Design Results for SCN8A

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 12 To Exon 13 (Pair 1)
Forward (1801,22)GATCCCGAGAAGGTGTTTAAGTAmplicon SizecDNA: 167 bpgenomic: 14,997
Reverse (1967,22)AAGATGCTGCTCTTGCTGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGG
CTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATC
CCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1671709 - 1875
NM_001177984 (SCN8A)1671709 - 1875
Exon 12 To Exon 13 (Pair 2)
Forward (1813,23)GTGTTTAAGTCAGAGTCAGAAGAAmplicon SizecDNA: 162 bpgenomic: 14,992
Reverse (1974,22)GAAACTGAAGATGCTGCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.017 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAAC
AGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCC
TTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1621721 - 1882
NM_001177984 (SCN8A)1621721 - 1882
Exon 12 To Exon 13 (Pair 3)
Forward (1739,23)AAAGACGTAACAGGAGAAAGAAGAmplicon SizecDNA: 234 bpgenomic: 15,064
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.964 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAG
GGGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTC
GGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCA
TCCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2341647 - 1880
NM_001177984 (SCN8A)2341647 - 1880
Exon 12 To Exon 13 (Pair 4)
Forward (1738,23)GAAAGACGTAACAGGAGAAAGAAAmplicon SizecDNA: 235 bpgenomic: 15,065
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.964 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceGAAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAA
GGGGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTT
CGGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGC
ATCCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2351646 - 1880
NM_014191 (SCN8A)2351646 - 1880
Exon 12 To Exon 13 (Pair 5)
Forward (1708,23)ATCTCTAAACTCAGCTCAAAGAGAmplicon SizecDNA: 266 bpgenomic: 15,096
Reverse (1973,22)AAACTGAAGATGCTGCTCTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.71 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAG
CAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAG
TCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAA
TTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCAC
AACAGCAAGAGCAGCATCTTCAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2661616 - 1881
NM_001177984 (SCN8A)2661616 - 1881
Exon 12 To Exon 13 (Pair 6)
Forward (1813,23)GTGTTTAAGTCAGAGTCAGAAGAAmplicon SizecDNA: 153 bpgenomic: 14,983
Reverse (1965,21)GATGCTGCTCTTGCTGTTGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAAC
AGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCC
TTCCTCTCCCGCCACAACAGCAAGAGCAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1531721 - 1873
NM_001177984 (SCN8A)1531721 - 1873
Exon 12 To Exon 13 (Pair 7)
Forward (1735,23)AAGGAAAGACGTAACAGGAGAAAAmplicon SizecDNA: 227 bpgenomic: 15,057
Reverse (1961,20)CTGCTCTTGCTGTTGTGGCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.081 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.144 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAG
AAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCC
TTTCGGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTC
AGCATCCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2271643 - 1869
NM_001177984 (SCN8A)2271643 - 1869
Exon 12 To Exon 13 (Pair 8)
Forward (1747,22)AACAGGAGAAAGAAGAGGAAGCAmplicon SizecDNA: 218 bpgenomic: 15,048
Reverse (1964,21)ATGCTGCTCTTGCTGTTGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers0.26 kcal/mol in 3' area
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.212 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCC
GAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCA
GACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGC
TCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2181655 - 1872
NM_001177984 (SCN8A)2181655 - 1872
Exon 12 To Exon 13 (Pair 9)
Forward (1740,23)AAGACGTAACAGGAGAAAGAAGAAmplicon SizecDNA: 231 bpgenomic: 15,061
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.964 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGG
GGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCG
GCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCAT
CCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2311648 - 1878
NM_014191 (SCN8A)2311648 - 1878
Exon 12 To Exon 13 (Pair 10)
Forward (1861,21)CTGCCAGACAACAGAATAGGGAmplicon SizecDNA: 112 bpgenomic: 14,942
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.303 kcal/mol
Forward Dimers-1.091 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATC
CCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1121769 - 1880
NM_001177984 (SCN8A)1121769 - 1880
Exon 12 To Exon 13 (Pair 11)
Forward (1816,23)TTTAAGTCAGAGTCAGAAGATGGAmplicon SizecDNA: 146 bpgenomic: 14,976
Reverse (1961,20)CTGCTCTTGCTGTTGTGGCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.75 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.081 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGA
ATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTC
CTCTCCCGCCACAACAGCAAGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1461724 - 1869
NM_014191 (SCN8A)1461724 - 1869
Exon 12 To Exon 13 (Pair 12)
Forward (1815,23)GTTTAAGTCAGAGTCAGAAGATGAmplicon SizecDNA: 150 bpgenomic: 14,980
Reverse (1964,21)ATGCTGCTCTTGCTGTTGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAG
AATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTT
CCTCTCCCGCCACAACAGCAAGAGCAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1501723 - 1872
NM_001177984 (SCN8A)1501723 - 1872
Exon 12 To Exon 13 (Pair 13)
Forward (1865,22)CAGACAACAGAATAGGGAGGAAAmplicon SizecDNA: 110 bpgenomic: 14,940
Reverse (1974,22)GAAACTGAAGATGCTGCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAG
GCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1101773 - 1882
NM_001177984 (SCN8A)1101773 - 1882
Exon 12 To Exon 13 (Pair 14)
Forward (1708,23)ATCTCTAAACTCAGCTCAAAGAGAmplicon SizecDNA: 265 bpgenomic: 15,095
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.71 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAG
CAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAG
TCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAA
TTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCAC
AACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2651616 - 1880
NM_014191 (SCN8A)2651616 - 1880
Exon 12 To Exon 13 (Pair 15)
Forward (1747,22)AACAGGAGAAAGAAGAGGAAGCAmplicon SizecDNA: 223 bpgenomic: 15,053
Reverse (1969,22)TGAAGATGCTGCTCTTGCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers0.26 kcal/mol in 3' area
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.212 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCC
GAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCA
GACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGC
TCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2231655 - 1877
NM_001177984 (SCN8A)2231655 - 1877
Exon 12 To Exon 13 (Pair 16)
Forward (1802,22)ATCCCGAGAAGGTGTTTAAGTCAmplicon SizecDNA: 160 bpgenomic: 14,990
Reverse (1961,20)CTGCTCTTGCTGTTGTGGCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.081 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGC
TGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCC
CAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1601710 - 1869
NM_001177984 (SCN8A)1601710 - 1869
Exon 12 To Exon 13 (Pair 17)
Forward (1706,24)AAATCTCTAAACTCAGCTCAAAGAAmplicon SizecDNA: 269 bpgenomic: 15,099
Reverse (1974,22)GAAACTGAAGATGCTGCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGA
AGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAG
AGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGA
AATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCC
ACAACAGCAAGAGCAGCATCTTCAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2691614 - 1882
NM_014191 (SCN8A)2691614 - 1882
Exon 12 To Exon 13 (Pair 18)
Forward (1818,22)TAAGTCAGAGTCAGAAGATGGCAmplicon SizecDNA: 156 bpgenomic: 14,986
Reverse (1973,22)AAACTGAAGATGCTGCTCTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.509 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.017 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAAT
AGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCT
CTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1561726 - 1881
NM_001177984 (SCN8A)1561726 - 1881
Exon 12 To Exon 13 (Pair 19)
Forward (1861,21)CTGCCAGACAACAGAATAGGGAmplicon SizecDNA: 113 bpgenomic: 14,943
Reverse (1973,22)AAACTGAAGATGCTGCTCTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.303 kcal/mol
Forward Dimers-1.091 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATC
CCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1131769 - 1881
NM_001177984 (SCN8A)1131769 - 1881
Exon 12 To Exon 13 (Pair 20)
Forward (1709,23)TCTCTAAACTCAGCTCAAAGAGTAmplicon SizecDNA: 259 bpgenomic: 15,089
Reverse (1967,22)AAGATGCTGCTCTTGCTGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.722 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceTCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAGC
AAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAGT
CAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAAT
TTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCACA
ACAGCAAGAGCAGCATCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2591617 - 1875
NM_001177984 (SCN8A)2591617 - 1875
Exon 12 To Exon 13 (Pair 21)
Forward (1813,23)GTGTTTAAGTCAGAGTCAGAAGAAmplicon SizecDNA: 158 bpgenomic: 14,988
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAAC
AGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCC
TTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1581721 - 1878
NM_001177984 (SCN8A)1581721 - 1878
Exon 12 To Exon 13 (Pair 22)
Forward (1801,22)GATCCCGAGAAGGTGTTTAAGTAmplicon SizecDNA: 164 bpgenomic: 14,994
Reverse (1964,21)ATGCTGCTCTTGCTGTTGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGG
CTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATC
CCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1641709 - 1872
NM_014191 (SCN8A)1641709 - 1872
Exon 12 To Exon 13 (Pair 23)
Forward (1803,22)TCCCGAGAAGGTGTTTAAGTCAAmplicon SizecDNA: 165 bpgenomic: 14,995
Reverse (1967,22)AAGATGCTGCTCTTGCTGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCT
GCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCC
AGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1651711 - 1875
NM_014191 (SCN8A)1651711 - 1875
Exon 12 To Exon 13 (Pair 24)
Forward (1818,22)TAAGTCAGAGTCAGAAGATGGCAmplicon SizecDNA: 153 bpgenomic: 14,983
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.509 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAAT
AGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCT
CTCCCGCCACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1531726 - 1878
NM_014191 (SCN8A)1531726 - 1878
Exon 12 To Exon 13 (Pair 25)
Forward (1818,22)TAAGTCAGAGTCAGAAGATGGCAmplicon SizecDNA: 152 bpgenomic: 14,982
Reverse (1969,22)TGAAGATGCTGCTCTTGCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.509 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAAT
AGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCT
CTCCCGCCACAACAGCAAGAGCAGCATCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1521726 - 1877
NM_014191 (SCN8A)1521726 - 1877
Exon 12 To Exon 13 (Pair 26)
Forward (1802,22)ATCCCGAGAAGGTGTTTAAGTCAmplicon SizecDNA: 163 bpgenomic: 14,993
Reverse (1964,21)ATGCTGCTCTTGCTGTTGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGC
TGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCC
CAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1631710 - 1872
NM_014191 (SCN8A)1631710 - 1872
Exon 12 To Exon 13 (Pair 27)
Forward (1815,23)GTTTAAGTCAGAGTCAGAAGATGAmplicon SizecDNA: 153 bpgenomic: 14,983
Reverse (1967,22)AAGATGCTGCTCTTGCTGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAG
AATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTT
CCTCTCCCGCCACAACAGCAAGAGCAGCATCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1531723 - 1875
NM_001177984 (SCN8A)1531723 - 1875
Exon 12 To Exon 13 (Pair 28)
Forward (1747,22)AACAGGAGAAAGAAGAGGAAGCAmplicon SizecDNA: 219 bpgenomic: 15,049
Reverse (1965,21)GATGCTGCTCTTGCTGTTGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers0.26 kcal/mol in 3' area
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.212 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCC
GAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCA
GACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGC
TCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2191655 - 1873
NM_001177984 (SCN8A)2191655 - 1873
Exon 12 To Exon 13 (Pair 29)
Forward (1815,23)GTTTAAGTCAGAGTCAGAAGATGAmplicon SizecDNA: 159 bpgenomic: 14,989
Reverse (1973,22)AAACTGAAGATGCTGCTCTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.017 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAG
AATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTT
CCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1591723 - 1881
NM_001177984 (SCN8A)1591723 - 1881
Exon 12 To Exon 13 (Pair 30)
Forward (1803,22)TCCCGAGAAGGTGTTTAAGTCAAmplicon SizecDNA: 168 bpgenomic: 14,998
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCT
GCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCC
AGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1681711 - 1878
NM_014191 (SCN8A)1681711 - 1878
Exon 12 To Exon 13 (Pair 31)
Forward (1866,23)AGACAACAGAATAGGGAGGAAATAmplicon SizecDNA: 105 bpgenomic: 14,935
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops3.157 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGG
CTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1051774 - 1878
NM_001177984 (SCN8A)1051774 - 1878
Exon 12 To Exon 13 (Pair 32)
Forward (1709,23)TCTCTAAACTCAGCTCAAAGAGTAmplicon SizecDNA: 265 bpgenomic: 15,095
Reverse (1973,22)AAACTGAAGATGCTGCTCTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.722 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceTCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAGC
AAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAGT
CAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAAT
TTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCACA
ACAGCAAGAGCAGCATCTTCAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2651617 - 1881
NM_001177984 (SCN8A)2651617 - 1881
Exon 12 To Exon 13 (Pair 33)
Forward (1813,23)GTGTTTAAGTCAGAGTCAGAAGAAmplicon SizecDNA: 150 bpgenomic: 14,980
Reverse (1962,20)GCTGCTCTTGCTGTTGTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAAC
AGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCC
TTCCTCTCCCGCCACAACAGCAAGAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1501721 - 1870
NM_001177984 (SCN8A)1501721 - 1870
Exon 12 To Exon 13 (Pair 34)
Forward (1818,22)TAAGTCAGAGTCAGAAGATGGCAmplicon SizecDNA: 155 bpgenomic: 14,985
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.509 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.017 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAAT
AGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCT
CTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1551726 - 1880
NM_001177984 (SCN8A)1551726 - 1880
Exon 12 To Exon 13 (Pair 35)
Forward (1866,23)AGACAACAGAATAGGGAGGAAATAmplicon SizecDNA: 107 bpgenomic: 14,937
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops3.157 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGG
CTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1071774 - 1880
NM_014191 (SCN8A)1071774 - 1880
Exon 12 To Exon 13 (Pair 36)
Forward (1815,23)GTTTAAGTCAGAGTCAGAAGATGAmplicon SizecDNA: 147 bpgenomic: 14,977
Reverse (1961,20)CTGCTCTTGCTGTTGTGGCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.081 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAG
AATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTT
CCTCTCCCGCCACAACAGCAAGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1471723 - 1869
NM_014191 (SCN8A)1471723 - 1869
Exon 12 To Exon 13 (Pair 37)
Forward (1709,23)TCTCTAAACTCAGCTCAAAGAGTAmplicon SizecDNA: 264 bpgenomic: 15,094
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.722 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceTCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAGC
AAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAGT
CAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAAT
TTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCACA
ACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2641617 - 1880
NM_001177984 (SCN8A)2641617 - 1880
Exon 12 To Exon 13 (Pair 38)
Forward (1865,22)CAGACAACAGAATAGGGAGGAAAmplicon SizecDNA: 108 bpgenomic: 14,938
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAG
GCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1081773 - 1880
NM_001177984 (SCN8A)1081773 - 1880
Exon 12 To Exon 13 (Pair 39)
Forward (1818,22)TAAGTCAGAGTCAGAAGATGGCAmplicon SizecDNA: 148 bpgenomic: 14,978
Reverse (1965,21)GATGCTGCTCTTGCTGTTGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.509 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAAT
AGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCT
CTCCCGCCACAACAGCAAGAGCAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1481726 - 1873
NM_014191 (SCN8A)1481726 - 1873
Exon 12 To Exon 13 (Pair 40)
Forward (1747,22)AACAGGAGAAAGAAGAGGAAGCAmplicon SizecDNA: 216 bpgenomic: 15,046
Reverse (1962,20)GCTGCTCTTGCTGTTGTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers0.26 kcal/mol in 3' area
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-2.212 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCC
GAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCA
GACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGC
TCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2161655 - 1870
NM_014191 (SCN8A)2161655 - 1870
Exon 12 To Exon 13 (Pair 41)
Forward (1802,22)ATCCCGAGAAGGTGTTTAAGTCAmplicon SizecDNA: 164 bpgenomic: 14,994
Reverse (1965,21)GATGCTGCTCTTGCTGTTGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGC
TGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCC
CAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1641710 - 1873
NM_001177984 (SCN8A)1641710 - 1873
Exon 12 To Exon 13 (Pair 42)
Forward (1709,23)TCTCTAAACTCAGCTCAAAGAGTAmplicon SizecDNA: 262 bpgenomic: 15,092
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.722 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceTCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAGC
AAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAGT
CAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAAT
TTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCACA
ACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2621617 - 1878
NM_001177984 (SCN8A)2621617 - 1878
Exon 12 To Exon 13 (Pair 43)
Forward (1803,22)TCCCGAGAAGGTGTTTAAGTCAAmplicon SizecDNA: 162 bpgenomic: 14,992
Reverse (1964,21)ATGCTGCTCTTGCTGTTGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCT
GCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCC
AGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1621711 - 1872
NM_001177984 (SCN8A)1621711 - 1872
Exon 12 To Exon 13 (Pair 44)
Forward (1815,23)GTTTAAGTCAGAGTCAGAAGATGAmplicon SizecDNA: 158 bpgenomic: 14,988
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.017 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAG
AATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTT
CCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1581723 - 1880
NM_014191 (SCN8A)1581723 - 1880
Exon 12 To Exon 13 (Pair 45)
Forward (1865,22)CAGACAACAGAATAGGGAGGAAAmplicon SizecDNA: 109 bpgenomic: 14,939
Reverse (1973,22)AAACTGAAGATGCTGCTCTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAG
GCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1091773 - 1881
NM_001177984 (SCN8A)1091773 - 1881
Exon 12 To Exon 13 (Pair 46)
Forward (1738,23)GAAAGACGTAACAGGAGAAAGAAAmplicon SizecDNA: 233 bpgenomic: 15,063
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.964 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceGAAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAA
GGGGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTT
CGGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGC
ATCCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2331646 - 1878
NM_001177984 (SCN8A)2331646 - 1878
Exon 12 To Exon 13 (Pair 47)
Forward (1737,22)GGAAAGACGTAACAGGAGAAAGAmplicon SizecDNA: 226 bpgenomic: 15,056
Reverse (1962,20)GCTGCTCTTGCTGTTGTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-2.144 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceGGAAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAA
AGGGGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTT
TCGGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAG
CATCCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2261645 - 1870
NM_001177984 (SCN8A)2261645 - 1870
Exon 12 To Exon 13 (Pair 48)
Forward (1803,22)TCCCGAGAAGGTGTTTAAGTCAAmplicon SizecDNA: 163 bpgenomic: 14,993
Reverse (1965,21)GATGCTGCTCTTGCTGTTGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCT
GCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCC
AGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1631711 - 1873
NM_014191 (SCN8A)1631711 - 1873
Exon 12 To Exon 13 (Pair 49)
Forward (1813,23)GTGTTTAAGTCAGAGTCAGAAGAAmplicon SizecDNA: 160 bpgenomic: 14,990
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.017 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAAC
AGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCC
TTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1601721 - 1880
NM_001177984 (SCN8A)1601721 - 1880
Exon 12 To Exon 13 (Pair 50)
Forward (1709,23)TCTCTAAACTCAGCTCAAAGAGTAmplicon SizecDNA: 257 bpgenomic: 15,087
Reverse (1965,21)GATGCTGCTCTTGCTGTTGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.722 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceTCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAGC
AAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAGT
CAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAAT
TTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCACA
ACAGCAAGAGCAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2571617 - 1873
NM_014191 (SCN8A)2571617 - 1873
Exon 12 To Exon 13 (Pair 51)
Forward (1706,24)AAATCTCTAAACTCAGCTCAAAGAAmplicon SizecDNA: 267 bpgenomic: 15,097
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGA
AGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAG
AGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGA
AATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCC
ACAACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2671614 - 1880
NM_001177984 (SCN8A)2671614 - 1880
Exon 12 To Exon 13 (Pair 52)
Forward (1861,21)CTGCCAGACAACAGAATAGGGAmplicon SizecDNA: 110 bpgenomic: 14,940
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.303 kcal/mol
Forward Dimers-1.091 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATC
CCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1101769 - 1878
NM_014191 (SCN8A)1101769 - 1878
Exon 12 To Exon 13 (Pair 53)
Forward (1739,23)AAAGACGTAACAGGAGAAAGAAGAmplicon SizecDNA: 232 bpgenomic: 15,062
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.964 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAG
GGGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTC
GGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCA
TCCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2321647 - 1878
NM_014191 (SCN8A)2321647 - 1878
Exon 12 To Exon 13 (Pair 54)
Forward (1706,24)AAATCTCTAAACTCAGCTCAAAGAAmplicon SizecDNA: 265 bpgenomic: 15,095
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGA
AGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAG
AGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGA
AATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCC
ACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2651614 - 1878
NM_001177984 (SCN8A)2651614 - 1878
Exon 12 To Exon 13 (Pair 55)
Forward (1801,22)GATCCCGAGAAGGTGTTTAAGTAmplicon SizecDNA: 169 bpgenomic: 14,999
Reverse (1969,22)TGAAGATGCTGCTCTTGCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGG
CTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATC
CCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1691709 - 1877
NM_001177984 (SCN8A)1691709 - 1877
Exon 12 To Exon 13 (Pair 56)
Forward (1813,23)GTGTTTAAGTCAGAGTCAGAAGAAmplicon SizecDNA: 152 bpgenomic: 14,982
Reverse (1964,21)ATGCTGCTCTTGCTGTTGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAAC
AGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCC
TTCCTCTCCCGCCACAACAGCAAGAGCAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1521721 - 1872
NM_014191 (SCN8A)1521721 - 1872
Exon 12 To Exon 13 (Pair 57)
Forward (1816,23)TTTAAGTCAGAGTCAGAAGATGGAmplicon SizecDNA: 149 bpgenomic: 14,979
Reverse (1964,21)ATGCTGCTCTTGCTGTTGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.75 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGA
ATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTC
CTCTCCCGCCACAACAGCAAGAGCAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1491724 - 1872
NM_001177984 (SCN8A)1491724 - 1872
Exon 12 To Exon 13 (Pair 58)
Forward (1801,22)GATCCCGAGAAGGTGTTTAAGTAmplicon SizecDNA: 170 bpgenomic: 15,000
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGG
CTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATC
CCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1701709 - 1878
NM_001177984 (SCN8A)1701709 - 1878
Exon 12 To Exon 13 (Pair 59)
Forward (1706,24)AAATCTCTAAACTCAGCTCAAAGAAmplicon SizecDNA: 256 bpgenomic: 15,086
Reverse (1961,20)CTGCTCTTGCTGTTGTGGCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.081 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.938 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGA
AGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAG
AGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGA
AATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCC
ACAACAGCAAGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2561614 - 1869
NM_014191 (SCN8A)2561614 - 1869
Exon 12 To Exon 13 (Pair 60)
Forward (1706,24)AAATCTCTAAACTCAGCTCAAAGAAmplicon SizecDNA: 257 bpgenomic: 15,087
Reverse (1962,20)GCTGCTCTTGCTGTTGTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.938 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGA
AGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAG
AGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGA
AATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCC
ACAACAGCAAGAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2571614 - 1870
NM_001177984 (SCN8A)2571614 - 1870
Exon 12 To Exon 13 (Pair 61)
Forward (1734,23)AAAGGAAAGACGTAACAGGAGAAAmplicon SizecDNA: 229 bpgenomic: 15,059
Reverse (1962,20)GCTGCTCTTGCTGTTGTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-2.144 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGA
GAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGC
CTTTCGGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCT
CAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2291642 - 1870
NM_001177984 (SCN8A)2291642 - 1870
Exon 12 To Exon 13 (Pair 62)
Forward (1747,22)AACAGGAGAAAGAAGAGGAAGCAmplicon SizecDNA: 221 bpgenomic: 15,051
Reverse (1967,22)AAGATGCTGCTCTTGCTGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers0.26 kcal/mol in 3' area
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.212 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCC
GAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCA
GACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGC
TCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2211655 - 1875
NM_001177984 (SCN8A)2211655 - 1875
Exon 12 To Exon 13 (Pair 63)
Forward (1738,23)GAAAGACGTAACAGGAGAAAGAAAmplicon SizecDNA: 236 bpgenomic: 15,066
Reverse (1973,22)AAACTGAAGATGCTGCTCTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.964 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceGAAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAA
GGGGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTT
CGGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGC
ATCCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2361646 - 1881
NM_001177984 (SCN8A)2361646 - 1881
Exon 12 To Exon 13 (Pair 64)
Forward (1708,23)ATCTCTAAACTCAGCTCAAAGAGAmplicon SizecDNA: 257 bpgenomic: 15,087
Reverse (1964,21)ATGCTGCTCTTGCTGTTGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.71 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAG
CAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAG
TCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAA
TTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCAC
AACAGCAAGAGCAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2571616 - 1872
NM_014191 (SCN8A)2571616 - 1872
Exon 12 To Exon 13 (Pair 65)
Forward (1737,22)GGAAAGACGTAACAGGAGAAAGAmplicon SizecDNA: 225 bpgenomic: 15,055
Reverse (1961,20)CTGCTCTTGCTGTTGTGGCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.081 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.144 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceGGAAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAA
AGGGGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTT
TCGGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAG
CATCCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2251645 - 1869
NM_014191 (SCN8A)2251645 - 1869
Exon 12 To Exon 13 (Pair 66)
Forward (1813,23)GTGTTTAAGTCAGAGTCAGAAGAAmplicon SizecDNA: 149 bpgenomic: 14,979
Reverse (1961,20)CTGCTCTTGCTGTTGTGGCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.081 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAAC
AGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCC
TTCCTCTCCCGCCACAACAGCAAGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1491721 - 1869
NM_001177984 (SCN8A)1491721 - 1869
Exon 12 To Exon 13 (Pair 67)
Forward (1803,22)TCCCGAGAAGGTGTTTAAGTCAAmplicon SizecDNA: 160 bpgenomic: 14,990
Reverse (1962,20)GCTGCTCTTGCTGTTGTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCT
GCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCC
AGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1601711 - 1870
NM_001177984 (SCN8A)1601711 - 1870
Exon 12 To Exon 13 (Pair 68)
Forward (1818,22)TAAGTCAGAGTCAGAAGATGGCAmplicon SizecDNA: 150 bpgenomic: 14,980
Reverse (1967,22)AAGATGCTGCTCTTGCTGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.509 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAAT
AGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCT
CTCCCGCCACAACAGCAAGAGCAGCATCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1501726 - 1875
NM_001177984 (SCN8A)1501726 - 1875
Exon 12 To Exon 13 (Pair 69)
Forward (1818,22)TAAGTCAGAGTCAGAAGATGGCAmplicon SizecDNA: 145 bpgenomic: 14,975
Reverse (1962,20)GCTGCTCTTGCTGTTGTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.509 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAAT
AGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCT
CTCCCGCCACAACAGCAAGAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1451726 - 1870
NM_014191 (SCN8A)1451726 - 1870
Exon 12 To Exon 13 (Pair 70)
Forward (1739,23)AAAGACGTAACAGGAGAAAGAAGAmplicon SizecDNA: 235 bpgenomic: 15,065
Reverse (1973,22)AAACTGAAGATGCTGCTCTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.964 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAG
GGGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTC
GGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCA
TCCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2351647 - 1881
NM_014191 (SCN8A)2351647 - 1881
Exon 12 To Exon 13 (Pair 71)
Forward (1813,23)GTGTTTAAGTCAGAGTCAGAAGAAmplicon SizecDNA: 161 bpgenomic: 14,991
Reverse (1973,22)AAACTGAAGATGCTGCTCTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.017 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAAC
AGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCC
TTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1611721 - 1881
NM_014191 (SCN8A)1611721 - 1881
Exon 12 To Exon 13 (Pair 72)
Forward (1816,23)TTTAAGTCAGAGTCAGAAGATGGAmplicon SizecDNA: 147 bpgenomic: 14,977
Reverse (1962,20)GCTGCTCTTGCTGTTGTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.75 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGA
ATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTC
CTCTCCCGCCACAACAGCAAGAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1471724 - 1870
NM_001177984 (SCN8A)1471724 - 1870
Exon 12 To Exon 13 (Pair 73)
Forward (1708,23)ATCTCTAAACTCAGCTCAAAGAGAmplicon SizecDNA: 263 bpgenomic: 15,093
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.71 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAG
CAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAG
TCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAA
TTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCAC
AACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2631616 - 1878
NM_014191 (SCN8A)2631616 - 1878
Exon 12 To Exon 13 (Pair 74)
Forward (1813,23)GTGTTTAAGTCAGAGTCAGAAGAAmplicon SizecDNA: 157 bpgenomic: 14,987
Reverse (1969,22)TGAAGATGCTGCTCTTGCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAAC
AGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCC
TTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1571721 - 1877
NM_001177984 (SCN8A)1571721 - 1877
Exon 12 To Exon 13 (Pair 75)
Forward (1709,23)TCTCTAAACTCAGCTCAAAGAGTAmplicon SizecDNA: 261 bpgenomic: 15,091
Reverse (1969,22)TGAAGATGCTGCTCTTGCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.722 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceTCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAGC
AAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAGT
CAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAAT
TTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCACA
ACAGCAAGAGCAGCATCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2611617 - 1877
NM_014191 (SCN8A)2611617 - 1877
Exon 12 To Exon 13 (Pair 76)
Forward (1818,22)TAAGTCAGAGTCAGAAGATGGCAmplicon SizecDNA: 147 bpgenomic: 14,977
Reverse (1964,21)ATGCTGCTCTTGCTGTTGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.509 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAAT
AGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCT
CTCCCGCCACAACAGCAAGAGCAGCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1471726 - 1872
NM_001177984 (SCN8A)1471726 - 1872
Exon 12 To Exon 13 (Pair 77)
Forward (1740,23)AAGACGTAACAGGAGAAAGAAGAAmplicon SizecDNA: 233 bpgenomic: 15,063
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-2.942 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.964 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAGACGTAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGG
GGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCG
GCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCAT
CCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2331648 - 1880
NM_014191 (SCN8A)2331648 - 1880
Exon 12 To Exon 13 (Pair 78)
Forward (1865,22)CAGACAACAGAATAGGGAGGAAAmplicon SizecDNA: 106 bpgenomic: 14,936
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers-0.002 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAG
GCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1061773 - 1878
NM_014191 (SCN8A)1061773 - 1878
Exon 12 To Exon 13 (Pair 79)
Forward (1708,23)ATCTCTAAACTCAGCTCAAAGAGAmplicon SizecDNA: 262 bpgenomic: 15,092
Reverse (1969,22)TGAAGATGCTGCTCTTGCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.71 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAG
CAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAG
TCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAA
TTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCAC
AACAGCAAGAGCAGCATCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2621616 - 1877
NM_001177984 (SCN8A)2621616 - 1877
Exon 12 To Exon 13 (Pair 80)
Forward (1866,23)AGACAACAGAATAGGGAGGAAATAmplicon SizecDNA: 109 bpgenomic: 14,939
Reverse (1974,22)GAAACTGAAGATGCTGCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops3.157 kcal/mol in 3' area
Forward Dimers-0.002 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGG
CTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1091774 - 1882
NM_014191 (SCN8A)1091774 - 1882
Exon 12 To Exon 13 (Pair 81)
Forward (1861,21)CTGCCAGACAACAGAATAGGGAmplicon SizecDNA: 114 bpgenomic: 14,944
Reverse (1974,22)GAAACTGAAGATGCTGCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.303 kcal/mol
Forward Dimers-1.091 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATC
CCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1141769 - 1882
NM_001177984 (SCN8A)1141769 - 1882
Exon 12 To Exon 13 (Pair 82)
Forward (1860,21)GCTGCCAGACAACAGAATAGGAmplicon SizecDNA: 111 bpgenomic: 14,941
Reverse (1970,21)CTGAAGATGCTGCTCTTGCTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.929 kcal/mol
Forward Dimers-1.839 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.712 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCAT
CCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1111768 - 1878
NM_001177984 (SCN8A)1111768 - 1878
Exon 12 To Exon 13 (Pair 83)
Forward (1706,24)AAATCTCTAAACTCAGCTCAAAGAAmplicon SizecDNA: 260 bpgenomic: 15,090
Reverse (1965,21)GATGCTGCTCTTGCTGTTGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.712 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAAATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGA
AGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAG
AGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGA
AATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCC
ACAACAGCAAGAGCAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2601614 - 1873
NM_001177984 (SCN8A)2601614 - 1873
Exon 12 To Exon 13 (Pair 84)
Forward (1803,22)TCCCGAGAAGGTGTTTAAGTCAAmplicon SizecDNA: 159 bpgenomic: 14,989
Reverse (1961,20)CTGCTCTTGCTGTTGTGGCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.081 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCT
GCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCC
AGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1591711 - 1869
NM_001177984 (SCN8A)1591711 - 1869
Exon 12 To Exon 13 (Pair 85)
Forward (1802,22)ATCCCGAGAAGGTGTTTAAGTCAmplicon SizecDNA: 168 bpgenomic: 14,998
Reverse (1969,22)TGAAGATGCTGCTCTTGCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGC
TGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCC
CAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1681710 - 1877
NM_014191 (SCN8A)1681710 - 1877
Exon 12 To Exon 13 (Pair 86)
Forward (1801,22)GATCCCGAGAAGGTGTTTAAGTAmplicon SizecDNA: 162 bpgenomic: 14,992
Reverse (1962,20)GCTGCTCTTGCTGTTGTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGG
CTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATC
CCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1621709 - 1870
NM_001177984 (SCN8A)1621709 - 1870
Exon 12 To Exon 13 (Pair 87)
Forward (1816,23)TTTAAGTCAGAGTCAGAAGATGGAmplicon SizecDNA: 152 bpgenomic: 14,982
Reverse (1967,22)AAGATGCTGCTCTTGCTGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.75 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGA
ATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTC
CTCTCCCGCCACAACAGCAAGAGCAGCATCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1521724 - 1875
NM_014191 (SCN8A)1521724 - 1875
Exon 12 To Exon 13 (Pair 88)
Forward (1818,22)TAAGTCAGAGTCAGAAGATGGCAmplicon SizecDNA: 157 bpgenomic: 14,987
Reverse (1974,22)GAAACTGAAGATGCTGCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.509 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.017 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAAT
AGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCT
CTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1571726 - 1882
NM_014191 (SCN8A)1571726 - 1882
Exon 12 To Exon 13 (Pair 89)
Forward (1816,23)TTTAAGTCAGAGTCAGAAGATGGAmplicon SizecDNA: 158 bpgenomic: 14,988
Reverse (1973,22)AAACTGAAGATGCTGCTCTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.75 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.017 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGA
ATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTC
CTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1581724 - 1881
NM_014191 (SCN8A)1581724 - 1881
Exon 12 To Exon 13 (Pair 90)
Forward (1708,23)ATCTCTAAACTCAGCTCAAAGAGAmplicon SizecDNA: 260 bpgenomic: 15,090
Reverse (1967,22)AAGATGCTGCTCTTGCTGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.71 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAG
CAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAG
TCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAA
TTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCAC
AACAGCAAGAGCAGCATCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2601616 - 1875
NM_001177984 (SCN8A)2601616 - 1875
Exon 12 To Exon 13 (Pair 91)
Forward (1860,21)GCTGCCAGACAACAGAATAGGAmplicon SizecDNA: 115 bpgenomic: 14,945
Reverse (1974,22)GAAACTGAAGATGCTGCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.929 kcal/mol
Forward Dimers-1.839 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCAT
CCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1151768 - 1882
NM_014191 (SCN8A)1151768 - 1882
Exon 12 To Exon 13 (Pair 92)
Forward (1802,22)ATCCCGAGAAGGTGTTTAAGTCAmplicon SizecDNA: 161 bpgenomic: 14,991
Reverse (1962,20)GCTGCTCTTGCTGTTGTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.27 kcal/mol
Forward Dimers-0.996 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.029 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceATCCCGAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGC
TGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCC
CAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1611710 - 1870
NM_001177984 (SCN8A)1611710 - 1870
Exon 12 To Exon 13 (Pair 93)
Forward (1860,21)GCTGCCAGACAACAGAATAGGAmplicon SizecDNA: 113 bpgenomic: 14,943
Reverse (1972,22)AACTGAAGATGCTGCTCTTGCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.929 kcal/mol
Forward Dimers-1.839 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCAT
CCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1131768 - 1880
NM_014191 (SCN8A)1131768 - 1880
Exon 12 To Exon 13 (Pair 94)
Forward (1815,23)GTTTAAGTCAGAGTCAGAAGATGAmplicon SizecDNA: 148 bpgenomic: 14,978
Reverse (1962,20)GCTGCTCTTGCTGTTGTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.454 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAG
AATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTT
CCTCTCCCGCCACAACAGCAAGAGCAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1481723 - 1870
NM_001177984 (SCN8A)1481723 - 1870
Exon 12 To Exon 13 (Pair 95)
Forward (1747,22)AACAGGAGAAAGAAGAGGAAGCAmplicon SizecDNA: 215 bpgenomic: 15,045
Reverse (1961,20)CTGCTCTTGCTGTTGTGGCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops998.645 kcal/mol
Forward Dimers0.26 kcal/mol in 3' area
Reverse Loops1.081 kcal/mol in 3' area
Reverse Dimers0.07 kcal/mol
Forward-Reverse Dimers-2.212 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceAACAGGAGAAAGAAGAGGAAGCAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCC
GAGAAGGTGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCA
GACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGC
TCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)2151655 - 1869
NM_001177984 (SCN8A)2151655 - 1869
Exon 12 To Exon 13 (Pair 96)
Forward (1815,23)GTTTAAGTCAGAGTCAGAAGATGAmplicon SizecDNA: 160 bpgenomic: 14,990
Reverse (1974,22)GAAACTGAAGATGCTGCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.017 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAG
AATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTT
CCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1601723 - 1882
NM_014191 (SCN8A)1601723 - 1882
Exon 12 To Exon 13 (Pair 97)
Forward (1860,21)GCTGCCAGACAACAGAATAGGAmplicon SizecDNA: 114 bpgenomic: 14,944
Reverse (1973,22)AAACTGAAGATGCTGCTCTTGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.929 kcal/mol
Forward Dimers-1.839 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.255 kcal/mol
Amplicon Folding-0.096 kcal/mol outside primersite
Amplicon SequenceGCTGCCAGACAACAGAATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCAT
CCCAGGCTCGCCCTTCCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1141768 - 1881
NM_014191 (SCN8A)1141768 - 1881
Exon 12 To Exon 13 (Pair 98)
Forward (1708,23)ATCTCTAAACTCAGCTCAAAGAGAmplicon SizecDNA: 258 bpgenomic: 15,088
Reverse (1965,21)GATGCTGCTCTTGCTGTTGTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.71 kcal/mol in 3' area
Forward Dimers-2.778 kcal/mol
Reverse Loops1.128 kcal/mol
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.121 kcal/mol
Amplicon Folding-1.345 kcal/mol outside primersite
Amplicon SequenceATCTCTAAACTCAGCTCAAAGAGTGCAAAGGAAAGACGTAACAGGAGAAAGAAGAGGAAG
CAAAAGGAACTCTCTGAAGGAGAGGAGAAAGGGGATCCCGAGAAGGTGTTTAAGTCAGAG
TCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGAATAGGGAGGAAA
TTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTCCTCTCCCGCCAC
AACAGCAAGAGCAGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)2581616 - 1873
NM_014191 (SCN8A)2581616 - 1873
Exon 12 To Exon 13 (Pair 99)
Forward (1816,23)TTTAAGTCAGAGTCAGAAGATGGAmplicon SizecDNA: 159 bpgenomic: 14,989
Reverse (1974,22)GAAACTGAAGATGCTGCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.75 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.169 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-2.017 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAGA
ATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTTC
CTCTCCCGCCACAACAGCAAGAGCAGCATCTTCAGTTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001177984 (SCN8A)1591724 - 1882
NM_014191 (SCN8A)1591724 - 1882
Exon 12 To Exon 13 (Pair 100)
Forward (1815,23)GTTTAAGTCAGAGTCAGAAGATGAmplicon SizecDNA: 155 bpgenomic: 14,985
Reverse (1969,22)TGAAGATGCTGCTCTTGCTGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.777 kcal/mol in 3' area
Forward Dimers-0.142 kcal/mol
Reverse Loops1.128 kcal/mol in 3' area
Reverse Dimers-0.996 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.659 kcal/mol outside primersite
Amplicon SequenceGTTTAAGTCAGAGTCAGAAGATGGCATGAGAAGGAAGGCCTTTCGGCTGCCAGACAACAG
AATAGGGAGGAAATTTTCCATCATGAATCAGTCACTGCTCAGCATCCCAGGCTCGCCCTT
CCTCTCCCGCCACAACAGCAAGAGCAGCATCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_014191 (SCN8A)1551723 - 1877
NM_001177984 (SCN8A)1551723 - 1877
 

See below for some more details.

Program Output:

Loading ...