0.272 kcal/mol
Forward-Reverse Dimers-2.703 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceAAGTAAACTTTGATAATGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTA
AAGGCTGGATGGATATTATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTG
TATATGAAGAAAATCTGTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCAT
TCTTCACTCTGAATCTATTCATTGGTGTCATCATAGATAACTTCAACCAGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2314535 - 4765
NM_001081676 (SCN3A)2314535 - 4765
NM_001165963 (SCN1A)2314253 - 4483
NM_001202435 (SCN1A)2314462 - 4692
NM_001165964 (SCN1A)2314169 - 4399
NM_006920 (SCN1A)2314220 - 4450
NM_006922 (SCN3A)2314682 - 4912
Exon 24 To Exon 26 (Pair 33)
Forward (4798,21)CTGGCTATCTTGCACTGCTTCAmplicon SizecDNA: 201 bpgenomic: 1,750
Reverse (4998,24)TGAAGTTATCTATGATGACACCAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops1.4 kcal/mol
Reverse Dimers-0.272 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATG
CAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGT
ATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCATTG
GTGTCATCATAGATAACTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2014559 - 4759
NM_001081677 (SCN3A)2014559 - 4759
NM_006922 (SCN3A)2014706 - 4906
Exon 24 To Exon 26 (Pair 34)
Forward (4730,21)TGACTGTCAGGCTCTTGGCAAAmplicon SizecDNA: 248 bpgenomic: 1,797
Reverse (4977,24)CAATGAATAGATTCAGAGTGAAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.667 kcal/mol in 3' area
Forward Dimers-2.499 kcal/mol
Reverse Loops0.809 kcal/mol
Reverse Dimers-1.416 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceTGACTGTCAGGCTCTTGGCAAGCAAGCTCGGTGGAAAAACGTGAAAGTAAACTTTGATAA
TGTTGGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATAT
TATGTATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCT
GTACATGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCT
ATTCATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)2484491 - 4738
NM_001081676 (SCN3A)2484491 - 4738
NM_006922 (SCN3A)2484638 - 4885
Exon 24 To Exon 26 (Pair 35)
Forward (4795,20)GCGCTGGCTATCTTGCACTGAmplicon SizecDNA: 197 bpgenomic: 1,746
Reverse (4991,24)ATCTATGATGACACCAATGAATAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.221 kcal/mol
Forward Dimers-2.526 kcal/mol
Reverse Loops1.041 kcal/mol
Reverse Dimers-0.124 kcal/mol
Forward-Reverse Dimers-1.065 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceGCGCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGT
ATGCAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACA
TGTATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCA
TTGGTGTCATCATAGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081677 (SCN3A)1974556 - 4752
NM_001081676 (SCN3A)1974556 - 4752
NM_006922 (SCN3A)1974703 - 4899
Exon 24 To Exon 26 (Pair 36)
Forward (4798,21)CTGGCTATCTTGCACTGCTTCAmplicon SizecDNA: 200 bpgenomic: 1,749
Reverse (4997,24)GAAGTTATCTATGATGACACCAATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.374 kcal/mol
Forward Dimers-1.266 kcal/mol
Reverse Loops1.4 kcal/mol
Reverse Dimers-0.272 kcal/mol
Forward-Reverse Dimers-1.679 kcal/mol
Amplicon Folding-0.348 kcal/mol outside primersite
Amplicon SequenceCTGGCTATCTTGCACTGCTTCAAGTGGCCACATTTAAAGGCTGGATGGATATTATGTATG
CAGCTGTTGATTCACGAGATGTTAAACTTCAGCCTGTATATGAAGAAAATCTGTACATGT
ATTTATACTTTGTCATCTTTATCATCTTTGGGTCATTCTTCACTCTGAATCTATTCATTG
GTGTCATCATAGATAACTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001081676 (SCN3A)2004559 - 4758
NM_001081677 (SCN3A)2004559 - 4758
NM_006922 (SCN3A)2004706 - 4905
 

See below for some more details.

Program Output:

Loading ...