Design Results for SCN4B

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size400
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size1000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 4 (Pair 1)
Forward (840,20)GACCTGGAGTTCAGCGACACAmplicon SizecDNA: 147 bpgenomic: 2,643
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.442 kcal/mol outside primersite
Amplicon SequenceGACCTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAGAAT
AATCTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGAC
AACACAGTGACACTCATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)147600 - 746
NM_001142349 (SCN4B)147537 - 683
Exon 3 To Exon 4 (Pair 2)
Forward (784,22)TCACTCTGGTAGGCTCTACTAAAmplicon SizecDNA: 203 bpgenomic: 2,699
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.325 kcal/mol
Forward Dimers-2.009 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.473 kcal/mol outside primersite
Amplicon SequenceTCACTCTGGTAGGCTCTACTAAGGAGAAGATGAACAACATTTCCATTGTGCTGAGGGACC
TGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAGAATAATC
TCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAACA
CAGTGACACTCATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)203544 - 746
NM_001142349 (SCN4B)203481 - 683
Exon 3 To Exon 4 (Pair 3)
Forward (799,23)CTACTAAGGAGAAGATGAACAACAmplicon SizecDNA: 188 bpgenomic: 2,684
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.293 kcal/mol
Forward Dimers-1.423 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.473 kcal/mol outside primersite
Amplicon SequenceCTACTAAGGAGAAGATGAACAACATTTCCATTGTGCTGAGGGACCTGGAGTTCAGCGACA
CGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAGAATAATCTCCAGCACCACGCCA
CCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAACACAGTGACACTCATCA
TCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)188559 - 746
NM_001142349 (SCN4B)188496 - 683
Exon 3 To Exon 4 (Pair 4)
Forward (832,20)TGCTGAGGGACCTGGAGTTCAmplicon SizecDNA: 155 bpgenomic: 2,651
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.442 kcal/mol outside primersite
Amplicon SequenceTGCTGAGGGACCTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCA
AGGAGAATAATCTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAG
AAGTGGACAACACAGTGACACTCATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)155592 - 746
NM_001142349 (SCN4B)155529 - 683
Exon 3 To Exon 4 (Pair 5)
Forward (833,20)GCTGAGGGACCTGGAGTTCAAmplicon SizecDNA: 154 bpgenomic: 2,650
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.442 kcal/mol outside primersite
Amplicon SequenceGCTGAGGGACCTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAA
GGAGAATAATCTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGA
AGTGGACAACACAGTGACACTCATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)154593 - 746
NM_001142349 (SCN4B)154530 - 683
Exon 3 To Exon 4 (Pair 6)
Forward (794,22)AGGCTCTACTAAGGAGAAGATGAmplicon SizecDNA: 193 bpgenomic: 2,689
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.231 kcal/mol
Forward Dimers-2.033 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.473 kcal/mol outside primersite
Amplicon SequenceAGGCTCTACTAAGGAGAAGATGAACAACATTTCCATTGTGCTGAGGGACCTGGAGTTCAG
CGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAGAATAATCTCCAGCACCA
CGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAACACAGTGACACT
CATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)193554 - 746
NM_001142349 (SCN4B)193491 - 683
Exon 3 To Exon 4 (Pair 7)
Forward (783,22)ATCACTCTGGTAGGCTCTACTAAmplicon SizecDNA: 204 bpgenomic: 2,700
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.325 kcal/mol
Forward Dimers-2.009 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.473 kcal/mol outside primersite
Amplicon SequenceATCACTCTGGTAGGCTCTACTAAGGAGAAGATGAACAACATTTCCATTGTGCTGAGGGAC
CTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAGAATAAT
CTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAAC
ACAGTGACACTCATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)204543 - 746
NM_001142349 (SCN4B)204480 - 683
Exon 3 To Exon 4 (Pair 8)
Forward (795,22)GGCTCTACTAAGGAGAAGATGAAmplicon SizecDNA: 192 bpgenomic: 2,688
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.231 kcal/mol
Forward Dimers-2.033 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.473 kcal/mol outside primersite
Amplicon SequenceGGCTCTACTAAGGAGAAGATGAACAACATTTCCATTGTGCTGAGGGACCTGGAGTTCAGC
GACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAGAATAATCTCCAGCACCAC
GCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAACACAGTGACACTC
ATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)192555 - 746
NM_001142349 (SCN4B)192492 - 683
Exon 3 To Exon 4 (Pair 9)
Forward (797,23)CTCTACTAAGGAGAAGATGAACAAmplicon SizecDNA: 190 bpgenomic: 2,686
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.605 kcal/mol
Forward Dimers-2.033 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.473 kcal/mol outside primersite
Amplicon SequenceCTCTACTAAGGAGAAGATGAACAACATTTCCATTGTGCTGAGGGACCTGGAGTTCAGCGA
CACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAGAATAATCTCCAGCACCACGC
CACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAACACAGTGACACTCAT
CATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)190557 - 746
NM_001142349 (SCN4B)190494 - 683
Exon 3 To Exon 4 (Pair 10)
Forward (806,23)GGAGAAGATGAACAACATTTCCAAmplicon SizecDNA: 181 bpgenomic: 2,677
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.487 kcal/mol
Forward Dimers-1.233 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.473 kcal/mol outside primersite
Amplicon SequenceGGAGAAGATGAACAACATTTCCATTGTGCTGAGGGACCTGGAGTTCAGCGACACGGGCAA
ATACACCTGCCATGTGAAGAACCCCAAGGAGAATAATCTCCAGCACCACGCCACCATCTT
CCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAACACAGTGACACTCATCATCCTGGC
T
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)181566 - 746
NM_001142349 (SCN4B)181503 - 683
Exon 3 To Exon 4 (Pair 11)
Forward (789,21)CTGGTAGGCTCTACTAAGGAGAmplicon SizecDNA: 198 bpgenomic: 2,694
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.042 kcal/mol in 3' area
Forward Dimers-2.009 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.473 kcal/mol outside primersite
Amplicon SequenceCTGGTAGGCTCTACTAAGGAGAAGATGAACAACATTTCCATTGTGCTGAGGGACCTGGAG
TTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAGAATAATCTCCAG
CACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAACACAGTG
ACACTCATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)198549 - 746
NM_001142349 (SCN4B)198486 - 683
Exon 3 To Exon 4 (Pair 12)
Forward (837,20)AGGGACCTGGAGTTCAGCGAAmplicon SizecDNA: 150 bpgenomic: 2,646
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.442 kcal/mol outside primersite
Amplicon SequenceAGGGACCTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAG
AATAATCTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTG
GACAACACAGTGACACTCATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)150597 - 746
NM_001142349 (SCN4B)150534 - 683
Exon 3 To Exon 4 (Pair 13)
Forward (835,20)TGAGGGACCTGGAGTTCAGCAmplicon SizecDNA: 152 bpgenomic: 2,648
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.442 kcal/mol outside primersite
Amplicon SequenceTGAGGGACCTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGG
AGAATAATCTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAG
TGGACAACACAGTGACACTCATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)152595 - 746
NM_001142349 (SCN4B)152532 - 683
Exon 3 To Exon 4 (Pair 14)
Forward (834,20)CTGAGGGACCTGGAGTTCAGAmplicon SizecDNA: 153 bpgenomic: 2,649
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol in 3' area
Forward Dimers-2.268 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.442 kcal/mol outside primersite
Amplicon SequenceCTGAGGGACCTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAG
GAGAATAATCTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAA
GTGGACAACACAGTGACACTCATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)153594 - 746
NM_001142349 (SCN4B)153531 - 683
Exon 3 To Exon 4 (Pair 15)
Forward (787,21)CTCTGGTAGGCTCTACTAAGGAmplicon SizecDNA: 200 bpgenomic: 2,696
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.53 kcal/mol in 3' area
Forward Dimers-2.009 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.473 kcal/mol outside primersite
Amplicon SequenceCTCTGGTAGGCTCTACTAAGGAGAAGATGAACAACATTTCCATTGTGCTGAGGGACCTGG
AGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAGAATAATCTCC
AGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAACACAG
TGACACTCATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)200547 - 746
NM_001142349 (SCN4B)200484 - 683
Exon 3 To Exon 4 (Pair 16)
Forward (839,20)GGACCTGGAGTTCAGCGACAAmplicon SizecDNA: 148 bpgenomic: 2,644
Reverse (986,21)AGCCAGGATGATGAGTGTCACNr. of Isoforms 2 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.806 kcal/mol
Forward Dimers-2.268 kcal/mol
Reverse Loops0.745 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers0 kcal/mol
Amplicon Folding-2.442 kcal/mol outside primersite
Amplicon SequenceGGACCTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGAAGAACCCCAAGGAGAA
TAATCTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGA
CAACACAGTGACACTCATCATCCTGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_174934 (SCN4B)148599 - 746
NM_001142349 (SCN4B)148536 - 683
 

See below for some more details.

Program Output:

Loading ...