Design Results for SETBP1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 3 To Exon 5 (Pair 1)
Forward (971,21)CGAAGGAGGAAGAAAGAAGCCAmplicon SizecDNA: 297 bpgenomic: 174,975
Reverse (1267,23)TTGCAGAATCCATGCGAAGTTATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.345 kcal/mol in 3' area
Forward Dimers-0.574 kcal/mol
Reverse Loops1.129 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.407 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceCGAAGGAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAG
CCAGTGACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGA
AGAGAAGAGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCA
TGTGCTTCTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTT
TTCACAGTGAACCTGCAGTCTGGGCACAAGAAGTATAACTTCGCATGGATTCTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)297847 - 1143
Exon 3 To Exon 5 (Pair 2)
Forward (977,22)AGGAAGAAAGAAGCCACTCCAAAmplicon SizecDNA: 278 bpgenomic: 174,956
Reverse (1254,22)GCGAAGTTATACTTCTTGTGCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol in 3' area
Forward Dimers-0.724 kcal/mol
Reverse Loops0.39 kcal/mol
Reverse Dimers-1.555 kcal/mol
Forward-Reverse Dimers-2.852 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTG
ACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAA
GAGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCATGTGCT
TCTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTTTTCACA
GTGAACCTGCAGTCTGGGCACAAGAAGTATAACTTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)278853 - 1130
Exon 3 To Exon 5 (Pair 3)
Forward (977,22)AGGAAGAAAGAAGCCACTCCAAAmplicon SizecDNA: 275 bpgenomic: 174,953
Reverse (1251,23)AAGTTATACTTCTTGTGCCCAGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol in 3' area
Forward Dimers-0.724 kcal/mol
Reverse Loops0.861 kcal/mol
Reverse Dimers-1.084 kcal/mol
Forward-Reverse Dimers-2.852 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTG
ACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAA
GAGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCATGTGCT
TCTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTTTTCACA
GTGAACCTGCAGTCTGGGCACAAGAAGTATAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)275853 - 1127
Exon 3 To Exon 5 (Pair 4)
Forward (971,21)CGAAGGAGGAAGAAAGAAGCCAmplicon SizecDNA: 296 bpgenomic: 174,974
Reverse (1266,23)TGCAGAATCCATGCGAAGTTATANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.345 kcal/mol in 3' area
Forward Dimers-0.574 kcal/mol
Reverse Loops1.129 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.407 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceCGAAGGAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAG
CCAGTGACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGA
AGAGAAGAGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCA
TGTGCTTCTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTT
TTCACAGTGAACCTGCAGTCTGGGCACAAGAAGTATAACTTCGCATGGATTCTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)296847 - 1142
Exon 3 To Exon 5 (Pair 5)
Forward (977,22)AGGAAGAAAGAAGCCACTCCAAAmplicon SizecDNA: 277 bpgenomic: 174,955
Reverse (1253,22)CGAAGTTATACTTCTTGTGCCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol in 3' area
Forward Dimers-0.724 kcal/mol
Reverse Loops0.39 kcal/mol
Reverse Dimers-1.555 kcal/mol
Forward-Reverse Dimers-2.852 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTG
ACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAA
GAGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCATGTGCT
TCTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTTTTCACA
GTGAACCTGCAGTCTGGGCACAAGAAGTATAACTTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)277853 - 1129
Exon 3 To Exon 5 (Pair 6)
Forward (977,22)AGGAAGAAAGAAGCCACTCCAAAmplicon SizecDNA: 135 bpgenomic: 174,813
Reverse (1111,20)TGCCTTGGCCTCCTCTTCTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol in 3' area
Forward Dimers-0.724 kcal/mol
Reverse Loops0.321 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-1.068 kcal/mol outside primersite
Amplicon SequenceAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTG
ACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAA
GAGGAGGCCAAGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)135853 - 987
Exon 3 To Exon 5 (Pair 7)
Forward (978,22)GGAAGAAAGAAGCCACTCCAAAAmplicon SizecDNA: 276 bpgenomic: 174,954
Reverse (1253,22)CGAAGTTATACTTCTTGTGCCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.39 kcal/mol
Reverse Dimers-1.555 kcal/mol
Forward-Reverse Dimers-2.852 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTGA
CCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAAG
AGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCATGTGCTT
CTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTTTTCACAG
TGAACCTGCAGTCTGGGCACAAGAAGTATAACTTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)276854 - 1129
Exon 3 To Exon 5 (Pair 8)
Forward (978,22)GGAAGAAAGAAGCCACTCCAAAAmplicon SizecDNA: 277 bpgenomic: 174,955
Reverse (1254,22)GCGAAGTTATACTTCTTGTGCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.39 kcal/mol
Reverse Dimers-1.555 kcal/mol
Forward-Reverse Dimers-2.852 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTGA
CCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAAG
AGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCATGTGCTT
CTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTTTTCACAG
TGAACCTGCAGTCTGGGCACAAGAAGTATAACTTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)277854 - 1130
Exon 3 To Exon 5 (Pair 9)
Forward (976,21)GAGGAAGAAAGAAGCCACTCCAmplicon SizecDNA: 278 bpgenomic: 174,956
Reverse (1253,22)CGAAGTTATACTTCTTGTGCCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol in 3' area
Forward Dimers-0.724 kcal/mol
Reverse Loops0.39 kcal/mol
Reverse Dimers-1.555 kcal/mol
Forward-Reverse Dimers-2.852 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGT
GACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGA
AGAGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCATGTGC
TTCTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTTTTCAC
AGTGAACCTGCAGTCTGGGCACAAGAAGTATAACTTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)278852 - 1129
Exon 3 To Exon 5 (Pair 10)
Forward (977,22)AGGAAGAAAGAAGCCACTCCAAAmplicon SizecDNA: 137 bpgenomic: 174,815
Reverse (1113,20)GATGCCTTGGCCTCCTCTTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol in 3' area
Forward Dimers-0.724 kcal/mol
Reverse Loops0.321 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-1.068 kcal/mol outside primersite
Amplicon SequenceAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTG
ACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAA
GAGGAGGCCAAGGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)137853 - 989
Exon 3 To Exon 5 (Pair 11)
Forward (978,22)GGAAGAAAGAAGCCACTCCAAAAmplicon SizecDNA: 134 bpgenomic: 174,812
Reverse (1111,20)TGCCTTGGCCTCCTCTTCTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.321 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-1.068 kcal/mol outside primersite
Amplicon SequenceGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTGA
CCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAAG
AGGAGGCCAAGGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)134854 - 987
Exon 3 To Exon 5 (Pair 12)
Forward (932,20)ACCAGAAGGTGTCCCGTGCTAmplicon SizecDNA: 182 bpgenomic: 174,860
Reverse (1113,20)GATGCCTTGGCCTCCTCTTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.166 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops0.321 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.148 kcal/mol
Amplicon Folding-1.068 kcal/mol outside primersite
Amplicon SequenceACCAGAAGGTGTCCCGTGCTGGAAAAAATAGCAAAGCCACGAAGGAGGAAGAAAGAAGCC
ACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTGACCTCAAAGGATTTC
AGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAAGAGGAGGCCAAGGCA
TC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)182808 - 989
Exon 3 To Exon 5 (Pair 13)
Forward (976,21)GAGGAAGAAAGAAGCCACTCCAmplicon SizecDNA: 279 bpgenomic: 174,957
Reverse (1254,22)GCGAAGTTATACTTCTTGTGCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol in 3' area
Forward Dimers-0.724 kcal/mol
Reverse Loops0.39 kcal/mol
Reverse Dimers-1.555 kcal/mol
Forward-Reverse Dimers-2.852 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGT
GACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGA
AGAGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCATGTGC
TTCTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTTTTCAC
AGTGAACCTGCAGTCTGGGCACAAGAAGTATAACTTCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)279852 - 1130
Exon 3 To Exon 5 (Pair 14)
Forward (971,21)CGAAGGAGGAAGAAAGAAGCCAmplicon SizecDNA: 294 bpgenomic: 174,972
Reverse (1264,23)CAGAATCCATGCGAAGTTATACTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.345 kcal/mol in 3' area
Forward Dimers-0.574 kcal/mol
Reverse Loops1.129 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.407 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceCGAAGGAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAG
CCAGTGACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGA
AGAGAAGAGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCA
TGTGCTTCTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTT
TTCACAGTGAACCTGCAGTCTGGGCACAAGAAGTATAACTTCGCATGGATTCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)294847 - 1140
Exon 3 To Exon 5 (Pair 15)
Forward (971,21)CGAAGGAGGAAGAAAGAAGCCAmplicon SizecDNA: 298 bpgenomic: 174,976
Reverse (1268,23)TTTGCAGAATCCATGCGAAGTTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.345 kcal/mol in 3' area
Forward Dimers-0.574 kcal/mol
Reverse Loops1.129 kcal/mol in 3' area
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.407 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceCGAAGGAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAG
CCAGTGACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGA
AGAGAAGAGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCA
TGTGCTTCTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTT
TTCACAGTGAACCTGCAGTCTGGGCACAAGAAGTATAACTTCGCATGGATTCTGCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)298847 - 1144
Exon 3 To Exon 5 (Pair 16)
Forward (977,22)AGGAAGAAAGAAGCCACTCCAAAmplicon SizecDNA: 134 bpgenomic: 174,812
Reverse (1110,20)GCCTTGGCCTCCTCTTCTCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol in 3' area
Forward Dimers-0.724 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-1.068 kcal/mol outside primersite
Amplicon SequenceAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTG
ACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAA
GAGGAGGCCAAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)134853 - 986
Exon 3 To Exon 5 (Pair 17)
Forward (978,22)GGAAGAAAGAAGCCACTCCAAAAmplicon SizecDNA: 136 bpgenomic: 174,814
Reverse (1113,20)GATGCCTTGGCCTCCTCTTCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.321 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-1.068 kcal/mol outside primersite
Amplicon SequenceGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTGA
CCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAAG
AGGAGGCCAAGGCATC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)136854 - 989
Exon 3 To Exon 5 (Pair 18)
Forward (976,21)GAGGAAGAAAGAAGCCACTCCAmplicon SizecDNA: 276 bpgenomic: 174,954
Reverse (1251,23)AAGTTATACTTCTTGTGCCCAGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol in 3' area
Forward Dimers-0.724 kcal/mol
Reverse Loops0.861 kcal/mol
Reverse Dimers-1.084 kcal/mol
Forward-Reverse Dimers-2.852 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceGAGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGT
GACCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGA
AGAGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCATGTGC
TTCTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTTTTCAC
AGTGAACCTGCAGTCTGGGCACAAGAAGTATAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)276852 - 1127
Exon 3 To Exon 5 (Pair 19)
Forward (978,22)GGAAGAAAGAAGCCACTCCAAAAmplicon SizecDNA: 133 bpgenomic: 174,811
Reverse (1110,20)GCCTTGGCCTCCTCTTCTCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.591 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-1.068 kcal/mol outside primersite
Amplicon SequenceGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTGA
CCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAAG
AGGAGGCCAAGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)133854 - 986
Exon 3 To Exon 5 (Pair 20)
Forward (978,22)GGAAGAAAGAAGCCACTCCAAAAmplicon SizecDNA: 287 bpgenomic: 174,965
Reverse (1264,23)CAGAATCCATGCGAAGTTATACTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops1.129 kcal/mol
Reverse Dimers-1.322 kcal/mol
Forward-Reverse Dimers-1.791 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTGA
CCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAAG
AGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCATGTGCTT
CTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTTTTCACAG
TGAACCTGCAGTCTGGGCACAAGAAGTATAACTTCGCATGGATTCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)287854 - 1140
Exon 3 To Exon 5 (Pair 21)
Forward (932,20)ACCAGAAGGTGTCCCGTGCTAmplicon SizecDNA: 174 bpgenomic: 174,852
Reverse (1105,20)GGCCTCCTCTTCTCTTCCAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.166 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops2.269 kcal/mol
Reverse Dimers-2.068 kcal/mol
Forward-Reverse Dimers-2.181 kcal/mol
Amplicon Folding-1.068 kcal/mol outside primersite
Amplicon SequenceACCAGAAGGTGTCCCGTGCTGGAAAAAATAGCAAAGCCACGAAGGAGGAAGAAAGAAGCC
ACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTGACCTCAAAGGATTTC
AGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAAGAGGAGGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)174808 - 981
Exon 3 To Exon 5 (Pair 22)
Forward (978,22)GGAAGAAAGAAGCCACTCCAAAAmplicon SizecDNA: 274 bpgenomic: 174,952
Reverse (1251,23)AAGTTATACTTCTTGTGCCCAGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.755 kcal/mol
Forward Dimers-0.717 kcal/mol
Reverse Loops0.861 kcal/mol
Reverse Dimers-1.084 kcal/mol
Forward-Reverse Dimers-2.852 kcal/mol
Amplicon Folding-2.631 kcal/mol outside primersite
Amplicon SequenceGGAAGAAAGAAGCCACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTGA
CCTCAAAGGATTTCAGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAAG
AGGAGGCCAAGGCATCCCATTCAAAAAGCAATTCCTGTCCCAGGAACGTGCCATGTGCTT
CTCATGCCCCCGGAACCCATTCCCCGCAAAACCCGGTTCTCTCACTCTTCCTTTTCACAG
TGAACCTGCAGTCTGGGCACAAGAAGTATAACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)274854 - 1127
Exon 3 To Exon 5 (Pair 23)
Forward (932,20)ACCAGAAGGTGTCCCGTGCTAmplicon SizecDNA: 176 bpgenomic: 174,854
Reverse (1107,21)TTGGCCTCCTCTTCTCTTCCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.166 kcal/mol
Forward Dimers-0.926 kcal/mol
Reverse Loops1.998 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.181 kcal/mol
Amplicon Folding-1.068 kcal/mol outside primersite
Amplicon SequenceACCAGAAGGTGTCCCGTGCTGGAAAAAATAGCAAAGCCACGAAGGAGGAAGAAAGAAGCC
ACTCCAAAAAGAAGCTCCTCACAGCCAGTGACCTTGCAGCCAGTGACCTCAAAGGATTTC
AGCCACAGATTAAAGACTCCAGTAAGGAGGAAGTCTGGAAGAGAAGAGGAGGCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001130110 (SETBP1)176808 - 983
Exon 5 To Exon 6 (Pair 4)
Forward (1865,22)CCAACACTGAGCTTTCCTAGTTAmplicon SizecDNA: 241 bpgenomic: 72,707
Reverse (2105,21)CAGTTTCTCTGCCAGACTCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.218 kcal/mol in 3' area
Forward Dimers-2.948 kcal/mol
Reverse Loops1.182 kcal/mol
Reverse Dimers-1.701 kcal/mol
Forward-Reverse Dimers-2.327 kcal/mol
Amplicon Folding-2.437 kcal/mol outside primersite
Amplicon SequenceCCAACACTGAGCTTTCCTAGTTTTAATAAAAGAGTAGGATTTGGAGCTTACGAGAGGCCC
CAGAAACATTCAACTCTCCATTATGACACGGGCCTCCCACAGGACTTCACCGGTGACACC
TTAAAACCAAAGCACCAGCAAAAAAGCAGCAGCCAGAACCACATGGACTGGTCCACCAAC
TCTGACAGCGGACCCGTCACTCAGAATTGCTTCATCAGTCCAGAGTCTGGCAGAGAAACT
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 20)
Forward (1681,24)CCATGGGATACATTTAGAAACTTTAmplicon SizecDNA: 275 bpgenomic: 72,741
Reverse (1955,22)CCGTGTCATAATGGAGAGTTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.427 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops1.609 kcal/mol
Reverse Dimers-0.502 kcal/mol
Forward-Reverse Dimers-2.359 kcal/mol
Amplicon Folding-2.19 kcal/mol outside primersite
Amplicon SequenceCCATGGGATACATTTAGAAACTTTTATAGCAATTTGACATTTTTGTGATATCCAAGCATG
TGATTGTTTTCCTACGGATTTGTCTTATAGTATTTTACCAAAGTTTCCACACAAAAAGTA
TGGATTAAGGACAAAGTATCTGGTCCTTCATCAAAGATCGTTTGATAAGCTCTGTTCTAG
TTAACCAACACTGAGCTTTCCTAGTTTTAATAAAAGAGTAGGATTTGGAGCTTACGAGAG
GCCCCAGAAACATTCAACTCTCCATTATGACACGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 24)
Forward (1863,22)AACCAACACTGAGCTTTCCTAGAmplicon SizecDNA: 243 bpgenomic: 72,709
Reverse (2105,21)CAGTTTCTCTGCCAGACTCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.218 kcal/mol in 3' area
Forward Dimers-2.948 kcal/mol
Reverse Loops1.182 kcal/mol
Reverse Dimers-1.701 kcal/mol
Forward-Reverse Dimers-2.327 kcal/mol
Amplicon Folding-2.437 kcal/mol outside primersite
Amplicon SequenceAACCAACACTGAGCTTTCCTAGTTTTAATAAAAGAGTAGGATTTGGAGCTTACGAGAGGC
CCCAGAAACATTCAACTCTCCATTATGACACGGGCCTCCCACAGGACTTCACCGGTGACA
CCTTAAAACCAAAGCACCAGCAAAAAAGCAGCAGCCAGAACCACATGGACTGGTCCACCA
ACTCTGACAGCGGACCCGTCACTCAGAATTGCTTCATCAGTCCAGAGTCTGGCAGAGAAA
CTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 36)
Forward (1861,23)TTAACCAACACTGAGCTTTCCTAAmplicon SizecDNA: 245 bpgenomic: 72,711
Reverse (2105,21)CAGTTTCTCTGCCAGACTCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.218 kcal/mol in 3' area
Forward Dimers-2.948 kcal/mol
Reverse Loops1.182 kcal/mol
Reverse Dimers-1.701 kcal/mol
Forward-Reverse Dimers-2.327 kcal/mol
Amplicon Folding-2.437 kcal/mol outside primersite
Amplicon SequenceTTAACCAACACTGAGCTTTCCTAGTTTTAATAAAAGAGTAGGATTTGGAGCTTACGAGAG
GCCCCAGAAACATTCAACTCTCCATTATGACACGGGCCTCCCACAGGACTTCACCGGTGA
CACCTTAAAACCAAAGCACCAGCAAAAAAGCAGCAGCCAGAACCACATGGACTGGTCCAC
CAACTCTGACAGCGGACCCGTCACTCAGAATTGCTTCATCAGTCCAGAGTCTGGCAGAGA
AACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 43)
Forward (1681,24)CCATGGGATACATTTAGAAACTTTAmplicon SizecDNA: 273 bpgenomic: 72,739
Reverse (1953,23)GTGTCATAATGGAGAGTTGAATGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.427 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops2.132 kcal/mol
Reverse Dimers-0.276 kcal/mol
Forward-Reverse Dimers-2.359 kcal/mol
Amplicon Folding-2.19 kcal/mol outside primersite
Amplicon SequenceCCATGGGATACATTTAGAAACTTTTATAGCAATTTGACATTTTTGTGATATCCAAGCATG
TGATTGTTTTCCTACGGATTTGTCTTATAGTATTTTACCAAAGTTTCCACACAAAAAGTA
TGGATTAAGGACAAAGTATCTGGTCCTTCATCAAAGATCGTTTGATAAGCTCTGTTCTAG
TTAACCAACACTGAGCTTTCCTAGTTTTAATAAAAGAGTAGGATTTGGAGCTTACGAGAG
GCCCCAGAAACATTCAACTCTCCATTATGACAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 45)
Forward (1681,24)CCATGGGATACATTTAGAAACTTTAmplicon SizecDNA: 277 bpgenomic: 72,743
Reverse (1957,21)GCCCGTGTCATAATGGAGAGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.427 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops1.398 kcal/mol
Reverse Dimers-0.713 kcal/mol
Forward-Reverse Dimers-2.751 kcal/mol
Amplicon Folding-2.19 kcal/mol outside primersite
Amplicon SequenceCCATGGGATACATTTAGAAACTTTTATAGCAATTTGACATTTTTGTGATATCCAAGCATG
TGATTGTTTTCCTACGGATTTGTCTTATAGTATTTTACCAAAGTTTCCACACAAAAAGTA
TGGATTAAGGACAAAGTATCTGGTCCTTCATCAAAGATCGTTTGATAAGCTCTGTTCTAG
TTAACCAACACTGAGCTTTCCTAGTTTTAATAAAAGAGTAGGATTTGGAGCTTACGAGAG
GCCCCAGAAACATTCAACTCTCCATTATGACACGGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 63)
Forward (1864,22)ACCAACACTGAGCTTTCCTAGTAmplicon SizecDNA: 242 bpgenomic: 72,708
Reverse (2105,21)CAGTTTCTCTGCCAGACTCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.218 kcal/mol in 3' area
Forward Dimers-2.948 kcal/mol
Reverse Loops1.182 kcal/mol
Reverse Dimers-1.701 kcal/mol
Forward-Reverse Dimers-2.327 kcal/mol
Amplicon Folding-2.437 kcal/mol outside primersite
Amplicon SequenceACCAACACTGAGCTTTCCTAGTTTTAATAAAAGAGTAGGATTTGGAGCTTACGAGAGGCC
CCAGAAACATTCAACTCTCCATTATGACACGGGCCTCCCACAGGACTTCACCGGTGACAC
CTTAAAACCAAAGCACCAGCAAAAAAGCAGCAGCCAGAACCACATGGACTGGTCCACCAA
CTCTGACAGCGGACCCGTCACTCAGAATTGCTTCATCAGTCCAGAGTCTGGCAGAGAAAC
TG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 5 To Exon 6 (Pair 66)
Forward (1681,24)CCATGGGATACATTTAGAAACTTTAmplicon SizecDNA: 274 bpgenomic: 72,740
Reverse (1954,23)CGTGTCATAATGGAGAGTTGAATNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.427 kcal/mol
Forward Dimers-2.59 kcal/mol
Reverse Loops2.132 kcal/mol in 3' area
Reverse Dimers-0.276 kcal/mol
Forward-Reverse Dimers-2.359 kcal/mol
Amplicon Folding-2.19 kcal/mol outside primersite
Amplicon SequenceCCATGGGATACATTTAGAAACTTTTATAGCAATTTGACATTTTTGTGATATCCAAGCATG
TGATTGTTTTCCTACGGATTTGTCTTATAGTATTTTACCAAAGTTTCCACACAAAAAGTA
TGGATTAAGGACAAAGTATCTGGTCCTTCATCAAAGATCGTTTGATAAGCTCTGTTCTAG
TTAACCAACACTGAGCTTTCCTAGTTTTAATAAAAGAGTAGGATTTGGAGCTTACGAGAG
GCCCCAGAAACATTCAACTCTCCATTATGACACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
 

See below for some more details.

Program Output:

Loading ...