Design Results for SCN3B

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 5 (Pair 1)
Forward (1295,21)CATCCTTCTGGTCTTCCTCACAmplicon SizecDNA: 177 bpgenomic: 4,156
Reverse (1471,22)GTCACACTGCTCCTGTTCTATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-0.595 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGAAA
GGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCATC
TGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1771295 - 1471
NM_001040151 (SCN3B)177896 - 1072
Exon 4 To Exon 5 (Pair 2)
Forward (1325,23)GCTCATCGAGATGATATATTGCTAmplicon SizecDNA: 100 bpgenomic: 4,079
Reverse (1424,21)CTTGTTCTCAGATGGGATGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.806 kcal/mol
Reverse Dimers-0.412 kcal/mol
Forward-Reverse Dimers-1.736 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGA
AAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1001325 - 1424
NM_001040151 (SCN3B)100926 - 1025
Exon 4 To Exon 5 (Pair 3)
Forward (1313,20)CACCTTGTGGCTGCTCATCGAmplicon SizecDNA: 156 bpgenomic: 4,135
Reverse (1468,22)ACACTGCTCCTGTTCTATTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.093 kcal/mol
Forward Dimers-1.07 kcal/mol
Reverse Loops2.062 kcal/mol
Reverse Dimers0.036 kcal/mol
Forward-Reverse Dimers-0.8 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGA
GGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTC
TGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1561313 - 1468
NM_001040151 (SCN3B)156914 - 1069
Exon 4 To Exon 5 (Pair 4)
Forward (1333,24)AGATGATATATTGCTACAGAAAGGAmplicon SizecDNA: 139 bpgenomic: 4,118
Reverse (1471,22)GTCACACTGCTCCTGTTCTATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-2.294 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGT
CTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAAT
AGAACAGGAGCAGTGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)139934 - 1072
NM_018400 (SCN3B)1391333 - 1471
Exon 4 To Exon 5 (Pair 5)
Forward (1327,24)TCATCGAGATGATATATTGCTACAAmplicon SizecDNA: 148 bpgenomic: 4,127
Reverse (1474,21)CATGTCACACTGCTCCTGTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAA
ACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGG
AGGAATAGAACAGGAGCAGTGTGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)148928 - 1075
NM_018400 (SCN3B)1481327 - 1474
Exon 4 To Exon 5 (Pair 6)
Forward (1324,23)TGCTCATCGAGATGATATATTGCAmplicon SizecDNA: 153 bpgenomic: 4,132
Reverse (1476,21)CTCATGTCACACTGCTCCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.346 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAG
AAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAG
TGGAGGAATAGAACAGGAGCAGTGTGACATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)153925 - 1077
NM_018400 (SCN3B)1531324 - 1476
Exon 4 To Exon 5 (Pair 7)
Forward (1333,24)AGATGATATATTGCTACAGAAAGGAmplicon SizecDNA: 80 bpgenomic: 4,059
Reverse (1412,21)TGGGATGGCAAGGTAGTCAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGT
CTGACTACCTTGCCATCCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)80934 - 1013
NM_018400 (SCN3B)801333 - 1412
Exon 4 To Exon 5 (Pair 8)
Forward (1333,24)AGATGATATATTGCTACAGAAAGGAmplicon SizecDNA: 133 bpgenomic: 4,112
Reverse (1465,21)CTGCTCCTGTTCTATTCCTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops2.555 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.294 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGT
CTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAAT
AGAACAGGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)133934 - 1066
NM_018400 (SCN3B)1331333 - 1465
Exon 4 To Exon 5 (Pair 9)
Forward (1324,23)TGCTCATCGAGATGATATATTGCAmplicon SizecDNA: 149 bpgenomic: 4,128
Reverse (1472,22)TGTCACACTGCTCCTGTTCTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.442 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAG
AAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAG
TGGAGGAATAGAACAGGAGCAGTGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1491324 - 1472
NM_001040151 (SCN3B)149925 - 1073
Exon 4 To Exon 5 (Pair 10)
Forward (1335,24)ATGATATATTGCTACAGAAAGGTCAmplicon SizecDNA: 136 bpgenomic: 4,115
Reverse (1470,22)TCACACTGCTCCTGTTCTATTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-2.294 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCT
GACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAG
AACAGGAGCAGTGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1361335 - 1470
NM_001040151 (SCN3B)136936 - 1071
Exon 4 To Exon 5 (Pair 11)
Forward (1293,22)TACATCCTTCTGGTCTTCCTCAAmplicon SizecDNA: 184 bpgenomic: 4,163
Reverse (1476,21)CTCATGTCACACTGCTCCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.981 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGA
AAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCA
TCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGTGACA
TGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)184894 - 1077
NM_018400 (SCN3B)1841293 - 1476
Exon 4 To Exon 5 (Pair 12)
Forward (1267,22)CCTCTGTGGTCTCAGAAATCATAmplicon SizecDNA: 207 bpgenomic: 4,186
Reverse (1473,22)ATGTCACACTGCTCCTGTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGC
TCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAA
ACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGG
AGGAATAGAACAGGAGCAGTGTGACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)207868 - 1074
NM_018400 (SCN3B)2071267 - 1473
Exon 4 To Exon 5 (Pair 13)
Forward (1290,22)ATGTACATCCTTCTGGTCTTCCAmplicon SizecDNA: 123 bpgenomic: 4,102
Reverse (1412,21)TGGGATGGCAAGGTAGTCAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol
Forward Dimers-2.998 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTAC
AGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATC
CCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1231290 - 1412
NM_001040151 (SCN3B)123891 - 1013
Exon 4 To Exon 5 (Pair 14)
Forward (1331,24)CGAGATGATATATTGCTACAGAAAAmplicon SizecDNA: 87 bpgenomic: 4,066
Reverse (1417,21)TCAGATGGGATGGCAAGGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGC
GTCTGACTACCTTGCCATCCCATCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)87932 - 1018
NM_018400 (SCN3B)871331 - 1417
Exon 4 To Exon 5 (Pair 15)
Forward (1336,24)TGATATATTGCTACAGAAAGGTCTAmplicon SizecDNA: 79 bpgenomic: 4,058
Reverse (1414,21)GATGGGATGGCAAGGTAGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.311 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTG
ACTACCTTGCCATCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)79937 - 1015
NM_018400 (SCN3B)791336 - 1414
Exon 4 To Exon 5 (Pair 16)
Forward (1291,22)TGTACATCCTTCTGGTCTTCCTAmplicon SizecDNA: 180 bpgenomic: 4,159
Reverse (1470,22)TCACACTGCTCCTGTTCTATTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol in 3' area
Forward Dimers-1.244 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-0.834 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACA
GAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCC
CATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)180892 - 1071
NM_018400 (SCN3B)1801291 - 1470
Exon 4 To Exon 5 (Pair 17)
Forward (1335,24)ATGATATATTGCTACAGAAAGGTCAmplicon SizecDNA: 81 bpgenomic: 4,060
Reverse (1415,21)AGATGGGATGGCAAGGTAGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCT
GACTACCTTGCCATCCCATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)81936 - 1016
NM_018400 (SCN3B)811335 - 1415
Exon 4 To Exon 5 (Pair 18)
Forward (1329,24)ATCGAGATGATATATTGCTACAGAAmplicon SizecDNA: 87 bpgenomic: 4,066
Reverse (1415,21)AGATGGGATGGCAAGGTAGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.022 kcal/mol
Forward Dimers-1.262 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAAC
GCGTCTGACTACCTTGCCATCCCATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)871329 - 1415
NM_001040151 (SCN3B)87930 - 1016
Exon 4 To Exon 5 (Pair 19)
Forward (1325,23)GCTCATCGAGATGATATATTGCTAmplicon SizecDNA: 94 bpgenomic: 4,073
Reverse (1418,21)CTCAGATGGGATGGCAAGGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.736 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGA
AAACGCGTCTGACTACCTTGCCATCCCATCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)941325 - 1418
NM_001040151 (SCN3B)94926 - 1019
Exon 4 To Exon 5 (Pair 20)
Forward (1327,24)TCATCGAGATGATATATTGCTACAAmplicon SizecDNA: 145 bpgenomic: 4,124
Reverse (1471,22)GTCACACTGCTCCTGTTCTATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAA
ACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGG
AGGAATAGAACAGGAGCAGTGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1451327 - 1471
NM_001040151 (SCN3B)145928 - 1072
Exon 4 To Exon 5 (Pair 21)
Forward (1267,22)CCTCTGTGGTCTCAGAAATCATAmplicon SizecDNA: 147 bpgenomic: 4,126
Reverse (1413,21)ATGGGATGGCAAGGTAGTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceCCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGC
TCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAA
ACGCGTCTGACTACCTTGCCATCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1471267 - 1413
NM_001040151 (SCN3B)147868 - 1014
Exon 4 To Exon 5 (Pair 22)
Forward (1322,23)GCTGCTCATCGAGATGATATATTAmplicon SizecDNA: 149 bpgenomic: 4,128
Reverse (1470,22)TCACACTGCTCCTGTTCTATTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCA
AGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACC
AGTGGAGGAATAGAACAGGAGCAGTGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1491322 - 1470
NM_001040151 (SCN3B)149923 - 1071
Exon 4 To Exon 5 (Pair 23)
Forward (1267,22)CCTCTGTGGTCTCAGAAATCATAmplicon SizecDNA: 206 bpgenomic: 4,185
Reverse (1472,22)TGTCACACTGCTCCTGTTCTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.442 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGC
TCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAA
ACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGG
AGGAATAGAACAGGAGCAGTGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)2061267 - 1472
NM_001040151 (SCN3B)206868 - 1073
Exon 4 To Exon 5 (Pair 24)
Forward (1323,23)CTGCTCATCGAGATGATATATTGAmplicon SizecDNA: 150 bpgenomic: 4,129
Reverse (1472,22)TGTCACACTGCTCCTGTTCTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.442 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAA
GAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCA
GTGGAGGAATAGAACAGGAGCAGTGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1501323 - 1472
NM_001040151 (SCN3B)150924 - 1073
Exon 4 To Exon 5 (Pair 25)
Forward (1334,24)GATGATATATTGCTACAGAAAGGTAmplicon SizecDNA: 138 bpgenomic: 4,117
Reverse (1471,22)GTCACACTGCTCCTGTTCTATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-2.294 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTC
TGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATA
GAACAGGAGCAGTGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1381334 - 1471
NM_001040151 (SCN3B)138935 - 1072
Exon 4 To Exon 5 (Pair 26)
Forward (1329,24)ATCGAGATGATATATTGCTACAGAAmplicon SizecDNA: 88 bpgenomic: 4,067
Reverse (1416,21)CAGATGGGATGGCAAGGTAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.022 kcal/mol
Forward Dimers-1.262 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAAC
GCGTCTGACTACCTTGCCATCCCATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)881329 - 1416
NM_001040151 (SCN3B)88930 - 1017
Exon 4 To Exon 5 (Pair 27)
Forward (1335,24)ATGATATATTGCTACAGAAAGGTCAmplicon SizecDNA: 90 bpgenomic: 4,069
Reverse (1424,21)CTTGTTCTCAGATGGGATGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops1.806 kcal/mol
Reverse Dimers-0.412 kcal/mol
Forward-Reverse Dimers-1.124 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCT
GACTACCTTGCCATCCCATCTGAGAACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)90936 - 1025
NM_018400 (SCN3B)901335 - 1424
Exon 4 To Exon 5 (Pair 28)
Forward (1334,24)GATGATATATTGCTACAGAAAGGTAmplicon SizecDNA: 84 bpgenomic: 4,063
Reverse (1417,21)TCAGATGGGATGGCAAGGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTC
TGACTACCTTGCCATCCCATCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)84935 - 1018
NM_018400 (SCN3B)841334 - 1417
Exon 4 To Exon 5 (Pair 29)
Forward (1301,21)TCTGGTCTTCCTCACCTTGTGAmplicon SizecDNA: 124 bpgenomic: 4,103
Reverse (1424,21)CTTGTTCTCAGATGGGATGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol
Forward Dimers-1.185 kcal/mol
Reverse Loops1.806 kcal/mol
Reverse Dimers-0.412 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTC
AAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAA
CAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1241301 - 1424
NM_001040151 (SCN3B)124902 - 1025
Exon 4 To Exon 5 (Pair 30)
Forward (1293,22)TACATCCTTCTGGTCTTCCTCAAmplicon SizecDNA: 181 bpgenomic: 4,160
Reverse (1473,22)ATGTCACACTGCTCCTGTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.507 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGA
AAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCA
TCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGTGACA
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)181894 - 1074
NM_018400 (SCN3B)1811293 - 1473
Exon 4 To Exon 5 (Pair 31)
Forward (1293,22)TACATCCTTCTGGTCTTCCTCAAmplicon SizecDNA: 176 bpgenomic: 4,155
Reverse (1468,22)ACACTGCTCCTGTTCTATTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops2.062 kcal/mol
Reverse Dimers0.036 kcal/mol
Forward-Reverse Dimers-0.627 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGA
AAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCA
TCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)176894 - 1069
NM_018400 (SCN3B)1761293 - 1468
Exon 4 To Exon 5 (Pair 32)
Forward (1329,24)ATCGAGATGATATATTGCTACAGAAmplicon SizecDNA: 86 bpgenomic: 4,065
Reverse (1414,21)GATGGGATGGCAAGGTAGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.022 kcal/mol
Forward Dimers-1.262 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAAC
GCGTCTGACTACCTTGCCATCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)86930 - 1015
NM_018400 (SCN3B)861329 - 1414
Exon 4 To Exon 5 (Pair 33)
Forward (1327,24)TCATCGAGATGATATATTGCTACAAmplicon SizecDNA: 137 bpgenomic: 4,116
Reverse (1463,21)GCTCCTGTTCTATTCCTCCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.633 kcal/mol
Reverse Dimers0.311 kcal/mol in 3' area
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAA
ACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGG
AGGAATAGAACAGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)137928 - 1064
NM_018400 (SCN3B)1371327 - 1463
Exon 4 To Exon 5 (Pair 34)
Forward (1321,22)GGCTGCTCATCGAGATGATATAAmplicon SizecDNA: 98 bpgenomic: 4,077
Reverse (1418,21)CTCAGATGGGATGGCAAGGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol in 3' area
Forward Dimers-1.557 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.736 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceGGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCC
AAGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)98922 - 1019
NM_018400 (SCN3B)981321 - 1418
Exon 4 To Exon 5 (Pair 35)
Forward (1325,23)GCTCATCGAGATGATATATTGCTAmplicon SizecDNA: 147 bpgenomic: 4,126
Reverse (1471,22)GTCACACTGCTCCTGTTCTATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGA
AAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGT
GGAGGAATAGAACAGGAGCAGTGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1471325 - 1471
NM_001040151 (SCN3B)147926 - 1072
Exon 4 To Exon 5 (Pair 36)
Forward (1290,22)ATGTACATCCTTCTGGTCTTCCAmplicon SizecDNA: 128 bpgenomic: 4,107
Reverse (1417,21)TCAGATGGGATGGCAAGGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol
Forward Dimers-2.998 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTAC
AGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATC
CCATCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)128891 - 1018
NM_018400 (SCN3B)1281290 - 1417
Exon 4 To Exon 5 (Pair 37)
Forward (1301,21)TCTGGTCTTCCTCACCTTGTGAmplicon SizecDNA: 165 bpgenomic: 4,144
Reverse (1465,21)CTGCTCCTGTTCTATTCCTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol
Forward Dimers-1.185 kcal/mol
Reverse Loops2.555 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.267 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTC
AAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAA
CAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)165902 - 1066
NM_018400 (SCN3B)1651301 - 1465
Exon 4 To Exon 5 (Pair 38)
Forward (1295,21)CATCCTTCTGGTCTTCCTCACAmplicon SizecDNA: 171 bpgenomic: 4,150
Reverse (1465,21)CTGCTCCTGTTCTATTCCTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops2.555 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.212 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGAAA
GGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCATC
TGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1711295 - 1465
NM_001040151 (SCN3B)171896 - 1066
Exon 4 To Exon 5 (Pair 39)
Forward (1290,22)ATGTACATCCTTCTGGTCTTCCAmplicon SizecDNA: 179 bpgenomic: 4,158
Reverse (1468,22)ACACTGCTCCTGTTCTATTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol
Forward Dimers-2.998 kcal/mol
Reverse Loops2.062 kcal/mol
Reverse Dimers0.036 kcal/mol
Forward-Reverse Dimers-0.661 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTAC
AGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATC
CCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1791290 - 1468
NM_001040151 (SCN3B)179891 - 1069
Exon 4 To Exon 5 (Pair 40)
Forward (1336,24)TGATATATTGCTACAGAAAGGTCTAmplicon SizecDNA: 137 bpgenomic: 4,116
Reverse (1472,22)TGTCACACTGCTCCTGTTCTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.311 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.442 kcal/mol
Forward-Reverse Dimers-2.294 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTG
ACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGA
ACAGGAGCAGTGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1371336 - 1472
NM_001040151 (SCN3B)137937 - 1073
Exon 4 To Exon 5 (Pair 41)
Forward (1333,24)AGATGATATATTGCTACAGAAAGGAmplicon SizecDNA: 83 bpgenomic: 4,062
Reverse (1415,21)AGATGGGATGGCAAGGTAGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGT
CTGACTACCTTGCCATCCCATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)83934 - 1016
NM_018400 (SCN3B)831333 - 1415
Exon 4 To Exon 5 (Pair 42)
Forward (1324,23)TGCTCATCGAGATGATATATTGCAmplicon SizecDNA: 145 bpgenomic: 4,124
Reverse (1468,22)ACACTGCTCCTGTTCTATTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.062 kcal/mol
Reverse Dimers0.036 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAG
AAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAG
TGGAGGAATAGAACAGGAGCAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)145925 - 1069
NM_018400 (SCN3B)1451324 - 1468
Exon 4 To Exon 5 (Pair 43)
Forward (1290,22)ATGTACATCCTTCTGGTCTTCCAmplicon SizecDNA: 174 bpgenomic: 4,153
Reverse (1463,21)GCTCCTGTTCTATTCCTCCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol
Forward Dimers-2.998 kcal/mol
Reverse Loops2.633 kcal/mol
Reverse Dimers0.311 kcal/mol in 3' area
Forward-Reverse Dimers-0.627 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTAC
AGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATC
CCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)174891 - 1064
NM_018400 (SCN3B)1741290 - 1463
Exon 4 To Exon 5 (Pair 44)
Forward (1333,24)AGATGATATATTGCTACAGAAAGGAmplicon SizecDNA: 85 bpgenomic: 4,064
Reverse (1417,21)TCAGATGGGATGGCAAGGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGT
CTGACTACCTTGCCATCCCATCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)85934 - 1018
NM_018400 (SCN3B)851333 - 1417
Exon 4 To Exon 5 (Pair 45)
Forward (1322,23)GCTGCTCATCGAGATGATATATTAmplicon SizecDNA: 144 bpgenomic: 4,123
Reverse (1465,21)CTGCTCCTGTTCTATTCCTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.555 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCA
AGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACC
AGTGGAGGAATAGAACAGGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)144923 - 1066
NM_018400 (SCN3B)1441322 - 1465
Exon 4 To Exon 5 (Pair 46)
Forward (1336,24)TGATATATTGCTACAGAAAGGTCTAmplicon SizecDNA: 78 bpgenomic: 4,057
Reverse (1413,21)ATGGGATGGCAAGGTAGTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.311 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTG
ACTACCTTGCCATCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)78937 - 1014
NM_018400 (SCN3B)781336 - 1413
Exon 4 To Exon 5 (Pair 47)
Forward (1325,23)GCTCATCGAGATGATATATTGCTAmplicon SizecDNA: 91 bpgenomic: 4,070
Reverse (1415,21)AGATGGGATGGCAAGGTAGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.736 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGA
AAACGCGTCTGACTACCTTGCCATCCCATCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)91926 - 1016
NM_018400 (SCN3B)911325 - 1415
Exon 4 To Exon 5 (Pair 48)
Forward (1336,24)TGATATATTGCTACAGAAAGGTCTAmplicon SizecDNA: 82 bpgenomic: 4,061
Reverse (1417,21)TCAGATGGGATGGCAAGGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.311 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTG
ACTACCTTGCCATCCCATCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)821336 - 1417
NM_001040151 (SCN3B)82937 - 1018
Exon 4 To Exon 5 (Pair 49)
Forward (1331,24)CGAGATGATATATTGCTACAGAAAAmplicon SizecDNA: 86 bpgenomic: 4,065
Reverse (1416,21)CAGATGGGATGGCAAGGTAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGC
GTCTGACTACCTTGCCATCCCATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)861331 - 1416
NM_001040151 (SCN3B)86932 - 1017
Exon 4 To Exon 5 (Pair 50)
Forward (1321,22)GGCTGCTCATCGAGATGATATAAmplicon SizecDNA: 97 bpgenomic: 4,076
Reverse (1417,21)TCAGATGGGATGGCAAGGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol in 3' area
Forward Dimers-1.557 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.736 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceGGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCC
AAGAAAACGCGTCTGACTACCTTGCCATCCCATCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)97922 - 1018
NM_018400 (SCN3B)971321 - 1417
Exon 4 To Exon 5 (Pair 51)
Forward (1323,23)CTGCTCATCGAGATGATATATTGAmplicon SizecDNA: 146 bpgenomic: 4,125
Reverse (1468,22)ACACTGCTCCTGTTCTATTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.062 kcal/mol
Reverse Dimers0.036 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAA
GAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCA
GTGGAGGAATAGAACAGGAGCAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)146924 - 1069
NM_018400 (SCN3B)1461323 - 1468
Exon 4 To Exon 5 (Pair 52)
Forward (1324,23)TGCTCATCGAGATGATATATTGCAmplicon SizecDNA: 147 bpgenomic: 4,126
Reverse (1470,22)TCACACTGCTCCTGTTCTATTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAG
AAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAG
TGGAGGAATAGAACAGGAGCAGTGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1471324 - 1470
NM_001040151 (SCN3B)147925 - 1071
Exon 4 To Exon 5 (Pair 53)
Forward (1322,23)GCTGCTCATCGAGATGATATATTAmplicon SizecDNA: 150 bpgenomic: 4,129
Reverse (1471,22)GTCACACTGCTCCTGTTCTATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCA
AGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACC
AGTGGAGGAATAGAACAGGAGCAGTGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1501322 - 1471
NM_001040151 (SCN3B)150923 - 1072
Exon 4 To Exon 5 (Pair 54)
Forward (1266,22)ACCTCTGTGGTCTCAGAAATCAAmplicon SizecDNA: 147 bpgenomic: 4,126
Reverse (1412,21)TGGGATGGCAAGGTAGTCAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.132 kcal/mol
Forward Dimers-0.711 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-2.594 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTG
CTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAA
AACGCGTCTGACTACCTTGCCATCCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1471266 - 1412
NM_001040151 (SCN3B)147867 - 1013
Exon 4 To Exon 5 (Pair 55)
Forward (1266,22)ACCTCTGTGGTCTCAGAAATCAAmplicon SizecDNA: 148 bpgenomic: 4,127
Reverse (1413,21)ATGGGATGGCAAGGTAGTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.132 kcal/mol
Forward Dimers-0.711 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-2.594 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTG
CTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAA
AACGCGTCTGACTACCTTGCCATCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1481266 - 1413
NM_001040151 (SCN3B)148867 - 1014
Exon 4 To Exon 5 (Pair 56)
Forward (1267,22)CCTCTGTGGTCTCAGAAATCATAmplicon SizecDNA: 210 bpgenomic: 4,189
Reverse (1476,21)CTCATGTCACACTGCTCCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGC
TCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAA
ACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGG
AGGAATAGAACAGGAGCAGTGTGACATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)2101267 - 1476
NM_001040151 (SCN3B)210868 - 1077
Exon 4 To Exon 5 (Pair 57)
Forward (1325,23)GCTCATCGAGATGATATATTGCTAmplicon SizecDNA: 92 bpgenomic: 4,071
Reverse (1416,21)CAGATGGGATGGCAAGGTAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.736 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGA
AAACGCGTCTGACTACCTTGCCATCCCATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)921325 - 1416
NM_001040151 (SCN3B)92926 - 1017
Exon 4 To Exon 5 (Pair 58)
Forward (1291,22)TGTACATCCTTCTGGTCTTCCTAmplicon SizecDNA: 181 bpgenomic: 4,160
Reverse (1471,22)GTCACACTGCTCCTGTTCTATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol in 3' area
Forward Dimers-1.244 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-0.834 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACA
GAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCC
CATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGTGA
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1811291 - 1471
NM_001040151 (SCN3B)181892 - 1072
Exon 4 To Exon 5 (Pair 59)
Forward (1290,22)ATGTACATCCTTCTGGTCTTCCAmplicon SizecDNA: 184 bpgenomic: 4,163
Reverse (1473,22)ATGTCACACTGCTCCTGTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol
Forward Dimers-2.998 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.507 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTAC
AGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATC
CCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGTG
ACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)184891 - 1074
NM_018400 (SCN3B)1841290 - 1473
Exon 4 To Exon 5 (Pair 60)
Forward (1322,23)GCTGCTCATCGAGATGATATATTAmplicon SizecDNA: 142 bpgenomic: 4,121
Reverse (1463,21)GCTCCTGTTCTATTCCTCCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.633 kcal/mol
Reverse Dimers0.311 kcal/mol in 3' area
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCA
AGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACC
AGTGGAGGAATAGAACAGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)142923 - 1064
NM_018400 (SCN3B)1421322 - 1463
Exon 4 To Exon 5 (Pair 61)
Forward (1290,22)ATGTACATCCTTCTGGTCTTCCAmplicon SizecDNA: 183 bpgenomic: 4,162
Reverse (1472,22)TGTCACACTGCTCCTGTTCTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol
Forward Dimers-2.998 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.442 kcal/mol
Forward-Reverse Dimers-1.135 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTAC
AGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATC
CCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGTG
ACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)183891 - 1073
NM_018400 (SCN3B)1831290 - 1472
Exon 4 To Exon 5 (Pair 62)
Forward (1313,20)CACCTTGTGGCTGCTCATCGAmplicon SizecDNA: 153 bpgenomic: 4,132
Reverse (1465,21)CTGCTCCTGTTCTATTCCTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.093 kcal/mol
Forward Dimers-1.07 kcal/mol
Reverse Loops2.555 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-0.426 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGA
GGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTC
TGCGGTACCAGTGGAGGAATAGAACAGGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1531313 - 1465
NM_001040151 (SCN3B)153914 - 1066
Exon 4 To Exon 5 (Pair 63)
Forward (1290,22)ATGTACATCCTTCTGGTCTTCCAmplicon SizecDNA: 181 bpgenomic: 4,160
Reverse (1470,22)TCACACTGCTCCTGTTCTATTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol
Forward Dimers-2.998 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-1.135 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTAC
AGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATC
CCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGTG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1811290 - 1470
NM_001040151 (SCN3B)181891 - 1071
Exon 4 To Exon 5 (Pair 64)
Forward (1267,22)CCTCTGTGGTCTCAGAAATCATAmplicon SizecDNA: 202 bpgenomic: 4,181
Reverse (1468,22)ACACTGCTCCTGTTCTATTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops2.062 kcal/mol
Reverse Dimers0.036 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGC
TCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAA
ACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGG
AGGAATAGAACAGGAGCAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)202868 - 1069
NM_018400 (SCN3B)2021267 - 1468
Exon 4 To Exon 5 (Pair 65)
Forward (1268,22)CTCTGTGGTCTCAGAAATCATGAmplicon SizecDNA: 198 bpgenomic: 4,177
Reverse (1465,21)CTGCTCCTGTTCTATTCCTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops2.555 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.057 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCT
CATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAA
CGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGA
GGAATAGAACAGGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1981268 - 1465
NM_001040151 (SCN3B)198869 - 1066
Exon 4 To Exon 5 (Pair 66)
Forward (1335,24)ATGATATATTGCTACAGAAAGGTCAmplicon SizecDNA: 79 bpgenomic: 4,058
Reverse (1413,21)ATGGGATGGCAAGGTAGTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCT
GACTACCTTGCCATCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)79936 - 1014
NM_018400 (SCN3B)791335 - 1413
Exon 4 To Exon 5 (Pair 67)
Forward (1268,22)CTCTGTGGTCTCAGAAATCATGAmplicon SizecDNA: 201 bpgenomic: 4,180
Reverse (1468,22)ACACTGCTCCTGTTCTATTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops2.062 kcal/mol
Reverse Dimers0.036 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCT
CATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAA
CGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGA
GGAATAGAACAGGAGCAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)2011268 - 1468
NM_001040151 (SCN3B)201869 - 1069
Exon 4 To Exon 5 (Pair 68)
Forward (1293,22)TACATCCTTCTGGTCTTCCTCAAmplicon SizecDNA: 120 bpgenomic: 4,099
Reverse (1412,21)TGGGATGGCAAGGTAGTCAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGA
AAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)120894 - 1013
NM_018400 (SCN3B)1201293 - 1412
Exon 4 To Exon 5 (Pair 69)
Forward (1331,24)CGAGATGATATATTGCTACAGAAAAmplicon SizecDNA: 84 bpgenomic: 4,063
Reverse (1414,21)GATGGGATGGCAAGGTAGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGC
GTCTGACTACCTTGCCATCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)84932 - 1015
NM_018400 (SCN3B)841331 - 1414
Exon 4 To Exon 5 (Pair 70)
Forward (1323,23)CTGCTCATCGAGATGATATATTGAmplicon SizecDNA: 141 bpgenomic: 4,120
Reverse (1463,21)GCTCCTGTTCTATTCCTCCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.633 kcal/mol
Reverse Dimers0.311 kcal/mol in 3' area
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAA
GAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCA
GTGGAGGAATAGAACAGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1411323 - 1463
NM_001040151 (SCN3B)141924 - 1064
Exon 4 To Exon 5 (Pair 71)
Forward (1336,24)TGATATATTGCTACAGAAAGGTCTAmplicon SizecDNA: 136 bpgenomic: 4,115
Reverse (1471,22)GTCACACTGCTCCTGTTCTATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.311 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-2.294 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTG
ACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGA
ACAGGAGCAGTGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1361336 - 1471
NM_001040151 (SCN3B)136937 - 1072
Exon 4 To Exon 5 (Pair 72)
Forward (1266,22)ACCTCTGTGGTCTCAGAAATCAAmplicon SizecDNA: 208 bpgenomic: 4,187
Reverse (1473,22)ATGTCACACTGCTCCTGTTCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.132 kcal/mol
Forward Dimers-0.711 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceACCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTG
CTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAA
AACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTG
GAGGAATAGAACAGGAGCAGTGTGACAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)2081266 - 1473
NM_001040151 (SCN3B)208867 - 1074
Exon 4 To Exon 5 (Pair 73)
Forward (1267,22)CCTCTGTGGTCTCAGAAATCATAmplicon SizecDNA: 148 bpgenomic: 4,127
Reverse (1414,21)GATGGGATGGCAAGGTAGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.19 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceCCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGC
TCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAA
ACGCGTCTGACTACCTTGCCATCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1481267 - 1414
NM_001040151 (SCN3B)148868 - 1015
Exon 4 To Exon 5 (Pair 74)
Forward (1293,22)TACATCCTTCTGGTCTTCCTCAAmplicon SizecDNA: 171 bpgenomic: 4,150
Reverse (1463,21)GCTCCTGTTCTATTCCTCCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops2.633 kcal/mol
Reverse Dimers0.311 kcal/mol in 3' area
Forward-Reverse Dimers-0.627 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGA
AAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCA
TCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1711293 - 1463
NM_001040151 (SCN3B)171894 - 1064
Exon 4 To Exon 5 (Pair 75)
Forward (1331,24)CGAGATGATATATTGCTACAGAAAAmplicon SizecDNA: 83 bpgenomic: 4,062
Reverse (1413,21)ATGGGATGGCAAGGTAGTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGC
GTCTGACTACCTTGCCATCCCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)831331 - 1413
NM_001040151 (SCN3B)83932 - 1014
Exon 4 To Exon 5 (Pair 76)
Forward (1335,24)ATGATATATTGCTACAGAAAGGTCAmplicon SizecDNA: 83 bpgenomic: 4,062
Reverse (1417,21)TCAGATGGGATGGCAAGGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCT
GACTACCTTGCCATCCCATCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)831335 - 1417
NM_001040151 (SCN3B)83936 - 1018
Exon 4 To Exon 5 (Pair 77)
Forward (1335,24)ATGATATATTGCTACAGAAAGGTCAmplicon SizecDNA: 138 bpgenomic: 4,117
Reverse (1472,22)TGTCACACTGCTCCTGTTCTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.442 kcal/mol
Forward-Reverse Dimers-2.294 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCT
GACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAG
AACAGGAGCAGTGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1381335 - 1472
NM_001040151 (SCN3B)138936 - 1073
Exon 4 To Exon 5 (Pair 78)
Forward (1336,24)TGATATATTGCTACAGAAAGGTCTAmplicon SizecDNA: 128 bpgenomic: 4,107
Reverse (1463,21)GCTCCTGTTCTATTCCTCCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.311 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops2.633 kcal/mol
Reverse Dimers0.311 kcal/mol in 3' area
Forward-Reverse Dimers-2.294 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTG
ACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGA
ACAGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1281336 - 1463
NM_001040151 (SCN3B)128937 - 1064
Exon 4 To Exon 5 (Pair 79)
Forward (1290,22)ATGTACATCCTTCTGGTCTTCCAmplicon SizecDNA: 185 bpgenomic: 4,164
Reverse (1474,21)CATGTCACACTGCTCCTGTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol
Forward Dimers-2.998 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.981 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTAC
AGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATC
CCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGTG
ACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)185891 - 1075
NM_018400 (SCN3B)1851290 - 1474
Exon 4 To Exon 5 (Pair 80)
Forward (1291,22)TGTACATCCTTCTGGTCTTCCTAmplicon SizecDNA: 178 bpgenomic: 4,157
Reverse (1468,22)ACACTGCTCCTGTTCTATTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol in 3' area
Forward Dimers-1.244 kcal/mol
Reverse Loops2.062 kcal/mol
Reverse Dimers0.036 kcal/mol
Forward-Reverse Dimers-0.627 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACA
GAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCC
CATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1781291 - 1468
NM_001040151 (SCN3B)178892 - 1069
Exon 4 To Exon 5 (Pair 81)
Forward (1330,24)TCGAGATGATATATTGCTACAGAAAmplicon SizecDNA: 88 bpgenomic: 4,067
Reverse (1417,21)TCAGATGGGATGGCAAGGTAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.57 kcal/mol
Forward Dimers-1.184 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACG
CGTCTGACTACCTTGCCATCCCATCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)881330 - 1417
NM_001040151 (SCN3B)88931 - 1018
Exon 4 To Exon 5 (Pair 82)
Forward (1267,22)CCTCTGTGGTCTCAGAAATCATAmplicon SizecDNA: 208 bpgenomic: 4,187
Reverse (1474,21)CATGTCACACTGCTCCTGTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGC
TCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAA
ACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGG
AGGAATAGAACAGGAGCAGTGTGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)2081267 - 1474
NM_001040151 (SCN3B)208868 - 1075
Exon 4 To Exon 5 (Pair 83)
Forward (1266,22)ACCTCTGTGGTCTCAGAAATCAAmplicon SizecDNA: 206 bpgenomic: 4,185
Reverse (1471,22)GTCACACTGCTCCTGTTCTATTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.132 kcal/mol
Forward Dimers-0.711 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceACCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTG
CTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAA
AACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTG
GAGGAATAGAACAGGAGCAGTGTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)2061266 - 1471
NM_001040151 (SCN3B)206867 - 1072
Exon 4 To Exon 5 (Pair 84)
Forward (1268,22)CTCTGTGGTCTCAGAAATCATGAmplicon SizecDNA: 157 bpgenomic: 4,136
Reverse (1424,21)CTTGTTCTCAGATGGGATGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops1.806 kcal/mol
Reverse Dimers-0.412 kcal/mol
Forward-Reverse Dimers-1.124 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCT
CATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAA
CGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1571268 - 1424
NM_001040151 (SCN3B)157869 - 1025
Exon 4 To Exon 5 (Pair 85)
Forward (1313,20)CACCTTGTGGCTGCTCATCGAmplicon SizecDNA: 160 bpgenomic: 4,139
Reverse (1472,22)TGTCACACTGCTCCTGTTCTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.093 kcal/mol
Forward Dimers-1.07 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.442 kcal/mol
Forward-Reverse Dimers-1.567 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGA
GGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTC
TGCGGTACCAGTGGAGGAATAGAACAGGAGCAGTGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1601313 - 1472
NM_001040151 (SCN3B)160914 - 1073
Exon 4 To Exon 5 (Pair 86)
Forward (1268,22)CTCTGTGGTCTCAGAAATCATGAmplicon SizecDNA: 205 bpgenomic: 4,184
Reverse (1472,22)TGTCACACTGCTCCTGTTCTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.442 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCT
CATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAA
CGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGA
GGAATAGAACAGGAGCAGTGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)205869 - 1073
NM_018400 (SCN3B)2051268 - 1472
Exon 4 To Exon 5 (Pair 87)
Forward (1267,22)CCTCTGTGGTCTCAGAAATCATAmplicon SizecDNA: 158 bpgenomic: 4,137
Reverse (1424,21)CTTGTTCTCAGATGGGATGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops1.806 kcal/mol
Reverse Dimers-0.412 kcal/mol
Forward-Reverse Dimers-1.124 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceCCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGC
TCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAA
ACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)158868 - 1025
NM_018400 (SCN3B)1581267 - 1424
Exon 4 To Exon 5 (Pair 88)
Forward (1268,22)CTCTGTGGTCTCAGAAATCATGAmplicon SizecDNA: 203 bpgenomic: 4,182
Reverse (1470,22)TCACACTGCTCCTGTTCTATTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.438 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCT
CATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAA
CGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGA
GGAATAGAACAGGAGCAGTGTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)203869 - 1071
NM_018400 (SCN3B)2031268 - 1470
Exon 4 To Exon 5 (Pair 89)
Forward (1268,22)CTCTGTGGTCTCAGAAATCATGAmplicon SizecDNA: 207 bpgenomic: 4,186
Reverse (1474,21)CATGTCACACTGCTCCTGTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.029 kcal/mol
Forward Dimers-0.537 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.417 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceCTCTGTGGTCTCAGAAATCATGATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCT
CATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAA
CGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGTGGA
GGAATAGAACAGGAGCAGTGTGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)2071268 - 1474
NM_001040151 (SCN3B)207869 - 1075
Exon 4 To Exon 5 (Pair 90)
Forward (1324,23)TGCTCATCGAGATGATATATTGCAmplicon SizecDNA: 142 bpgenomic: 4,121
Reverse (1465,21)CTGCTCCTGTTCTATTCCTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.555 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAG
AAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAG
TGGAGGAATAGAACAGGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)142925 - 1066
NM_018400 (SCN3B)1421324 - 1465
Exon 4 To Exon 5 (Pair 91)
Forward (1290,22)ATGTACATCCTTCTGGTCTTCCAmplicon SizecDNA: 125 bpgenomic: 4,104
Reverse (1414,21)GATGGGATGGCAAGGTAGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.513 kcal/mol
Forward Dimers-2.998 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceATGTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTAC
AGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATC
CCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)125891 - 1015
NM_018400 (SCN3B)1251290 - 1414
Exon 4 To Exon 5 (Pair 92)
Forward (1321,22)GGCTGCTCATCGAGATGATATAAmplicon SizecDNA: 156 bpgenomic: 4,135
Reverse (1476,21)CTCATGTCACACTGCTCCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol in 3' area
Forward Dimers-1.557 kcal/mol
Reverse Loops2.093 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.346 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceGGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCC
AAGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTAC
CAGTGGAGGAATAGAACAGGAGCAGTGTGACATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1561321 - 1476
NM_001040151 (SCN3B)156922 - 1077
Exon 4 To Exon 5 (Pair 93)
Forward (1293,22)TACATCCTTCTGGTCTTCCTCAAmplicon SizecDNA: 124 bpgenomic: 4,103
Reverse (1416,21)CAGATGGGATGGCAAGGTAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.484 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-2.409 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTACATCCTTCTGGTCTTCCTCACCTTGTGGCTGCTCATCGAGATGATATATTGCTACAGA
AAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCTGACTACCTTGCCATCCCA
TCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1241293 - 1416
NM_001040151 (SCN3B)124894 - 1017
Exon 4 To Exon 5 (Pair 94)
Forward (1333,24)AGATGATATATTGCTACAGAAAGGAmplicon SizecDNA: 82 bpgenomic: 4,061
Reverse (1414,21)GATGGGATGGCAAGGTAGTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.633 kcal/mol
Forward Dimers-1 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGT
CTGACTACCTTGCCATCCCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)821333 - 1414
NM_001040151 (SCN3B)82934 - 1015
Exon 4 To Exon 5 (Pair 95)
Forward (1322,23)GCTGCTCATCGAGATGATATATTAmplicon SizecDNA: 151 bpgenomic: 4,130
Reverse (1472,22)TGTCACACTGCTCCTGTTCTATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.588 kcal/mol
Reverse Dimers-0.442 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceGCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCA
AGAAAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACC
AGTGGAGGAATAGAACAGGAGCAGTGTGACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1511322 - 1472
NM_001040151 (SCN3B)151923 - 1073
Exon 4 To Exon 5 (Pair 96)
Forward (1325,23)GCTCATCGAGATGATATATTGCTAmplicon SizecDNA: 141 bpgenomic: 4,120
Reverse (1465,21)CTGCTCCTGTTCTATTCCTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.555 kcal/mol
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGA
AAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGT
GGAGGAATAGAACAGGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)141926 - 1066
NM_018400 (SCN3B)1411325 - 1465
Exon 4 To Exon 5 (Pair 97)
Forward (1335,24)ATGATATATTGCTACAGAAAGGTCAmplicon SizecDNA: 82 bpgenomic: 4,061
Reverse (1416,21)CAGATGGGATGGCAAGGTAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol in 3' area
Forward Dimers-1 kcal/mol
Reverse Loops2.009 kcal/mol
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.743 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGAAAACGCGTCT
GACTACCTTGCCATCCCATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)821335 - 1416
NM_001040151 (SCN3B)82936 - 1017
Exon 4 To Exon 5 (Pair 98)
Forward (1323,23)CTGCTCATCGAGATGATATATTGAmplicon SizecDNA: 90 bpgenomic: 4,069
Reverse (1412,21)TGGGATGGCAAGGTAGTCAGANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.755 kcal/mol in 3' area
Reverse Dimers-1.535 kcal/mol
Forward-Reverse Dimers-1.067 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceCTGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAA
GAAAACGCGTCTGACTACCTTGCCATCCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001040151 (SCN3B)90924 - 1013
NM_018400 (SCN3B)901323 - 1412
Exon 4 To Exon 5 (Pair 99)
Forward (1325,23)GCTCATCGAGATGATATATTGCTAmplicon SizecDNA: 139 bpgenomic: 4,118
Reverse (1463,21)GCTCCTGTTCTATTCCTCCACNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops2.633 kcal/mol
Reverse Dimers0.311 kcal/mol in 3' area
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGA
AAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGT
GGAGGAATAGAACAGGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1391325 - 1463
NM_001040151 (SCN3B)139926 - 1064
Exon 4 To Exon 5 (Pair 100)
Forward (1325,23)GCTCATCGAGATGATATATTGCTAmplicon SizecDNA: 150 bpgenomic: 4,129
Reverse (1474,21)CATGTCACACTGCTCCTGTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.548 kcal/mol
Forward Dimers-1.557 kcal/mol
Reverse Loops1.588 kcal/mol in 3' area
Reverse Dimers-0.743 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding-1.364 kcal/mol outside primersite
Amplicon SequenceGCTCATCGAGATGATATATTGCTACAGAAAGGTCTCAAAAGCCGAAGAGGCAGCCCAAGA
AAACGCGTCTGACTACCTTGCCATCCCATCTGAGAACAAGGAGAACTCTGCGGTACCAGT
GGAGGAATAGAACAGGAGCAGTGTGACATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_018400 (SCN3B)1501325 - 1474
NM_001040151 (SCN3B)150926 - 1075
 

See below for some more details.

Program Output:

Loading ...