Design Results for SMARCA2

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size150
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 25 To Exon 26 (Pair 1)
Forward (3685,22)GCTGATACAGTGGTCATCTTTGAmplicon SizecDNA: 124 bpgenomic: 5,528
Reverse (3808,21)TGTTCACGGTACAGAGCCTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol
Forward Dimers-0.995 kcal/mol
Reverse Loops1.204 kcal/mol in 3' area
Reverse Dimers-0.73 kcal/mol
Forward-Reverse Dimers-2.086 kcal/mol
Amplicon Folding-2.058 kcal/mol outside primersite
Amplicon SequenceGCTGATACAGTGGTCATCTTTGACAGCGACTGGAATCCTCATCAGGATCTGCAGGCCCAA
GACCGAGCTCACCGCATCGGGCAGCAGAACGAGGTCCGGGTACTGAGGCTCTGTACCGTG
AACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1243511 - 3634
NM_003070 (SMARCA2)1243511 - 3634
Exon 25 To Exon 26 (Pair 2)
Forward (3685,22)GCTGATACAGTGGTCATCTTTGAmplicon SizecDNA: 134 bpgenomic: 5,538
Reverse (3818,20)TCCTCCACGCTGTTCACGGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol
Forward Dimers-0.995 kcal/mol
Reverse Loops1.546 kcal/mol in 3' area
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.399 kcal/mol
Amplicon Folding-2.058 kcal/mol outside primersite
Amplicon SequenceGCTGATACAGTGGTCATCTTTGACAGCGACTGGAATCCTCATCAGGATCTGCAGGCCCAA
GACCGAGCTCACCGCATCGGGCAGCAGAACGAGGTCCGGGTACTGAGGCTCTGTACCGTG
AACAGCGTGGAGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1343511 - 3644
NM_139045 (SMARCA2)1343511 - 3644
Exon 25 To Exon 26 (Pair 3)
Forward (3685,22)GCTGATACAGTGGTCATCTTTGAmplicon SizecDNA: 121 bpgenomic: 5,525
Reverse (3805,21)TCACGGTACAGAGCCTCAGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol
Forward Dimers-0.995 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.73 kcal/mol
Forward-Reverse Dimers-2.086 kcal/mol
Amplicon Folding-2.058 kcal/mol outside primersite
Amplicon SequenceGCTGATACAGTGGTCATCTTTGACAGCGACTGGAATCCTCATCAGGATCTGCAGGCCCAA
GACCGAGCTCACCGCATCGGGCAGCAGAACGAGGTCCGGGTACTGAGGCTCTGTACCGTG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1213511 - 3631
NM_003070 (SMARCA2)1213511 - 3631
Exon 25 To Exon 26 (Pair 4)
Forward (3685,22)GCTGATACAGTGGTCATCTTTGAmplicon SizecDNA: 135 bpgenomic: 5,539
Reverse (3819,20)TTCCTCCACGCTGTTCACGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol
Forward Dimers-0.995 kcal/mol
Reverse Loops1.546 kcal/mol in 3' area
Reverse Dimers-0.458 kcal/mol
Forward-Reverse Dimers-2.399 kcal/mol
Amplicon Folding-2.058 kcal/mol outside primersite
Amplicon SequenceGCTGATACAGTGGTCATCTTTGACAGCGACTGGAATCCTCATCAGGATCTGCAGGCCCAA
GACCGAGCTCACCGCATCGGGCAGCAGAACGAGGTCCGGGTACTGAGGCTCTGTACCGTG
AACAGCGTGGAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1353511 - 3645
NM_139045 (SMARCA2)1353511 - 3645
Exon 25 To Exon 26 (Pair 5)
Forward (3685,22)GCTGATACAGTGGTCATCTTTGAmplicon SizecDNA: 122 bpgenomic: 5,526
Reverse (3806,21)TTCACGGTACAGAGCCTCAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.288 kcal/mol
Forward Dimers-0.995 kcal/mol
Reverse Loops1.204 kcal/mol
Reverse Dimers-0.73 kcal/mol
Forward-Reverse Dimers-2.086 kcal/mol
Amplicon Folding-2.058 kcal/mol outside primersite
Amplicon SequenceGCTGATACAGTGGTCATCTTTGACAGCGACTGGAATCCTCATCAGGATCTGCAGGCCCAA
GACCGAGCTCACCGCATCGGGCAGCAGAACGAGGTCCGGGTACTGAGGCTCTGTACCGTG
AA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1223511 - 3632
NM_139045 (SMARCA2)1223511 - 3632
Exon 26 To Exon 27 (Pair 1)
Forward (3857,21)ATCAGAAAGTGATCCAGGCGGAmplicon SizecDNA: 139 bpgenomic: 3,547
Reverse (3995,21)TGGTTCAGAGTCTCATCGTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.597 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGG
CATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGG
ACGATGAGACTCTGAACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1393683 - 3821
NM_003070 (SMARCA2)1393683 - 3821
Exon 26 To Exon 27 (Pair 2)
Forward (3856,21)GATCAGAAAGTGATCCAGGCGAmplicon SizecDNA: 128 bpgenomic: 3,536
Reverse (3983,22)TCATCGTCCGGTACTTCATCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.034 kcal/mol
Forward Dimers-0.737 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceGATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGG
GCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCG
GACGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1283682 - 3809
NM_003070 (SMARCA2)1283682 - 3809
Exon 26 To Exon 27 (Pair 3)
Forward (3860,20)AGAAAGTGATCCAGGCGGGCAmplicon SizecDNA: 140 bpgenomic: 3,548
Reverse (3999,22)CATTTGGTTCAGAGTCTCATCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.646 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCAT
TCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACG
ATGAGACTCTGAACCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1403686 - 3825
NM_139045 (SMARCA2)1403686 - 3825
Exon 26 To Exon 27 (Pair 4)
Forward (3859,20)CAGAAAGTGATCCAGGCGGGAmplicon SizecDNA: 139 bpgenomic: 3,547
Reverse (3997,22)TTTGGTTCAGAGTCTCATCGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.156 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCA
TTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGAC
GATGAGACTCTGAACCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1393685 - 3823
NM_003070 (SMARCA2)1393685 - 3823
Exon 26 To Exon 27 (Pair 5)
Forward (3872,21)AGGCGGGCATGTTTGACCAAAAmplicon SizecDNA: 112 bpgenomic: 3,520
Reverse (3983,22)TCATCGTCCGGTACTTCATCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.07 kcal/mol in 3' area
Forward Dimers-1.17 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-2.137 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCA
TCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1123698 - 3809
NM_139045 (SMARCA2)1123698 - 3809
Exon 26 To Exon 27 (Pair 6)
Forward (3856,21)GATCAGAAAGTGATCCAGGCGAmplicon SizecDNA: 137 bpgenomic: 3,545
Reverse (3992,21)TTCAGAGTCTCATCGTCCGGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.034 kcal/mol
Forward Dimers-0.737 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceGATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGG
GCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCG
GACGATGAGACTCTGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1373682 - 3818
NM_139045 (SMARCA2)1373682 - 3818
Exon 26 To Exon 27 (Pair 7)
Forward (3857,21)ATCAGAAAGTGATCCAGGCGGAmplicon SizecDNA: 143 bpgenomic: 3,551
Reverse (3999,22)CATTTGGTTCAGAGTCTCATCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.597 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGG
CATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGG
ACGATGAGACTCTGAACCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1433683 - 3825
NM_003070 (SMARCA2)1433683 - 3825
Exon 26 To Exon 27 (Pair 8)
Forward (3860,20)AGAAAGTGATCCAGGCGGGCAmplicon SizecDNA: 148 bpgenomic: 3,556
Reverse (4007,22)CGAGCAATCATTTGGTTCAGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.475 kcal/mol
Reverse Dimers-0.663 kcal/mol
Forward-Reverse Dimers-1.522 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCAT
TCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACG
ATGAGACTCTGAACCAAATGATTGCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1483686 - 3833
NM_003070 (SMARCA2)1483686 - 3833
Exon 26 To Exon 27 (Pair 9)
Forward (3857,21)ATCAGAAAGTGATCCAGGCGGAmplicon SizecDNA: 141 bpgenomic: 3,549
Reverse (3997,22)TTTGGTTCAGAGTCTCATCGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.597 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGG
CATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGG
ACGATGAGACTCTGAACCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1413683 - 3823
NM_003070 (SMARCA2)1413683 - 3823
Exon 26 To Exon 27 (Pair 10)
Forward (3860,20)AGAAAGTGATCCAGGCGGGCAmplicon SizecDNA: 138 bpgenomic: 3,546
Reverse (3997,22)TTTGGTTCAGAGTCTCATCGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.646 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCAT
TCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACG
ATGAGACTCTGAACCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1383686 - 3823
NM_139045 (SMARCA2)1383686 - 3823
Exon 26 To Exon 27 (Pair 11)
Forward (3857,21)ATCAGAAAGTGATCCAGGCGGAmplicon SizecDNA: 151 bpgenomic: 3,559
Reverse (4007,22)CGAGCAATCATTTGGTTCAGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.597 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops0.475 kcal/mol
Reverse Dimers-0.663 kcal/mol
Forward-Reverse Dimers-1.522 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGG
CATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGG
ACGATGAGACTCTGAACCAAATGATTGCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1513683 - 3833
NM_139045 (SMARCA2)1513683 - 3833
Exon 26 To Exon 27 (Pair 12)
Forward (3859,20)CAGAAAGTGATCCAGGCGGGAmplicon SizecDNA: 123 bpgenomic: 3,531
Reverse (3981,22)ATCGTCCGGTACTTCATCTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.156 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCA
TTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGAC
GAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1233685 - 3807
NM_003070 (SMARCA2)1233685 - 3807
Exon 26 To Exon 27 (Pair 13)
Forward (3856,21)GATCAGAAAGTGATCCAGGCGAmplicon SizecDNA: 144 bpgenomic: 3,552
Reverse (3999,22)CATTTGGTTCAGAGTCTCATCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.034 kcal/mol
Forward Dimers-0.737 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceGATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGG
GCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCG
GACGATGAGACTCTGAACCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1443682 - 3825
NM_003070 (SMARCA2)1443682 - 3825
Exon 26 To Exon 27 (Pair 14)
Forward (3859,20)CAGAAAGTGATCCAGGCGGGAmplicon SizecDNA: 137 bpgenomic: 3,545
Reverse (3995,21)TGGTTCAGAGTCTCATCGTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.156 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCA
TTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGAC
GATGAGACTCTGAACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1373685 - 3821
NM_139045 (SMARCA2)1373685 - 3821
Exon 26 To Exon 27 (Pair 15)
Forward (3893,20)AGTCTTCAAGCCACGAGCGGAmplicon SizecDNA: 88 bpgenomic: 3,496
Reverse (3980,22)TCGTCCGGTACTTCATCTTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.901 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-2.5 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAA
ATGAGGAAGAAGATGAAGTACCGGACGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)883719 - 3806
NM_003070 (SMARCA2)883719 - 3806
Exon 26 To Exon 28 (Pair 1)
Forward (3930,21)CATCTTGGAGCATGAGGAGGAAmplicon SizecDNA: 127 bpgenomic: 7,718
Reverse (4056,19)CCGCCGGTCCATGTCCATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.378 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.698 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCT
GAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGGATGGACATGGA
CCGGCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1273756 - 3882
NM_003070 (SMARCA2)1273756 - 3882
Exon 26 To Exon 27 (Pair 16)
Forward (3872,21)AGGCGGGCATGTTTGACCAAAAmplicon SizecDNA: 113 bpgenomic: 3,521
Reverse (3984,21)CTCATCGTCCGGTACTTCATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.07 kcal/mol in 3' area
Forward Dimers-1.17 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-2.137 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCA
TCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1133698 - 3810
NM_139045 (SMARCA2)1133698 - 3810
Exon 26 To Exon 27 (Pair 17)
Forward (3931,22)ATCTTGGAGCATGAGGAGGAAAAmplicon SizecDNA: 80 bpgenomic: 3,488
Reverse (4010,22)CGTCGAGCAATCATTTGGTTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.381 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.404 kcal/mol
Amplicon Folding1.494 kcal/mol inside primersite
Amplicon SequenceATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTG
AACCAAATGATTGCTCGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)803757 - 3836
NM_003070 (SMARCA2)803757 - 3836
Exon 26 To Exon 28 (Pair 2)
Forward (3930,21)CATCTTGGAGCATGAGGAGGAAmplicon SizecDNA: 125 bpgenomic: 7,716
Reverse (4054,19)GCCGGTCCATGTCCATCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.378 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.159 kcal/mol in 3' area
Reverse Dimers-2.738 kcal/mol
Forward-Reverse Dimers-1.698 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCT
GAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGGATGGACATGGA
CCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1253756 - 3880
NM_139045 (SMARCA2)1253756 - 3880
Exon 26 To Exon 27 (Pair 18)
Forward (3856,21)GATCAGAAAGTGATCCAGGCGAmplicon SizecDNA: 142 bpgenomic: 3,550
Reverse (3997,22)TTTGGTTCAGAGTCTCATCGTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.034 kcal/mol
Forward Dimers-0.737 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceGATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGG
GCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCG
GACGATGAGACTCTGAACCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1423682 - 3823
NM_003070 (SMARCA2)1423682 - 3823
Exon 26 To Exon 28 (Pair 3)
Forward (3930,21)CATCTTGGAGCATGAGGAGGAAmplicon SizecDNA: 126 bpgenomic: 7,717
Reverse (4055,19)CGCCGGTCCATGTCCATCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.378 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.698 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCT
GAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGGATGGACATGGA
CCGGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1263756 - 3881
NM_139045 (SMARCA2)1263756 - 3881
Exon 26 To Exon 27 (Pair 19)
Forward (3856,21)GATCAGAAAGTGATCCAGGCGAmplicon SizecDNA: 136 bpgenomic: 3,544
Reverse (3991,21)TCAGAGTCTCATCGTCCGGTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.034 kcal/mol
Forward Dimers-0.737 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceGATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGG
GCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCG
GACGATGAGACTCTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1363682 - 3817
NM_003070 (SMARCA2)1363682 - 3817
Exon 26 To Exon 27 (Pair 20)
Forward (3893,20)AGTCTTCAAGCCACGAGCGGAmplicon SizecDNA: 117 bpgenomic: 3,525
Reverse (4009,22)GTCGAGCAATCATTTGGTTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.901 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.881 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAA
ATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTGAACCAAATGATTGCTCGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1173719 - 3835
NM_003070 (SMARCA2)1173719 - 3835
Exon 26 To Exon 27 (Pair 21)
Forward (3856,21)GATCAGAAAGTGATCCAGGCGAmplicon SizecDNA: 140 bpgenomic: 3,548
Reverse (3995,21)TGGTTCAGAGTCTCATCGTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.034 kcal/mol
Forward Dimers-0.737 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceGATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGG
GCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCG
GACGATGAGACTCTGAACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1403682 - 3821
NM_003070 (SMARCA2)1403682 - 3821
Exon 26 To Exon 27 (Pair 22)
Forward (3860,20)AGAAAGTGATCCAGGCGGGCAmplicon SizecDNA: 121 bpgenomic: 3,529
Reverse (3980,22)TCGTCCGGTACTTCATCTTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCAT
TCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1213686 - 3806
NM_139045 (SMARCA2)1213686 - 3806
Exon 26 To Exon 27 (Pair 23)
Forward (3931,22)ATCTTGGAGCATGAGGAGGAAAAmplicon SizecDNA: 82 bpgenomic: 3,490
Reverse (4012,22)CTCGTCGAGCAATCATTTGGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.381 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-2.502 kcal/mol
Forward-Reverse Dimers-1.404 kcal/mol
Amplicon Folding1.494 kcal/mol inside primersite
Amplicon SequenceATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTG
AACCAAATGATTGCTCGACGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)823757 - 3838
NM_139045 (SMARCA2)823757 - 3838
Exon 26 To Exon 27 (Pair 24)
Forward (3860,20)AGAAAGTGATCCAGGCGGGCAmplicon SizecDNA: 151 bpgenomic: 3,559
Reverse (4010,22)CGTCGAGCAATCATTTGGTTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.522 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCAT
TCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACG
ATGAGACTCTGAACCAAATGATTGCTCGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1513686 - 3836
NM_139045 (SMARCA2)1513686 - 3836
Exon 26 To Exon 27 (Pair 25)
Forward (3859,20)CAGAAAGTGATCCAGGCGGGAmplicon SizecDNA: 122 bpgenomic: 3,530
Reverse (3980,22)TCGTCCGGTACTTCATCTTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.156 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCA
TTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGAC
GA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1223685 - 3806
NM_003070 (SMARCA2)1223685 - 3806
Exon 26 To Exon 27 (Pair 26)
Forward (3930,21)CATCTTGGAGCATGAGGAGGAAmplicon SizecDNA: 81 bpgenomic: 3,489
Reverse (4010,22)CGTCGAGCAATCATTTGGTTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.378 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.404 kcal/mol
Amplicon Folding1.494 kcal/mol inside primersite
Amplicon SequenceCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCT
GAACCAAATGATTGCTCGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)813756 - 3836
NM_003070 (SMARCA2)813756 - 3836
Exon 26 To Exon 27 (Pair 27)
Forward (3930,21)CATCTTGGAGCATGAGGAGGAAmplicon SizecDNA: 82 bpgenomic: 3,490
Reverse (4011,22)TCGTCGAGCAATCATTTGGTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.378 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.314 kcal/mol
Forward-Reverse Dimers-1.404 kcal/mol
Amplicon Folding1.494 kcal/mol inside primersite
Amplicon SequenceCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCT
GAACCAAATGATTGCTCGACGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)823756 - 3837
NM_139045 (SMARCA2)823756 - 3837
Exon 26 To Exon 27 (Pair 28)
Forward (3930,21)CATCTTGGAGCATGAGGAGGAAmplicon SizecDNA: 80 bpgenomic: 3,488
Reverse (4009,22)GTCGAGCAATCATTTGGTTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.378 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.404 kcal/mol
Amplicon Folding1.494 kcal/mol inside primersite
Amplicon SequenceCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCT
GAACCAAATGATTGCTCGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)803756 - 3835
NM_139045 (SMARCA2)803756 - 3835
Exon 26 To Exon 27 (Pair 29)
Forward (3859,20)CAGAAAGTGATCCAGGCGGGAmplicon SizecDNA: 151 bpgenomic: 3,559
Reverse (4009,22)GTCGAGCAATCATTTGGTTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.156 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.522 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCA
TTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGAC
GATGAGACTCTGAACCAAATGATTGCTCGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1513685 - 3835
NM_139045 (SMARCA2)1513685 - 3835
Exon 26 To Exon 27 (Pair 30)
Forward (3893,20)AGTCTTCAAGCCACGAGCGGAmplicon SizecDNA: 115 bpgenomic: 3,523
Reverse (4007,22)CGAGCAATCATTTGGTTCAGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.901 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.475 kcal/mol
Reverse Dimers-0.663 kcal/mol
Forward-Reverse Dimers-1.576 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAA
ATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTGAACCAAATGATTGCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1153719 - 3833
NM_139045 (SMARCA2)1153719 - 3833
Exon 26 To Exon 27 (Pair 31)
Forward (3856,21)GATCAGAAAGTGATCCAGGCGAmplicon SizecDNA: 126 bpgenomic: 3,534
Reverse (3981,22)ATCGTCCGGTACTTCATCTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.034 kcal/mol
Forward Dimers-0.737 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceGATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGG
GCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCG
GACGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1263682 - 3807
NM_139045 (SMARCA2)1263682 - 3807
Exon 26 To Exon 28 (Pair 4)
Forward (3931,22)ATCTTGGAGCATGAGGAGGAAAAmplicon SizecDNA: 125 bpgenomic: 7,716
Reverse (4055,19)CGCCGGTCCATGTCCATCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.381 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.698 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTG
AACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGGATGGACATGGAC
CGGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1253757 - 3881
NM_003070 (SMARCA2)1253757 - 3881
Exon 26 To Exon 27 (Pair 32)
Forward (3872,21)AGGCGGGCATGTTTGACCAAAAmplicon SizecDNA: 115 bpgenomic: 3,523
Reverse (3986,21)GTCTCATCGTCCGGTACTTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.07 kcal/mol in 3' area
Forward Dimers-1.17 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-2.137 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCA
TCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1153698 - 3812
NM_003070 (SMARCA2)1153698 - 3812
Exon 26 To Exon 27 (Pair 33)
Forward (3931,22)ATCTTGGAGCATGAGGAGGAAAAmplicon SizecDNA: 77 bpgenomic: 3,485
Reverse (4007,22)CGAGCAATCATTTGGTTCAGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.381 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.475 kcal/mol
Reverse Dimers-0.663 kcal/mol
Forward-Reverse Dimers-1.404 kcal/mol
Amplicon Folding1.494 kcal/mol inside primersite
Amplicon SequenceATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTG
AACCAAATGATTGCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)773757 - 3833
NM_003070 (SMARCA2)773757 - 3833
Exon 26 To Exon 27 (Pair 34)
Forward (3857,21)ATCAGAAAGTGATCCAGGCGGAmplicon SizecDNA: 125 bpgenomic: 3,533
Reverse (3981,22)ATCGTCCGGTACTTCATCTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.597 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGG
CATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGG
ACGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1253683 - 3807
NM_139045 (SMARCA2)1253683 - 3807
Exon 26 To Exon 27 (Pair 35)
Forward (3931,22)ATCTTGGAGCATGAGGAGGAAAAmplicon SizecDNA: 79 bpgenomic: 3,487
Reverse (4009,22)GTCGAGCAATCATTTGGTTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.381 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.404 kcal/mol
Amplicon Folding1.494 kcal/mol inside primersite
Amplicon SequenceATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTG
AACCAAATGATTGCTCGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)793757 - 3835
NM_003070 (SMARCA2)793757 - 3835
Exon 26 To Exon 27 (Pair 36)
Forward (3931,22)ATCTTGGAGCATGAGGAGGAAAAmplicon SizecDNA: 81 bpgenomic: 3,489
Reverse (4011,22)TCGTCGAGCAATCATTTGGTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.381 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.314 kcal/mol
Forward-Reverse Dimers-1.404 kcal/mol
Amplicon Folding1.494 kcal/mol inside primersite
Amplicon SequenceATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTG
AACCAAATGATTGCTCGACGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)813757 - 3837
NM_139045 (SMARCA2)813757 - 3837
Exon 26 To Exon 27 (Pair 37)
Forward (3872,21)AGGCGGGCATGTTTGACCAAAAmplicon SizecDNA: 117 bpgenomic: 3,525
Reverse (3988,21)GAGTCTCATCGTCCGGTACTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.07 kcal/mol in 3' area
Forward Dimers-1.17 kcal/mol
Reverse Loops1.792 kcal/mol in 3' area
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-2.137 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCA
TCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1173698 - 3814
NM_003070 (SMARCA2)1173698 - 3814
Exon 26 To Exon 27 (Pair 38)
Forward (3930,21)CATCTTGGAGCATGAGGAGGAAmplicon SizecDNA: 83 bpgenomic: 3,491
Reverse (4012,22)CTCGTCGAGCAATCATTTGGTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.378 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-2.502 kcal/mol
Forward-Reverse Dimers-1.404 kcal/mol
Amplicon Folding1.494 kcal/mol inside primersite
Amplicon SequenceCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCT
GAACCAAATGATTGCTCGACGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)833756 - 3838
NM_139045 (SMARCA2)833756 - 3838
Exon 26 To Exon 27 (Pair 39)
Forward (3857,21)ATCAGAAAGTGATCCAGGCGGAmplicon SizecDNA: 124 bpgenomic: 3,532
Reverse (3980,22)TCGTCCGGTACTTCATCTTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.597 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGG
CATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGG
ACGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1243683 - 3806
NM_003070 (SMARCA2)1243683 - 3806
Exon 26 To Exon 27 (Pair 40)
Forward (3872,21)AGGCGGGCATGTTTGACCAAAAmplicon SizecDNA: 109 bpgenomic: 3,517
Reverse (3980,22)TCGTCCGGTACTTCATCTTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.07 kcal/mol in 3' area
Forward Dimers-1.17 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-2.137 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCA
TCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1093698 - 3806
NM_139045 (SMARCA2)1093698 - 3806
Exon 26 To Exon 27 (Pair 41)
Forward (3930,21)CATCTTGGAGCATGAGGAGGAAmplicon SizecDNA: 78 bpgenomic: 3,486
Reverse (4007,22)CGAGCAATCATTTGGTTCAGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.378 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.475 kcal/mol
Reverse Dimers-0.663 kcal/mol
Forward-Reverse Dimers-1.404 kcal/mol
Amplicon Folding1.494 kcal/mol inside primersite
Amplicon SequenceCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCT
GAACCAAATGATTGCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)783756 - 3833
NM_139045 (SMARCA2)783756 - 3833
Exon 26 To Exon 28 (Pair 5)
Forward (3931,22)ATCTTGGAGCATGAGGAGGAAAAmplicon SizecDNA: 126 bpgenomic: 7,717
Reverse (4056,19)CCGCCGGTCCATGTCCATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.381 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.698 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTG
AACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGGATGGACATGGAC
CGGCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1263757 - 3882
NM_003070 (SMARCA2)1263757 - 3882
Exon 26 To Exon 27 (Pair 42)
Forward (3856,21)GATCAGAAAGTGATCCAGGCGAmplicon SizecDNA: 125 bpgenomic: 3,533
Reverse (3980,22)TCGTCCGGTACTTCATCTTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.034 kcal/mol
Forward Dimers-0.737 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceGATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGG
GCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCG
GACGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1253682 - 3806
NM_003070 (SMARCA2)1253682 - 3806
Exon 26 To Exon 27 (Pair 43)
Forward (3860,20)AGAAAGTGATCCAGGCGGGCAmplicon SizecDNA: 122 bpgenomic: 3,530
Reverse (3981,22)ATCGTCCGGTACTTCATCTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCAT
TCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACG
AT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1223686 - 3807
NM_139045 (SMARCA2)1223686 - 3807
Exon 26 To Exon 27 (Pair 44)
Forward (3860,20)AGAAAGTGATCCAGGCGGGCAmplicon SizecDNA: 124 bpgenomic: 3,532
Reverse (3983,22)TCATCGTCCGGTACTTCATCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCAT
TCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACG
ATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1243686 - 3809
NM_003070 (SMARCA2)1243686 - 3809
Exon 26 To Exon 27 (Pair 45)
Forward (3859,20)CAGAAAGTGATCCAGGCGGGAmplicon SizecDNA: 141 bpgenomic: 3,549
Reverse (3999,22)CATTTGGTTCAGAGTCTCATCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.156 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops1.824 kcal/mol
Reverse Dimers-2.336 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCA
TTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGAC
GATGAGACTCTGAACCAAATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1413685 - 3825
NM_139045 (SMARCA2)1413685 - 3825
Exon 26 To Exon 27 (Pair 46)
Forward (3857,21)ATCAGAAAGTGATCCAGGCGGAmplicon SizecDNA: 127 bpgenomic: 3,535
Reverse (3983,22)TCATCGTCCGGTACTTCATCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.597 kcal/mol
Forward Dimers-0.18 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceATCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGG
CATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGG
ACGATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1273683 - 3809
NM_139045 (SMARCA2)1273683 - 3809
Exon 26 To Exon 27 (Pair 47)
Forward (3860,20)AGAAAGTGATCCAGGCGGGCAmplicon SizecDNA: 150 bpgenomic: 3,558
Reverse (4009,22)GTCGAGCAATCATTTGGTTCAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.945 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.522 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCAT
TCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACG
ATGAGACTCTGAACCAAATGATTGCTCGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1503686 - 3835
NM_139045 (SMARCA2)1503686 - 3835
Exon 26 To Exon 27 (Pair 48)
Forward (3872,21)AGGCGGGCATGTTTGACCAAAAmplicon SizecDNA: 116 bpgenomic: 3,524
Reverse (3987,21)AGTCTCATCGTCCGGTACTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.07 kcal/mol in 3' area
Forward Dimers-1.17 kcal/mol
Reverse Loops2.128 kcal/mol in 3' area
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-2.137 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCA
TCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1163698 - 3813
NM_139045 (SMARCA2)1163698 - 3813
Exon 26 To Exon 27 (Pair 49)
Forward (3859,20)CAGAAAGTGATCCAGGCGGGAmplicon SizecDNA: 125 bpgenomic: 3,533
Reverse (3983,22)TCATCGTCCGGTACTTCATCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.156 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-1.883 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCA
TTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGAC
GATGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1253685 - 3809
NM_003070 (SMARCA2)1253685 - 3809
Exon 26 To Exon 28 (Pair 6)
Forward (3931,22)ATCTTGGAGCATGAGGAGGAAAAmplicon SizecDNA: 124 bpgenomic: 7,715
Reverse (4054,19)GCCGGTCCATGTCCATCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.381 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.159 kcal/mol in 3' area
Reverse Dimers-2.738 kcal/mol
Forward-Reverse Dimers-1.698 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTG
AACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGGATGGACATGGAC
CGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1243757 - 3880
NM_003070 (SMARCA2)1243757 - 3880
Exon 26 To Exon 27 (Pair 50)
Forward (3893,20)AGTCTTCAAGCCACGAGCGGAmplicon SizecDNA: 119 bpgenomic: 3,527
Reverse (4011,22)TCGTCGAGCAATCATTTGGTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.901 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.314 kcal/mol
Forward-Reverse Dimers-2.5 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAA
ATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTGAACCAAATGATTGCTCGACGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)1193719 - 3837
NM_003070 (SMARCA2)1193719 - 3837
Exon 26 To Exon 27 (Pair 51)
Forward (3859,20)CAGAAAGTGATCCAGGCGGGAmplicon SizecDNA: 149 bpgenomic: 3,557
Reverse (4007,22)CGAGCAATCATTTGGTTCAGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.156 kcal/mol in 3' area
Forward Dimers-0.18 kcal/mol
Reverse Loops0.475 kcal/mol
Reverse Dimers-0.663 kcal/mol
Forward-Reverse Dimers-1.522 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceCAGAAAGTGATCCAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCA
TTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGAC
GATGAGACTCTGAACCAAATGATTGCTCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1493685 - 3833
NM_139045 (SMARCA2)1493685 - 3833
Exon 26 To Exon 27 (Pair 52)
Forward (3893,20)AGTCTTCAAGCCACGAGCGGAmplicon SizecDNA: 118 bpgenomic: 3,526
Reverse (4010,22)CGTCGAGCAATCATTTGGTTCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.901 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops0.475 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.195 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCATCTTGGAGCATGAGGAGGAAA
ATGAGGAAGAAGATGAAGTACCGGACGATGAGACTCTGAACCAAATGATTGCTCGACG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1183719 - 3836
NM_139045 (SMARCA2)1183719 - 3836
Exon 26 To Exon 27 (Pair 53)
Forward (3872,21)AGGCGGGCATGTTTGACCAAAAmplicon SizecDNA: 110 bpgenomic: 3,518
Reverse (3981,22)ATCGTCCGGTACTTCATCTTCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.07 kcal/mol in 3' area
Forward Dimers-1.17 kcal/mol
Reverse Loops2.128 kcal/mol
Reverse Dimers-2.298 kcal/mol
Forward-Reverse Dimers-2.137 kcal/mol
Amplicon Folding-0.203 kcal/mol outside primersite
Amplicon SequenceAGGCGGGCATGTTTGACCAAAAGTCTTCAAGCCACGAGCGGAGGGCATTCCTGCAGGCCA
TCTTGGAGCATGAGGAGGAAAATGAGGAAGAAGATGAAGTACCGGACGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1103698 - 3807
NM_139045 (SMARCA2)1103698 - 3807
Exon 27 To Exon 28 (Pair 1)
Forward (3979,23)GATGAGACTCTGAACCAAATGATAmplicon SizecDNA: 76 bpgenomic: 4,259
Reverse (4054,19)GCCGGTCCATGTCCATCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops1.159 kcal/mol in 3' area
Reverse Dimers-2.738 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceGATGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGG
ATGGACATGGACCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)763805 - 3880
NM_139045 (SMARCA2)763805 - 3880
Exon 27 To Exon 28 (Pair 2)
Forward (3981,23)TGAGACTCTGAACCAAATGATTGAmplicon SizecDNA: 76 bpgenomic: 4,259
Reverse (4056,19)CCGCCGGTCCATGTCCATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.705 kcal/mol in 3' area
Forward Dimers-0.739 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceTGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGGAT
GGACATGGACCGGCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)763807 - 3882
NM_139045 (SMARCA2)763807 - 3882
Exon 27 To Exon 28 (Pair 3)
Forward (3981,23)TGAGACTCTGAACCAAATGATTGAmplicon SizecDNA: 75 bpgenomic: 4,258
Reverse (4055,19)CGCCGGTCCATGTCCATCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.705 kcal/mol in 3' area
Forward Dimers-0.739 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceTGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGGAT
GGACATGGACCGGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)753807 - 3881
NM_139045 (SMARCA2)753807 - 3881
Exon 27 To Exon 28 (Pair 4)
Forward (3979,23)GATGAGACTCTGAACCAAATGATAmplicon SizecDNA: 80 bpgenomic: 4,263
Reverse (4058,19)CTCCGCCGGTCCATGTCCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops2.087 kcal/mol
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceGATGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGG
ATGGACATGGACCGGCGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)803805 - 3884
NM_139045 (SMARCA2)803805 - 3884
Exon 27 To Exon 28 (Pair 5)
Forward (3978,22)CGATGAGACTCTGAACCAAATGAmplicon SizecDNA: 81 bpgenomic: 4,264
Reverse (4058,19)CTCCGCCGGTCCATGTCCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops2.087 kcal/mol
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceCGATGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCG
GATGGACATGGACCGGCGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)813804 - 3884
NM_139045 (SMARCA2)813804 - 3884
Exon 27 To Exon 28 (Pair 6)
Forward (3986,22)CTCTGAACCAAATGATTGCTCGAmplicon SizecDNA: 73 bpgenomic: 4,256
Reverse (4058,19)CTCCGCCGGTCCATGTCCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.494 kcal/mol in 3' area
Forward Dimers-0.379 kcal/mol
Reverse Loops2.087 kcal/mol
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceCTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGGATGGACA
TGGACCGGCGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)733812 - 3884
NM_139045 (SMARCA2)733812 - 3884
Exon 27 To Exon 28 (Pair 7)
Forward (3979,23)GATGAGACTCTGAACCAAATGATAmplicon SizecDNA: 78 bpgenomic: 4,261
Reverse (4056,19)CCGCCGGTCCATGTCCATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceGATGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGG
ATGGACATGGACCGGCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)783805 - 3882
NM_139045 (SMARCA2)783805 - 3882
Exon 27 To Exon 28 (Pair 8)
Forward (3978,22)CGATGAGACTCTGAACCAAATGAmplicon SizecDNA: 77 bpgenomic: 4,260
Reverse (4054,19)GCCGGTCCATGTCCATCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops1.159 kcal/mol in 3' area
Reverse Dimers-2.738 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceCGATGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCG
GATGGACATGGACCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)773804 - 3880
NM_003070 (SMARCA2)773804 - 3880
Exon 27 To Exon 28 (Pair 9)
Forward (3981,23)TGAGACTCTGAACCAAATGATTGAmplicon SizecDNA: 78 bpgenomic: 4,261
Reverse (4058,19)CTCCGCCGGTCCATGTCCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.705 kcal/mol in 3' area
Forward Dimers-0.739 kcal/mol
Reverse Loops2.087 kcal/mol
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceTGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGGAT
GGACATGGACCGGCGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)783807 - 3884
NM_003070 (SMARCA2)783807 - 3884
Exon 27 To Exon 28 (Pair 10)
Forward (3978,22)CGATGAGACTCTGAACCAAATGAmplicon SizecDNA: 78 bpgenomic: 4,261
Reverse (4055,19)CGCCGGTCCATGTCCATCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceCGATGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCG
GATGGACATGGACCGGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)783804 - 3881
NM_003070 (SMARCA2)783804 - 3881
Exon 27 To Exon 28 (Pair 11)
Forward (3975,21)GGACGATGAGACTCTGAACCAAmplicon SizecDNA: 80 bpgenomic: 4,263
Reverse (4054,19)GCCGGTCCATGTCCATCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.159 kcal/mol in 3' area
Reverse Dimers-2.738 kcal/mol
Forward-Reverse Dimers-1.821 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceGGACGATGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTAT
GCGGATGGACATGGACCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)803801 - 3880
NM_003070 (SMARCA2)803801 - 3880
Exon 27 To Exon 28 (Pair 12)
Forward (3981,23)TGAGACTCTGAACCAAATGATTGAmplicon SizecDNA: 74 bpgenomic: 4,257
Reverse (4054,19)GCCGGTCCATGTCCATCCGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.705 kcal/mol in 3' area
Forward Dimers-0.739 kcal/mol
Reverse Loops1.159 kcal/mol in 3' area
Reverse Dimers-2.738 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceTGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGGAT
GGACATGGACCGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)743807 - 3880
NM_003070 (SMARCA2)743807 - 3880
Exon 27 To Exon 28 (Pair 13)
Forward (3978,22)CGATGAGACTCTGAACCAAATGAmplicon SizecDNA: 79 bpgenomic: 4,262
Reverse (4056,19)CCGCCGGTCCATGTCCATCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceCGATGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCG
GATGGACATGGACCGGCGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)793804 - 3882
NM_139045 (SMARCA2)793804 - 3882
Exon 27 To Exon 28 (Pair 14)
Forward (3979,23)GATGAGACTCTGAACCAAATGATAmplicon SizecDNA: 77 bpgenomic: 4,260
Reverse (4055,19)CGCCGGTCCATGTCCATCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.847 kcal/mol
Forward Dimers-0.739 kcal/mol
Reverse Loops1.671 kcal/mol in 3' area
Reverse Dimers-2.894 kcal/mol
Forward-Reverse Dimers-1.758 kcal/mol
Amplicon Folding0.719 kcal/mol inside primersite
Amplicon SequenceGATGAGACTCTGAACCAAATGATTGCTCGACGAGAAGAAGAATTTGACCTTTTTATGCGG
ATGGACATGGACCGGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_139045 (SMARCA2)773805 - 3881
NM_003070 (SMARCA2)773805 - 3881
Exon 32 To Exon 33 (Pair 1)
Forward (5224,22)GCTGAGAAACTGTCACCAAATCAmplicon SizecDNA: 123 bpgenomic: 8,638
Reverse (5346,22)TTCCAACTGAGAATTACTGGGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.684 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding0.426 kcal/mol outside primersite
Amplicon SequenceGCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGAACGCTATCATCGAT
ACTGTGATAAACTACAAAGATAGGTGTAACGTGGAGAAGGTGCCCAGTAATTCTCAGTTG
GAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1234216 - 4338
Exon 32 To Exon 33 (Pair 2)
Forward (5222,21)CCGCTGAGAAACTGTCACCAAAmplicon SizecDNA: 127 bpgenomic: 8,642
Reverse (5348,23)ATTTCCAACTGAGAATTACTGGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.684 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding0.426 kcal/mol outside primersite
Amplicon SequenceCCGCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGAACGCTATCATCG
ATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAGAAGGTGCCCAGTAATTCTCAGT
TGGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1274214 - 4340
Exon 32 To Exon 33 (Pair 3)
Forward (5260,22)AAGCAGATGAACGCTATCATCGAmplicon SizecDNA: 87 bpgenomic: 8,602
Reverse (5346,22)TTCCAACTGAGAATTACTGGGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.426 kcal/mol
Forward Dimers-1.401 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-2.086 kcal/mol
Amplicon Folding0.426 kcal/mol inside primersite
Amplicon SequenceAAGCAGATGAACGCTATCATCGATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAG
AAGGTGCCCAGTAATTCTCAGTTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)874252 - 4338
Exon 32 To Exon 33 (Pair 4)
Forward (5223,22)CGCTGAGAAACTGTCACCAAATAmplicon SizecDNA: 123 bpgenomic: 8,638
Reverse (5345,22)TCCAACTGAGAATTACTGGGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.684 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding0.426 kcal/mol outside primersite
Amplicon SequenceCGCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGAACGCTATCATCGA
TACTGTGATAAACTACAAAGATAGGTGTAACGTGGAGAAGGTGCCCAGTAATTCTCAGTT
GGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1234215 - 4337
Exon 32 To Exon 34 (Pair 1)
Forward (5260,22)AAGCAGATGAACGCTATCATCGAmplicon SizecDNA: 124 bpgenomic: 19,737
Reverse (5383,20)CTTCACTGAGCTGTCGCCCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.426 kcal/mol
Forward Dimers-1.401 kcal/mol
Reverse Loops1.263 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.426 kcal/mol inside primersite
Amplicon SequenceAAGCAGATGAACGCTATCATCGATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAG
AAGGTGCCCAGTAATTCTCAGTTGGAAATAGAAGGAAACAGTTCAGGGCGACAGCTCAGT
GAAG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1244252 - 4375
NM_139045 (SMARCA2)704252 - 4321
Exon 32 To Exon 33 (Pair 5)
Forward (5260,22)AAGCAGATGAACGCTATCATCGAmplicon SizecDNA: 89 bpgenomic: 8,604
Reverse (5348,23)ATTTCCAACTGAGAATTACTGGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.426 kcal/mol
Forward Dimers-1.401 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-2.086 kcal/mol
Amplicon Folding0.426 kcal/mol inside primersite
Amplicon SequenceAAGCAGATGAACGCTATCATCGATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAG
AAGGTGCCCAGTAATTCTCAGTTGGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)894252 - 4340
Exon 32 To Exon 34 (Pair 2)
Forward (5260,22)AAGCAGATGAACGCTATCATCGAmplicon SizecDNA: 125 bpgenomic: 19,738
Reverse (5384,20)ACTTCACTGAGCTGTCGCCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.426 kcal/mol
Forward Dimers-1.401 kcal/mol
Reverse Loops1.263 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.426 kcal/mol inside primersite
Amplicon SequenceAAGCAGATGAACGCTATCATCGATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAG
AAGGTGCCCAGTAATTCTCAGTTGGAAATAGAAGGAAACAGTTCAGGGCGACAGCTCAGT
GAAGT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1254252 - 4376
NM_139045 (SMARCA2)714252 - 4322
Exon 32 To Exon 33 (Pair 6)
Forward (5224,22)GCTGAGAAACTGTCACCAAATCAmplicon SizecDNA: 125 bpgenomic: 8,640
Reverse (5348,23)ATTTCCAACTGAGAATTACTGGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.684 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding0.426 kcal/mol outside primersite
Amplicon SequenceGCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGAACGCTATCATCGAT
ACTGTGATAAACTACAAAGATAGGTGTAACGTGGAGAAGGTGCCCAGTAATTCTCAGTTG
GAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1254216 - 4340
Exon 32 To Exon 34 (Pair 3)
Forward (5260,22)AAGCAGATGAACGCTATCATCGAmplicon SizecDNA: 123 bpgenomic: 19,736
Reverse (5382,20)TTCACTGAGCTGTCGCCCTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.426 kcal/mol
Forward Dimers-1.401 kcal/mol
Reverse Loops1.263 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.426 kcal/mol inside primersite
Amplicon SequenceAAGCAGATGAACGCTATCATCGATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAG
AAGGTGCCCAGTAATTCTCAGTTGGAAATAGAAGGAAACAGTTCAGGGCGACAGCTCAGT
GAA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1234252 - 4374
NM_139045 (SMARCA2)694252 - 4320
Exon 32 To Exon 33 (Pair 7)
Forward (5260,22)AAGCAGATGAACGCTATCATCGAmplicon SizecDNA: 86 bpgenomic: 8,601
Reverse (5345,22)TCCAACTGAGAATTACTGGGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.426 kcal/mol
Forward Dimers-1.401 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-2.086 kcal/mol
Amplicon Folding0.426 kcal/mol inside primersite
Amplicon SequenceAAGCAGATGAACGCTATCATCGATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAG
AAGGTGCCCAGTAATTCTCAGTTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)864252 - 4337
Exon 32 To Exon 33 (Pair 8)
Forward (5225,22)CTGAGAAACTGTCACCAAATCCAmplicon SizecDNA: 121 bpgenomic: 8,636
Reverse (5345,22)TCCAACTGAGAATTACTGGGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.684 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.086 kcal/mol
Amplicon Folding0.426 kcal/mol outside primersite
Amplicon SequenceCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGAACGCTATCATCGATA
CTGTGATAAACTACAAAGATAGGTGTAACGTGGAGAAGGTGCCCAGTAATTCTCAGTTGG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1214217 - 4337
Exon 32 To Exon 33 (Pair 9)
Forward (5222,21)CCGCTGAGAAACTGTCACCAAAmplicon SizecDNA: 124 bpgenomic: 8,639
Reverse (5345,22)TCCAACTGAGAATTACTGGGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.684 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding0.426 kcal/mol outside primersite
Amplicon SequenceCCGCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGAACGCTATCATCG
ATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAGAAGGTGCCCAGTAATTCTCAGT
TGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1244214 - 4337
Exon 32 To Exon 33 (Pair 10)
Forward (5223,22)CGCTGAGAAACTGTCACCAAATAmplicon SizecDNA: 124 bpgenomic: 8,639
Reverse (5346,22)TTCCAACTGAGAATTACTGGGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.684 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding0.426 kcal/mol outside primersite
Amplicon SequenceCGCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGAACGCTATCATCGA
TACTGTGATAAACTACAAAGATAGGTGTAACGTGGAGAAGGTGCCCAGTAATTCTCAGTT
GGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1244215 - 4338
Exon 32 To Exon 34 (Pair 4)
Forward (5260,22)AAGCAGATGAACGCTATCATCGAmplicon SizecDNA: 128 bpgenomic: 19,741
Reverse (5387,21)AAGACTTCACTGAGCTGTCGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.426 kcal/mol
Forward Dimers-1.401 kcal/mol
Reverse Loops1.382 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.426 kcal/mol inside primersite
Amplicon SequenceAAGCAGATGAACGCTATCATCGATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAG
AAGGTGCCCAGTAATTCTCAGTTGGAAATAGAAGGAAACAGTTCAGGGCGACAGCTCAGT
GAAGTCTT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1284252 - 4379
NM_139045 (SMARCA2)744252 - 4325
Exon 32 To Exon 33 (Pair 11)
Forward (5222,21)CCGCTGAGAAACTGTCACCAAAmplicon SizecDNA: 125 bpgenomic: 8,640
Reverse (5346,22)TTCCAACTGAGAATTACTGGGCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.684 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding0.426 kcal/mol outside primersite
Amplicon SequenceCCGCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGAACGCTATCATCG
ATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAGAAGGTGCCCAGTAATTCTCAGT
TGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1254214 - 4338
Exon 32 To Exon 34 (Pair 5)
Forward (5260,22)AAGCAGATGAACGCTATCATCGAmplicon SizecDNA: 126 bpgenomic: 19,739
Reverse (5385,20)GACTTCACTGAGCTGTCGCCNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.426 kcal/mol
Forward Dimers-1.401 kcal/mol
Reverse Loops1.263 kcal/mol in 3' area
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.426 kcal/mol inside primersite
Amplicon SequenceAAGCAGATGAACGCTATCATCGATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAG
AAGGTGCCCAGTAATTCTCAGTTGGAAATAGAAGGAAACAGTTCAGGGCGACAGCTCAGT
GAAGTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1264252 - 4377
NM_139045 (SMARCA2)724252 - 4323
Exon 32 To Exon 34 (Pair 6)
Forward (5260,22)AAGCAGATGAACGCTATCATCGAmplicon SizecDNA: 122 bpgenomic: 19,735
Reverse (5381,20)TCACTGAGCTGTCGCCCTGANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.426 kcal/mol
Forward Dimers-1.401 kcal/mol
Reverse Loops1.263 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.426 kcal/mol inside primersite
Amplicon SequenceAAGCAGATGAACGCTATCATCGATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAG
AAGGTGCCCAGTAATTCTCAGTTGGAAATAGAAGGAAACAGTTCAGGGCGACAGCTCAGT
GA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1224252 - 4373
NM_139045 (SMARCA2)684252 - 4319
Exon 32 To Exon 33 (Pair 12)
Forward (5224,22)GCTGAGAAACTGTCACCAAATCAmplicon SizecDNA: 122 bpgenomic: 8,637
Reverse (5345,22)TCCAACTGAGAATTACTGGGCANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.684 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding0.426 kcal/mol outside primersite
Amplicon SequenceGCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGAACGCTATCATCGAT
ACTGTGATAAACTACAAAGATAGGTGTAACGTGGAGAAGGTGCCCAGTAATTCTCAGTTG
GA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1224216 - 4337
Exon 32 To Exon 34 (Pair 7)
Forward (5260,22)AAGCAGATGAACGCTATCATCGAmplicon SizecDNA: 121 bpgenomic: 19,734
Reverse (5380,20)CACTGAGCTGTCGCCCTGAANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.426 kcal/mol
Forward Dimers-1.401 kcal/mol
Reverse Loops1.263 kcal/mol
Reverse Dimers-2.732 kcal/mol
Forward-Reverse Dimers-2.095 kcal/mol
Amplicon Folding0.426 kcal/mol inside primersite
Amplicon SequenceAAGCAGATGAACGCTATCATCGATACTGTGATAAACTACAAAGATAGGTGTAACGTGGAG
AAGGTGCCCAGTAATTCTCAGTTGGAAATAGAAGGAAACAGTTCAGGGCGACAGCTCAGT
G
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1214252 - 4372
NM_139045 (SMARCA2)674252 - 4318
Exon 32 To Exon 33 (Pair 13)
Forward (5223,22)CGCTGAGAAACTGTCACCAAATAmplicon SizecDNA: 126 bpgenomic: 8,641
Reverse (5348,23)ATTTCCAACTGAGAATTACTGGGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.684 kcal/mol
Forward Dimers-0.96 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-0.936 kcal/mol
Forward-Reverse Dimers-1.14 kcal/mol
Amplicon Folding0.426 kcal/mol outside primersite
Amplicon SequenceCGCTGAGAAACTGTCACCAAATCCCCCCAAACTGACAAAGCAGATGAACGCTATCATCGA
TACTGTGATAAACTACAAAGATAGGTGTAACGTGGAGAAGGTGCCCAGTAATTCTCAGTT
GGAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1264215 - 4340
Exon 33 To Exon 34 (Pair 1)
Forward (5321,22)AGGTGCCCAGTAATTCTCAGTTAmplicon SizecDNA: 102 bpgenomic: 11,200
Reverse (5422,24)ATTCTGGTAATTCTTTCCTTGAAGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.185 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.781 kcal/mol
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-1.459 kcal/mol
Amplicon Folding0.203 kcal/mol inside primersite
Amplicon SequenceAGGTGCCCAGTAATTCTCAGTTGGAAATAGAAGGAAACAGTTCAGGGCGACAGCTCAGTG
AAGTCTTCATTCAGTTACCTTCAAGGAAAGAATTACCAGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1024313 - 4414
Exon 33 To Exon 34 (Pair 2)
Forward (5321,22)AGGTGCCCAGTAATTCTCAGTTAmplicon SizecDNA: 105 bpgenomic: 11,203
Reverse (5425,24)AGTATTCTGGTAATTCTTTCCTTGNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.185 kcal/mol
Forward Dimers-0.847 kcal/mol
Reverse Loops1.551 kcal/mol
Reverse Dimers-0.402 kcal/mol
Forward-Reverse Dimers-1.459 kcal/mol
Amplicon Folding0.203 kcal/mol inside primersite
Amplicon SequenceAGGTGCCCAGTAATTCTCAGTTGGAAATAGAAGGAAACAGTTCAGGGCGACAGCTCAGTG
AAGTCTTCATTCAGTTACCTTCAAGGAAAGAATTACCAGAATACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003070 (SMARCA2)1054313 - 4417
 

See below for some more details.

Program Output:

Loading ...