Design Results for SMARCB1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 4 (Pair 1)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 259 bpgenomic: 9,178
Reverse (652,20)GGAGCATGGCACGGCATCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTT
AGATGCCGTGCCATGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)232393 - 624
NM_003073 (SMARCB1)259393 - 651
Exon 2 To Exon 4 (Pair 2)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 259 bpgenomic: 9,178
Reverse (653,20)TGGAGCATGGCACGGCATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTA
GATGCCGTGCCATGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)232394 - 625
NM_003073 (SMARCB1)259394 - 652
Exon 2 To Exon 4 (Pair 3)
Forward (373,22)CACTGTGGAAGAGAGGAAGAAAAmplicon SizecDNA: 278 bpgenomic: 9,197
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.933 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.214 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCACTGTGGAAGAGAGGAAGAAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAA
CACTAAGGATCACGGATACACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGA
AGTGGAAGAGATTCTGGATGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGA
GCCCCCCACCTACCTCAGGGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCT
GCCCAACAGCTCCCACCACTTAGATGCCGTGCCATGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)278372 - 649
NM_001007468 (SMARCB1)251372 - 622
Exon 2 To Exon 4 (Pair 4)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 211 bpgenomic: 9,130
Reverse (604,21)TACCCACTGGCTGTTCCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAGCCAGTGGGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)184393 - 576
NM_003073 (SMARCB1)211393 - 603
Exon 2 To Exon 4 (Pair 5)
Forward (393,23)AAATAGTTGCATCGTCACATGGTAmplicon SizecDNA: 260 bpgenomic: 9,179
Reverse (652,20)GGAGCATGGCACGGCATCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.902 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACA
CGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATG
GCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGG
AACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACT
TAGATGCCGTGCCATGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)233392 - 624
NM_003073 (SMARCB1)260392 - 651
Exon 2 To Exon 4 (Pair 6)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 212 bpgenomic: 9,131
Reverse (605,20)GTACCCACTGGCTGTTCCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAGCCAGTGGGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)185393 - 577
NM_003073 (SMARCB1)212393 - 604
Exon 2 To Exon 4 (Pair 7)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 213 bpgenomic: 9,132
Reverse (606,20)GGTACCCACTGGCTGTTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol in 3' area
Reverse Dimers-2.176 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAGCCAGTGGGTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)213393 - 605
NM_001007468 (SMARCB1)186393 - 578
Exon 2 To Exon 4 (Pair 8)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 208 bpgenomic: 9,127
Reverse (601,20)CCACTGGCTGTTCCTCTTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.02 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAGCCAGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)181393 - 573
NM_003073 (SMARCB1)208393 - 600
Exon 2 To Exon 4 (Pair 9)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 200 bpgenomic: 9,119
Reverse (594,21)CTGTTCCTCTTGGCCTTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)173394 - 566
NM_003073 (SMARCB1)200394 - 593
Exon 2 To Exon 4 (Pair 10)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 257 bpgenomic: 9,176
Reverse (652,20)GGAGCATGGCACGGCATCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAG
ATGCCGTGCCATGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)257395 - 651
NM_001007468 (SMARCB1)230395 - 624
Exon 2 To Exon 4 (Pair 11)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 206 bpgenomic: 9,125
Reverse (600,20)CACTGGCTGTTCCTCTTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAGCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)179394 - 572
NM_003073 (SMARCB1)206394 - 599
Exon 2 To Exon 4 (Pair 12)
Forward (393,23)AAATAGTTGCATCGTCACATGGTAmplicon SizecDNA: 261 bpgenomic: 9,180
Reverse (653,20)TGGAGCATGGCACGGCATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.902 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACA
CGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATG
GCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGG
AACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACT
TAGATGCCGTGCCATGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)261392 - 652
NM_001007468 (SMARCB1)234392 - 625
Exon 2 To Exon 4 (Pair 13)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 279 bpgenomic: 9,198
Reverse (673,21)GCGGTTCCTGTTGATGGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.024 kcal/mol
Forward-Reverse Dimers-0.966 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTA
GATGCCGTGCCATGCTCCACAACCATCAACAGGAACCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)279394 - 672
NM_001007468 (SMARCB1)252394 - 645
Exon 2 To Exon 4 (Pair 14)
Forward (373,22)CACTGTGGAAGAGAGGAAGAAAAmplicon SizecDNA: 281 bpgenomic: 9,200
Reverse (653,20)TGGAGCATGGCACGGCATCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.933 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.214 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCACTGTGGAAGAGAGGAAGAAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAA
CACTAAGGATCACGGATACACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGA
AGTGGAAGAGATTCTGGATGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGA
GCCCCCCACCTACCTCAGGGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCT
GCCCAACAGCTCCCACCACTTAGATGCCGTGCCATGCTCCA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)281372 - 652
NM_001007468 (SMARCB1)254372 - 625
Exon 2 To Exon 4 (Pair 15)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 210 bpgenomic: 9,129
Reverse (605,20)GTACCCACTGGCTGTTCCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAGCCAGTGGGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)210395 - 604
NM_001007468 (SMARCB1)183395 - 577
Exon 2 To Exon 4 (Pair 16)
Forward (373,22)CACTGTGGAAGAGAGGAAGAAAAmplicon SizecDNA: 234 bpgenomic: 9,153
Reverse (606,20)GGTACCCACTGGCTGTTCCTNr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.933 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.002 kcal/mol in 3' area
Reverse Dimers-2.176 kcal/mol
Forward-Reverse Dimers-2.458 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceCACTGTGGAAGAGAGGAAGAAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAA
CACTAAGGATCACGGATACACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGA
AGTGGAAGAGATTCTGGATGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGA
GCCCCCCACCTACCTCAGGGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)207372 - 578
NM_003073 (SMARCB1)234372 - 605
Exon 2 To Exon 4 (Pair 17)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 207 bpgenomic: 9,126
Reverse (601,20)CCACTGGCTGTTCCTCTTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.02 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAGCCAGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)207394 - 600
NM_001007468 (SMARCB1)180394 - 573
Exon 2 To Exon 4 (Pair 18)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 199 bpgenomic: 9,118
Reverse (594,21)CTGTTCCTCTTGGCCTTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)172395 - 566
NM_003073 (SMARCB1)199395 - 593
Exon 2 To Exon 4 (Pair 19)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 212 bpgenomic: 9,131
Reverse (606,20)GGTACCCACTGGCTGTTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol in 3' area
Reverse Dimers-2.176 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAGCCAGTGGGTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)185394 - 578
NM_003073 (SMARCB1)212394 - 605
Exon 2 To Exon 4 (Pair 20)
Forward (393,23)AAATAGTTGCATCGTCACATGGTAmplicon SizecDNA: 214 bpgenomic: 9,133
Reverse (606,20)GGTACCCACTGGCTGTTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.902 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol in 3' area
Reverse Dimers-2.176 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACA
CGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATG
GCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGG
AACAGAAGGCCAAGAGGAACAGCCAGTGGGTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)187392 - 578
NM_003073 (SMARCB1)214392 - 605
Exon 2 To Exon 4 (Pair 21)
Forward (373,22)CACTGTGGAAGAGAGGAAGAAAAmplicon SizecDNA: 280 bpgenomic: 9,199
Reverse (652,20)GGAGCATGGCACGGCATCTANr. of Isoforms 1 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.933 kcal/mol
Forward Dimers-0.734 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.214 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCACTGTGGAAGAGAGGAAGAAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAA
CACTAAGGATCACGGATACACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGA
AGTGGAAGAGATTCTGGATGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGA
GCCCCCCACCTACCTCAGGGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCT
GCCCAACAGCTCCCACCACTTAGATGCCGTGCCATGCTCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)253372 - 624
NM_003073 (SMARCB1)280372 - 651
Exon 2 To Exon 4 (Pair 22)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 205 bpgenomic: 9,124
Reverse (600,20)CACTGGCTGTTCCTCTTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAGCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)205395 - 599
NM_001007468 (SMARCB1)178395 - 572
Exon 2 To Exon 4 (Pair 23)
Forward (393,23)AAATAGTTGCATCGTCACATGGTAmplicon SizecDNA: 210 bpgenomic: 9,129
Reverse (602,20)CCCACTGGCTGTTCCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.902 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACA
CGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATG
GCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGG
AACAGAAGGCCAAGAGGAACAGCCAGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)183392 - 574
NM_003073 (SMARCB1)210392 - 601
Exon 2 To Exon 4 (Pair 24)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 201 bpgenomic: 9,120
Reverse (594,21)CTGTTCCTCTTGGCCTTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-0.871 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)174393 - 566
NM_003073 (SMARCB1)201393 - 593
Exon 2 To Exon 4 (Pair 25)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 207 bpgenomic: 9,126
Reverse (602,20)CCCACTGGCTGTTCCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAGCCAGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)207395 - 601
NM_001007468 (SMARCB1)180395 - 574
Exon 2 To Exon 4 (Pair 26)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 209 bpgenomic: 9,128
Reverse (602,20)CCCACTGGCTGTTCCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAGCCAGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)182393 - 574
NM_003073 (SMARCB1)209393 - 601
Exon 2 To Exon 4 (Pair 27)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 211 bpgenomic: 9,130
Reverse (605,20)GTACCCACTGGCTGTTCCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAGCCAGTGGGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)184394 - 577
NM_003073 (SMARCB1)211394 - 604
Exon 2 To Exon 4 (Pair 28)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 207 bpgenomic: 9,126
Reverse (600,20)CACTGGCTGTTCCTCTTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAGCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)207393 - 599
NM_001007468 (SMARCB1)180393 - 572
Exon 2 To Exon 4 (Pair 29)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 255 bpgenomic: 9,174
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAG
ATGCCGTGCCATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)255395 - 649
NM_001007468 (SMARCB1)228395 - 622
Exon 2 To Exon 4 (Pair 30)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 256 bpgenomic: 9,175
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTA
GATGCCGTGCCATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)256394 - 649
NM_001007468 (SMARCB1)229394 - 622
Exon 2 To Exon 4 (Pair 31)
Forward (393,23)AAATAGTTGCATCGTCACATGGTAmplicon SizecDNA: 213 bpgenomic: 9,132
Reverse (605,20)GTACCCACTGGCTGTTCCTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.902 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACA
CGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATG
GCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGG
AACAGAAGGCCAAGAGGAACAGCCAGTGGGTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)186392 - 577
NM_003073 (SMARCB1)213392 - 604
Exon 2 To Exon 4 (Pair 32)
Forward (393,23)AAATAGTTGCATCGTCACATGGTAmplicon SizecDNA: 212 bpgenomic: 9,131
Reverse (604,21)TACCCACTGGCTGTTCCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.902 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACA
CGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATG
GCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGG
AACAGAAGGCCAAGAGGAACAGCCAGTGGGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)212392 - 603
NM_001007468 (SMARCB1)185392 - 576
Exon 2 To Exon 4 (Pair 33)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 257 bpgenomic: 9,176
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTT
AGATGCCGTGCCATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)257393 - 649
NM_001007468 (SMARCB1)230393 - 622
Exon 2 To Exon 4 (Pair 34)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 258 bpgenomic: 9,177
Reverse (652,20)GGAGCATGGCACGGCATCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTA
GATGCCGTGCCATGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)258394 - 651
NM_001007468 (SMARCB1)231394 - 624
Exon 2 To Exon 4 (Pair 35)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 278 bpgenomic: 9,197
Reverse (673,21)GCGGTTCCTGTTGATGGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.024 kcal/mol
Forward-Reverse Dimers-0.966 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAG
ATGCCGTGCCATGCTCCACAACCATCAACAGGAACCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)251395 - 645
NM_003073 (SMARCB1)278395 - 672
Exon 2 To Exon 4 (Pair 36)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 280 bpgenomic: 9,199
Reverse (674,21)TGCGGTTCCTGTTGATGGTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.024 kcal/mol
Forward-Reverse Dimers-1.062 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTA
GATGCCGTGCCATGCTCCACAACCATCAACAGGAACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)253394 - 646
NM_003073 (SMARCB1)280394 - 673
Exon 2 To Exon 4 (Pair 37)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 279 bpgenomic: 9,198
Reverse (674,21)TGCGGTTCCTGTTGATGGTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.024 kcal/mol
Forward-Reverse Dimers-1.062 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAG
ATGCCGTGCCATGCTCCACAACCATCAACAGGAACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)279395 - 673
NM_001007468 (SMARCB1)252395 - 646
Exon 2 To Exon 4 (Pair 38)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 209 bpgenomic: 9,128
Reverse (604,21)TACCCACTGGCTGTTCCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAGCCAGTGGGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)182395 - 576
NM_003073 (SMARCB1)209395 - 603
Exon 2 To Exon 4 (Pair 39)
Forward (393,23)AAATAGTTGCATCGTCACATGGTAmplicon SizecDNA: 281 bpgenomic: 9,200
Reverse (673,21)GCGGTTCCTGTTGATGGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.902 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.024 kcal/mol
Forward-Reverse Dimers-0.966 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACA
CGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATG
GCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGG
AACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACT
TAGATGCCGTGCCATGCTCCACAACCATCAACAGGAACCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)281392 - 672
NM_001007468 (SMARCB1)254392 - 645
Exon 2 To Exon 4 (Pair 40)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 208 bpgenomic: 9,127
Reverse (602,20)CCCACTGGCTGTTCCTCTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAGCCAGTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)208394 - 601
NM_001007468 (SMARCB1)181394 - 574
Exon 2 To Exon 4 (Pair 41)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 280 bpgenomic: 9,199
Reverse (673,21)GCGGTTCCTGTTGATGGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.024 kcal/mol
Forward-Reverse Dimers-0.966 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTT
AGATGCCGTGCCATGCTCCACAACCATCAACAGGAACCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)280393 - 672
NM_001007468 (SMARCB1)253393 - 645
Exon 2 To Exon 4 (Pair 42)
Forward (393,23)AAATAGTTGCATCGTCACATGGTAmplicon SizecDNA: 258 bpgenomic: 9,177
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.902 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACA
CGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATG
GCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGG
AACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACT
TAGATGCCGTGCCATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)231392 - 622
NM_003073 (SMARCB1)258392 - 649
Exon 2 To Exon 4 (Pair 43)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 206 bpgenomic: 9,125
Reverse (601,20)CCACTGGCTGTTCCTCTTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.02 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAGCCAGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)206395 - 600
NM_001007468 (SMARCB1)179395 - 573
Exon 2 To Exon 4 (Pair 44)
Forward (395,23)ATAGTTGCATCGTCACATGGTAAAmplicon SizecDNA: 210 bpgenomic: 9,129
Reverse (604,21)TACCCACTGGCTGTTCCTCTTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.231 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACG
ACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGC
AACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAA
CAGAAGGCCAAGAGGAACAGCCAGTGGGTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)210394 - 603
NM_001007468 (SMARCB1)183394 - 576
Exon 2 To Exon 4 (Pair 45)
Forward (393,23)AAATAGTTGCATCGTCACATGGTAmplicon SizecDNA: 282 bpgenomic: 9,201
Reverse (674,21)TGCGGTTCCTGTTGATGGTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.902 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.024 kcal/mol
Forward-Reverse Dimers-1.062 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACA
CGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATG
GCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGG
AACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACT
TAGATGCCGTGCCATGCTCCACAACCATCAACAGGAACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)255392 - 646
NM_003073 (SMARCB1)282392 - 673
Exon 2 To Exon 4 (Pair 46)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 281 bpgenomic: 9,200
Reverse (674,21)TGCGGTTCCTGTTGATGGTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.024 kcal/mol
Forward-Reverse Dimers-1.062 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTT
AGATGCCGTGCCATGCTCCACAACCATCAACAGGAACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)281393 - 673
NM_001007468 (SMARCB1)254393 - 646
Exon 2 To Exon 4 (Pair 47)
Forward (394,23)AATAGTTGCATCGTCACATGGTAAmplicon SizecDNA: 260 bpgenomic: 9,179
Reverse (653,20)TGGAGCATGGCACGGCATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACAC
GACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGG
CAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGA
ACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTT
AGATGCCGTGCCATGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)260393 - 652
NM_001007468 (SMARCB1)233393 - 625
Exon 2 To Exon 4 (Pair 48)
Forward (393,23)AAATAGTTGCATCGTCACATGGTAmplicon SizecDNA: 209 bpgenomic: 9,128
Reverse (601,20)CCACTGGCTGTTCCTCTTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.902 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.02 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACA
CGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATG
GCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGG
AACAGAAGGCCAAGAGGAACAGCCAGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)209392 - 600
NM_001007468 (SMARCB1)182392 - 573
Exon 2 To Exon 4 (Pair 49)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 211 bpgenomic: 9,130
Reverse (606,20)GGTACCCACTGGCTGTTCCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol in 3' area
Reverse Dimers-2.176 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAGCCAGTGGGTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)184395 - 578
NM_003073 (SMARCB1)211395 - 605
Exon 2 To Exon 4 (Pair 50)
Forward (396,23)TAGTTGCATCGTCACATGGTAAAAmplicon SizecDNA: 258 bpgenomic: 9,177
Reverse (653,20)TGGAGCATGGCACGGCATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.854 kcal/mol in 3' area
Forward Dimers-1.214 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.866 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceTAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACACGA
CTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCA
ACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAAC
AGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAG
ATGCCGTGCCATGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)258395 - 652
NM_001007468 (SMARCB1)231395 - 625
Exon 2 To Exon 4 (Pair 51)
Forward (393,23)AAATAGTTGCATCGTCACATGGTAmplicon SizecDNA: 208 bpgenomic: 9,127
Reverse (600,20)CACTGGCTGTTCCTCTTGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.902 kcal/mol
Forward Dimers-1.214 kcal/mol
Reverse Loops1.002 kcal/mol
Reverse Dimers-0.004 kcal/mol
Forward-Reverse Dimers-1.367 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAAATAGTTGCATCGTCACATGGTAAAAAAACAAAACCTAACACTAAGGATCACGGATACA
CGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATG
GCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGG
AACAGAAGGCCAAGAGGAACAGCCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)181392 - 572
NM_003073 (SMARCB1)208392 - 599
Exon 3 To Exon 4 (Pair 1)
Forward (449,21)TACACGACTCTAGCCACCAGTAmplicon SizecDNA: 202 bpgenomic: 7,457
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops2.134 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceTACACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTG
GATGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTC
AGGGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCAC
CACTTAGATGCCGTGCCATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)202421 - 622
NM_003073 (SMARCB1)202448 - 649
Exon 3 To Exon 4 (Pair 2)
Forward (451,20)CACGACTCTAGCCACCAGTGAmplicon SizecDNA: 200 bpgenomic: 7,455
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGA
TGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAG
GGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCA
CTTAGATGCCGTGCCATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)200423 - 622
NM_003073 (SMARCB1)200450 - 649
Exon 3 To Exon 4 (Pair 3)
Forward (458,20)CTAGCCACCAGTGTGACCCTAmplicon SizecDNA: 196 bpgenomic: 7,451
Reverse (653,20)TGGAGCATGGCACGGCATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAAC
GATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAG
AAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGAT
GCCGTGCCATGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)196457 - 652
NM_001007468 (SMARCB1)196430 - 625
Exon 3 To Exon 4 (Pair 4)
Forward (462,21)CCACCAGTGTGACCCTGTTAAAmplicon SizecDNA: 133 bpgenomic: 7,388
Reverse (594,21)CTGTTCCTCTTGGCCTTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.066 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGATG
AGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAGG
CCAAGAGGAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)133461 - 593
NM_001007468 (SMARCB1)133434 - 566
Exon 3 To Exon 4 (Pair 5)
Forward (459,20)TAGCCACCAGTGTGACCCTGAmplicon SizecDNA: 197 bpgenomic: 7,452
Reverse (655,20)TGTGGAGCATGGCACGGCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol in 3' area
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACG
ATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGA
AGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATG
CCGTGCCATGCTCCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)197458 - 654
NM_001007468 (SMARCB1)197431 - 627
Exon 3 To Exon 4 (Pair 6)
Forward (460,20)AGCCACCAGTGTGACCCTGTAmplicon SizecDNA: 132 bpgenomic: 7,387
Reverse (591,21)TTCCTCTTGGCCTTCTGTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGA
TGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAA
GGCCAAGAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)132459 - 590
NM_001007468 (SMARCB1)132432 - 563
Exon 3 To Exon 4 (Pair 7)
Forward (451,20)CACGACTCTAGCCACCAGTGAmplicon SizecDNA: 141 bpgenomic: 7,396
Reverse (591,21)TTCCTCTTGGCCTTCTGTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceCACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGA
TGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAG
GGAACAGAAGGCCAAGAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)141450 - 590
NM_001007468 (SMARCB1)141423 - 563
Exon 3 To Exon 4 (Pair 8)
Forward (462,21)CCACCAGTGTGACCCTGTTAAAmplicon SizecDNA: 195 bpgenomic: 7,450
Reverse (656,20)TTGTGGAGCATGGCACGGCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol in 3' area
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.214 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGATG
AGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAGG
CCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCCG
TGCCATGCTCCACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)195434 - 628
NM_003073 (SMARCB1)195461 - 655
Exon 3 To Exon 4 (Pair 9)
Forward (461,20)GCCACCAGTGTGACCCTGTTAmplicon SizecDNA: 196 bpgenomic: 7,451
Reverse (656,20)TTGTGGAGCATGGCACGGCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol in 3' area
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.627 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGAT
GAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAG
GCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCC
GTGCCATGCTCCACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)196433 - 628
NM_003073 (SMARCB1)196460 - 655
Exon 3 To Exon 4 (Pair 10)
Forward (482,21)AAAGCCTCGGAAGTGGAAGAGAmplicon SizecDNA: 175 bpgenomic: 7,430
Reverse (656,20)TTGTGGAGCATGGCACGGCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.52 kcal/mol
Forward Dimers-0.397 kcal/mol
Reverse Loops1.236 kcal/mol in 3' area
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGATGAGAAGTACAAGGCTGTGTCC
ATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAGGCCAAGAGGAACAGCCAGTGG
GTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCCGTGCCATGCTCCACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)175454 - 628
NM_003073 (SMARCB1)175481 - 655
Exon 3 To Exon 4 (Pair 11)
Forward (460,20)AGCCACCAGTGTGACCCTGTAmplicon SizecDNA: 191 bpgenomic: 7,446
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGA
TGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAA
GGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGC
CGTGCCATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)191459 - 649
NM_001007468 (SMARCB1)191432 - 622
Exon 3 To Exon 4 (Pair 12)
Forward (462,21)CCACCAGTGTGACCCTGTTAAAmplicon SizecDNA: 192 bpgenomic: 7,447
Reverse (653,20)TGGAGCATGGCACGGCATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.596 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGATG
AGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAGG
CCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCCG
TGCCATGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)192461 - 652
NM_001007468 (SMARCB1)192434 - 625
Exon 3 To Exon 4 (Pair 13)
Forward (459,20)TAGCCACCAGTGTGACCCTGAmplicon SizecDNA: 133 bpgenomic: 7,388
Reverse (591,21)TTCCTCTTGGCCTTCTGTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACG
ATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGA
AGGCCAAGAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)133458 - 590
NM_001007468 (SMARCB1)133431 - 563
Exon 3 To Exon 4 (Pair 14)
Forward (442,21)TCACGGATACACGACTCTAGCAmplicon SizecDNA: 211 bpgenomic: 7,466
Reverse (652,20)GGAGCATGGCACGGCATCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.663 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.469 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceTCACGGATACACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGA
GATTCTGGATGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCAC
CTACCTCAGGGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAG
CTCCCACCACTTAGATGCCGTGCCATGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)211441 - 651
NM_001007468 (SMARCB1)211414 - 624
Exon 3 To Exon 4 (Pair 15)
Forward (462,21)CCACCAGTGTGACCCTGTTAAAmplicon SizecDNA: 210 bpgenomic: 7,465
Reverse (671,21)GGTTCCTGTTGATGGTTGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-2.512 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGATG
AGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAGG
CCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCCG
TGCCATGCTCCACAACCATCAACAGGAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)210434 - 643
NM_003073 (SMARCB1)210461 - 670
Exon 3 To Exon 4 (Pair 16)
Forward (462,21)CCACCAGTGTGACCCTGTTAAAmplicon SizecDNA: 130 bpgenomic: 7,385
Reverse (591,21)TTCCTCTTGGCCTTCTGTTCCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-1.066 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGATG
AGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAGG
CCAAGAGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)130434 - 563
NM_003073 (SMARCB1)130461 - 590
Exon 3 To Exon 4 (Pair 17)
Forward (458,20)CTAGCCACCAGTGTGACCCTAmplicon SizecDNA: 198 bpgenomic: 7,453
Reverse (655,20)TGTGGAGCATGGCACGGCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol in 3' area
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAAC
GATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAG
AAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGAT
GCCGTGCCATGCTCCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)198430 - 627
NM_003073 (SMARCB1)198457 - 654
Exon 3 To Exon 4 (Pair 18)
Forward (462,21)CCACCAGTGTGACCCTGTTAAAmplicon SizecDNA: 189 bpgenomic: 7,444
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGATG
AGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAGG
CCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCCG
TGCCATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)189461 - 649
NM_001007468 (SMARCB1)189434 - 622
Exon 3 To Exon 4 (Pair 19)
Forward (460,20)AGCCACCAGTGTGACCCTGTAmplicon SizecDNA: 294 bpgenomic: 7,549
Reverse (753,20)AAGGCGGAATCAGCACGGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.574 kcal/mol
Reverse Dimers-1.242 kcal/mol
Forward-Reverse Dimers-1.961 kcal/mol
Amplicon Folding-1.965 kcal/mol outside primersite
Amplicon SequenceAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGA
TGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAA
GGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGC
CGTGCCATGCTCCACAACCATCAACAGGAACCGCATGGGCCGAGACAAGAAGAGAACCTT
CCCCCTTTGGTGTGGATGCATCGCTGCACTCACCCTCCGTGCTGATTCCGCCTT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 20)
Forward (461,20)GCCACCAGTGTGACCCTGTTAmplicon SizecDNA: 195 bpgenomic: 7,450
Reverse (655,20)TGTGGAGCATGGCACGGCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol in 3' area
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.627 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGAT
GAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAG
GCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCC
GTGCCATGCTCCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)195460 - 654
NM_001007468 (SMARCB1)195433 - 627
Exon 3 To Exon 4 (Pair 21)
Forward (451,20)CACGACTCTAGCCACCAGTGAmplicon SizecDNA: 300 bpgenomic: 7,555
Reverse (750,19)GCGGAATCAGCACGGAGGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.803 kcal/mol
Reverse Dimers-0.66 kcal/mol
Forward-Reverse Dimers-1.469 kcal/mol
Amplicon Folding-1.965 kcal/mol outside primersite
Amplicon SequenceCACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGA
TGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAG
GGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCA
CTTAGATGCCGTGCCATGCTCCACAACCATCAACAGGAACCGCATGGGCCGAGACAAGAA
GAGAACCTTCCCCCTTTGGTGTGGATGCATCGCTGCACTCACCCTCCGTGCTGATTCCGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 22)
Forward (458,20)CTAGCCACCAGTGTGACCCTAmplicon SizecDNA: 294 bpgenomic: 7,549
Reverse (751,19)GGCGGAATCAGCACGGAGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.574 kcal/mol
Reverse Dimers-1.242 kcal/mol
Forward-Reverse Dimers-1.634 kcal/mol
Amplicon Folding-1.965 kcal/mol outside primersite
Amplicon SequenceCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAAC
GATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAG
AAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGAT
GCCGTGCCATGCTCCACAACCATCAACAGGAACCGCATGGGCCGAGACAAGAAGAGAACC
TTCCCCCTTTGGTGTGGATGCATCGCTGCACTCACCCTCCGTGCTGATTCCGCC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 23)
Forward (482,21)AAAGCCTCGGAAGTGGAAGAGAmplicon SizecDNA: 193 bpgenomic: 7,448
Reverse (674,21)TGCGGTTCCTGTTGATGGTTGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.52 kcal/mol
Forward Dimers-0.397 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.024 kcal/mol
Forward-Reverse Dimers-1.504 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGATGAGAAGTACAAGGCTGTGTCC
ATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAGGCCAAGAGGAACAGCCAGTGG
GTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCCGTGCCATGCTCCACAACCATC
AACAGGAACCGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)193481 - 673
NM_001007468 (SMARCB1)193454 - 646
Exon 3 To Exon 4 (Pair 24)
Forward (451,20)CACGACTCTAGCCACCAGTGAmplicon SizecDNA: 206 bpgenomic: 7,461
Reverse (656,20)TTGTGGAGCATGGCACGGCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.236 kcal/mol in 3' area
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGA
TGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAG
GGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCA
CTTAGATGCCGTGCCATGCTCCACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)206423 - 628
NM_003073 (SMARCB1)206450 - 655
Exon 3 To Exon 4 (Pair 25)
Forward (459,20)TAGCCACCAGTGTGACCCTGAmplicon SizecDNA: 213 bpgenomic: 7,468
Reverse (671,21)GGTTCCTGTTGATGGTTGTGGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-2.512 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACG
ATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGA
AGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATG
CCGTGCCATGCTCCACAACCATCAACAGGAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)213458 - 670
NM_001007468 (SMARCB1)213431 - 643
Exon 3 To Exon 4 (Pair 26)
Forward (458,20)CTAGCCACCAGTGTGACCCTAmplicon SizecDNA: 199 bpgenomic: 7,454
Reverse (656,20)TTGTGGAGCATGGCACGGCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol in 3' area
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAAC
GATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAG
AAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGAT
GCCGTGCCATGCTCCACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)199430 - 628
NM_003073 (SMARCB1)199457 - 655
Exon 3 To Exon 4 (Pair 27)
Forward (460,20)AGCCACCAGTGTGACCCTGTAmplicon SizecDNA: 239 bpgenomic: 7,494
Reverse (698,21)AGGTTCTCTTCTTGTCTCGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.592 kcal/mol
Reverse Dimers0.084 kcal/mol in 3' area
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-1.77 kcal/mol outside primersite
Amplicon SequenceAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGA
TGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAA
GGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGC
CGTGCCATGCTCCACAACCATCAACAGGAACCGCATGGGCCGAGACAAGAAGAGAACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)239432 - 670
NM_003073 (SMARCB1)239459 - 697
Exon 3 To Exon 4 (Pair 28)
Forward (461,20)GCCACCAGTGTGACCCTGTTAmplicon SizecDNA: 193 bpgenomic: 7,448
Reverse (653,20)TGGAGCATGGCACGGCATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.627 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGAT
GAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAG
GCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCC
GTGCCATGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)193460 - 652
NM_001007468 (SMARCB1)193433 - 625
Exon 3 To Exon 4 (Pair 29)
Forward (451,20)CACGACTCTAGCCACCAGTGAmplicon SizecDNA: 144 bpgenomic: 7,399
Reverse (594,21)CTGTTCCTCTTGGCCTTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceCACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGA
TGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAG
GGAACAGAAGGCCAAGAGGAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)144450 - 593
NM_001007468 (SMARCB1)144423 - 566
Exon 3 To Exon 4 (Pair 30)
Forward (462,21)CCACCAGTGTGACCCTGTTAAAmplicon SizecDNA: 292 bpgenomic: 7,547
Reverse (753,20)AAGGCGGAATCAGCACGGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.574 kcal/mol
Reverse Dimers-1.242 kcal/mol
Forward-Reverse Dimers-1.472 kcal/mol
Amplicon Folding-1.965 kcal/mol outside primersite
Amplicon SequenceCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGATG
AGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAGG
CCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCCG
TGCCATGCTCCACAACCATCAACAGGAACCGCATGGGCCGAGACAAGAAGAGAACCTTCC
CCCTTTGGTGTGGATGCATCGCTGCACTCACCCTCCGTGCTGATTCCGCCTT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 31)
Forward (460,20)AGCCACCAGTGTGACCCTGTAmplicon SizecDNA: 133 bpgenomic: 7,388
Reverse (592,21)GTTCCTCTTGGCCTTCTGTTCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGA
TGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAA
GGCCAAGAGGAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)133432 - 564
NM_003073 (SMARCB1)133459 - 591
Exon 3 To Exon 4 (Pair 32)
Forward (459,20)TAGCCACCAGTGTGACCCTGAmplicon SizecDNA: 240 bpgenomic: 7,495
Reverse (698,21)AGGTTCTCTTCTTGTCTCGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.592 kcal/mol
Reverse Dimers0.084 kcal/mol in 3' area
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-1.77 kcal/mol outside primersite
Amplicon SequenceTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACG
ATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGA
AGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATG
CCGTGCCATGCTCCACAACCATCAACAGGAACCGCATGGGCCGAGACAAGAAGAGAACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)240458 - 697
NM_001007468 (SMARCB1)240431 - 670
Exon 3 To Exon 4 (Pair 33)
Forward (482,21)AAAGCCTCGGAAGTGGAAGAGAmplicon SizecDNA: 169 bpgenomic: 7,424
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.52 kcal/mol
Forward Dimers-0.397 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGATGAGAAGTACAAGGCTGTGTCC
ATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAGGCCAAGAGGAACAGCCAGTGG
GTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCCGTGCCATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)169481 - 649
NM_001007468 (SMARCB1)169454 - 622
Exon 3 To Exon 4 (Pair 34)
Forward (460,20)AGCCACCAGTGTGACCCTGTAmplicon SizecDNA: 197 bpgenomic: 7,452
Reverse (656,20)TTGTGGAGCATGGCACGGCANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol in 3' area
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGA
TGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAA
GGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGC
CGTGCCATGCTCCACAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)197432 - 628
NM_003073 (SMARCB1)197459 - 655
Exon 3 To Exon 4 (Pair 35)
Forward (462,21)CCACCAGTGTGACCCTGTTAAAmplicon SizecDNA: 191 bpgenomic: 7,446
Reverse (652,20)GGAGCATGGCACGGCATCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-1.383 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGATG
AGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAGG
CCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCCG
TGCCATGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)191461 - 651
NM_001007468 (SMARCB1)191434 - 624
Exon 3 To Exon 4 (Pair 36)
Forward (458,20)CTAGCCACCAGTGTGACCCTAmplicon SizecDNA: 137 bpgenomic: 7,392
Reverse (594,21)CTGTTCCTCTTGGCCTTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAAC
GATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAG
AAGGCCAAGAGGAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)137457 - 593
NM_001007468 (SMARCB1)137430 - 566
Exon 3 To Exon 4 (Pair 37)
Forward (458,20)CTAGCCACCAGTGTGACCCTAmplicon SizecDNA: 195 bpgenomic: 7,450
Reverse (652,20)GGAGCATGGCACGGCATCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAAC
GATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAG
AAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGAT
GCCGTGCCATGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)195430 - 624
NM_003073 (SMARCB1)195457 - 651
Exon 3 To Exon 4 (Pair 38)
Forward (461,20)GCCACCAGTGTGACCCTGTTAmplicon SizecDNA: 192 bpgenomic: 7,447
Reverse (652,20)GGAGCATGGCACGGCATCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.627 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGAT
GAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAG
GCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCC
GTGCCATGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)192433 - 624
NM_003073 (SMARCB1)192460 - 651
Exon 3 To Exon 4 (Pair 39)
Forward (451,20)CACGACTCTAGCCACCAGTGAmplicon SizecDNA: 205 bpgenomic: 7,460
Reverse (655,20)TGTGGAGCATGGCACGGCATNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.236 kcal/mol in 3' area
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGA
TGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAG
GGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCA
CTTAGATGCCGTGCCATGCTCCACA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)205423 - 627
NM_003073 (SMARCB1)205450 - 654
Exon 3 To Exon 4 (Pair 40)
Forward (459,20)TAGCCACCAGTGTGACCCTGAmplicon SizecDNA: 192 bpgenomic: 7,447
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACG
ATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGA
AGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATG
CCGTGCCATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)192431 - 622
NM_003073 (SMARCB1)192458 - 649
Exon 3 To Exon 4 (Pair 41)
Forward (459,20)TAGCCACCAGTGTGACCCTGAmplicon SizecDNA: 136 bpgenomic: 7,391
Reverse (594,21)CTGTTCCTCTTGGCCTTCTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.33 kcal/mol
Reverse Dimers-2.61 kcal/mol
Forward-Reverse Dimers-2.421 kcal/mol
Amplicon Folding-0.94 kcal/mol outside primersite
Amplicon SequenceTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACG
ATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGA
AGGCCAAGAGGAACAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)136458 - 593
NM_001007468 (SMARCB1)136431 - 566
Exon 3 To Exon 4 (Pair 42)
Forward (458,20)CTAGCCACCAGTGTGACCCTAmplicon SizecDNA: 193 bpgenomic: 7,448
Reverse (650,21)AGCATGGCACGGCATCTAAGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAAC
GATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAG
AAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGAT
GCCGTGCCATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)193430 - 622
NM_003073 (SMARCB1)193457 - 649
Exon 3 To Exon 4 (Pair 43)
Forward (451,20)CACGACTCTAGCCACCAGTGAmplicon SizecDNA: 203 bpgenomic: 7,458
Reverse (653,20)TGGAGCATGGCACGGCATCTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops1.737 kcal/mol in 3' area
Forward Dimers-1.66 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceCACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGA
TGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAG
GGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCA
CTTAGATGCCGTGCCATGCTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)203450 - 652
NM_001007468 (SMARCB1)203423 - 625
Exon 3 To Exon 4 (Pair 44)
Forward (459,20)TAGCCACCAGTGTGACCCTGAmplicon SizecDNA: 295 bpgenomic: 7,550
Reverse (753,20)AAGGCGGAATCAGCACGGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.574 kcal/mol
Reverse Dimers-1.242 kcal/mol
Forward-Reverse Dimers-1.961 kcal/mol
Amplicon Folding-1.965 kcal/mol outside primersite
Amplicon SequenceTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACG
ATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGA
AGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATG
CCGTGCCATGCTCCACAACCATCAACAGGAACCGCATGGGCCGAGACAAGAAGAGAACCT
TCCCCCTTTGGTGTGGATGCATCGCTGCACTCACCCTCCGTGCTGATTCCGCCTT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
Exon 3 To Exon 4 (Pair 45)
Forward (442,21)TCACGGATACACGACTCTAGCAmplicon SizecDNA: 232 bpgenomic: 7,487
Reverse (673,21)GCGGTTCCTGTTGATGGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.663 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.024 kcal/mol
Forward-Reverse Dimers-1.3 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceTCACGGATACACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGA
GATTCTGGATGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCAC
CTACCTCAGGGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAG
CTCCCACCACTTAGATGCCGTGCCATGCTCCACAACCATCAACAGGAACCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)232441 - 672
NM_001007468 (SMARCB1)232414 - 645
Exon 3 To Exon 4 (Pair 46)
Forward (461,20)GCCACCAGTGTGACCCTGTTAmplicon SizecDNA: 238 bpgenomic: 7,493
Reverse (698,21)AGGTTCTCTTCTTGTCTCGGCNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.592 kcal/mol
Reverse Dimers0.084 kcal/mol in 3' area
Forward-Reverse Dimers-1.967 kcal/mol
Amplicon Folding-1.77 kcal/mol outside primersite
Amplicon SequenceGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGAT
GAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAAG
GCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGCC
GTGCCATGCTCCACAACCATCAACAGGAACCGCATGGGCCGAGACAAGAAGAGAACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_003073 (SMARCB1)238460 - 697
NM_001007468 (SMARCB1)238433 - 670
Exon 3 To Exon 4 (Pair 47)
Forward (444,21)ACGGATACACGACTCTAGCCAAmplicon SizecDNA: 230 bpgenomic: 7,485
Reverse (673,21)GCGGTTCCTGTTGATGGTTGTNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.663 kcal/mol
Forward Dimers-1.66 kcal/mol
Reverse Loops1.855 kcal/mol
Reverse Dimers-0.024 kcal/mol
Forward-Reverse Dimers-1.3 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceACGGATACACGACTCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGA
TTCTGGATGGCAACGATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCT
ACCTCAGGGAACAGAAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCT
CCCACCACTTAGATGCCGTGCCATGCTCCACAACCATCAACAGGAACCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)230416 - 645
NM_003073 (SMARCB1)230443 - 672
Exon 3 To Exon 4 (Pair 48)
Forward (460,20)AGCCACCAGTGTGACCCTGTAmplicon SizecDNA: 193 bpgenomic: 7,448
Reverse (652,20)GGAGCATGGCACGGCATCTANr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.236 kcal/mol
Reverse Dimers-1.447 kcal/mol
Forward-Reverse Dimers-2.954 kcal/mol
Amplicon Folding-1.4 kcal/mol outside primersite
Amplicon SequenceAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAACGA
TGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAGAA
GGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGATGC
CGTGCCATGCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001007468 (SMARCB1)193432 - 624
NM_003073 (SMARCB1)193459 - 651
Exon 3 To Exon 4 (Pair 49)
Forward (458,20)CTAGCCACCAGTGTGACCCTAmplicon SizecDNA: 296 bpgenomic: 7,551
Reverse (753,20)AAGGCGGAATCAGCACGGAGNr. of Isoforms 2 out of 2 (by amplicon BlastN)
Folding EnergiesForward Loops0.399 kcal/mol
Forward Dimers-0.626 kcal/mol
Reverse Loops1.574 kcal/mol
Reverse Dimers-1.242 kcal/mol
Forward-Reverse Dimers-1.961 kcal/mol
Amplicon Folding-1.965 kcal/mol outside primersite
Amplicon SequenceCTAGCCACCAGTGTGACCCTGTTAAAAGCCTCGGAAGTGGAAGAGATTCTGGATGGCAAC
GATGAGAAGTACAAGGCTGTGTCCATCAGCACAGAGCCCCCCACCTACCTCAGGGAACAG
AAGGCCAAGAGGAACAGCCAGTGGGTACCCACCCTGCCCAACAGCTCCCACCACTTAGAT
GCCGTGCCATGCTCCACAACCATCAACAGGAACCGCATGGGCCGAGACAAGAAGAGAACC
TTCCCCCTTTGGTGTGGATGCATCGCTGCACTCACCCTCCGTGCTGATTCCGCCTT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
() -
 

See below for some more details.

Program Output:

Loading ...