Design Results for apc

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 9 To Exon 11 (Pair 1)
Forward (1274,22)TTACAGTCCCAAGCAACAGAAGAmplicon SizecDNA: 207 bpgenomic: 23,067
Reverse (1480,20)CCTTCGAGGTGCAGAGTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.316 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.529 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.357 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTTACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCA
CATGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCT
GGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCT
AGTAGCACACACTCTGCACCTCGAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)207896 - 1102
NM_000038 (APC)207788 - 994
Exon 9 To Exon 11 (Pair 2)
Forward (1276,21)ACAGTCCCAAGCAACAGAAGCAmplicon SizecDNA: 193 bpgenomic: 23,053
Reverse (1468,22)AGAGTGTGTGCTACTAGAACTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.789 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-2.454 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACA
TGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGG
TAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAG
TAGCACACACTCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000038 (APC)193790 - 982
NM_001127510 (APC)193898 - 1090
Exon 9 To Exon 11 (Pair 3)
Forward (1276,21)ACAGTCCCAAGCAACAGAAGCAmplicon SizecDNA: 197 bpgenomic: 23,057
Reverse (1472,21)GTGCAGAGTGTGTGCTACTAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.789 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-2.454 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACA
TGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGG
TAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAG
TAGCACACACTCTGCAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)197898 - 1094
NM_000038 (APC)197790 - 986
Exon 9 To Exon 11 (Pair 4)
Forward (1274,22)TTACAGTCCCAAGCAACAGAAGAmplicon SizecDNA: 199 bpgenomic: 23,059
Reverse (1472,21)GTGCAGAGTGTGTGCTACTAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.316 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-2.454 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTTACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCA
CATGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCT
GGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCT
AGTAGCACACACTCTGCAC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)199896 - 1094
NM_000038 (APC)199788 - 986
Exon 9 To Exon 11 (Pair 5)
Forward (1276,21)ACAGTCCCAAGCAACAGAAGCAmplicon SizecDNA: 222 bpgenomic: 23,082
Reverse (1497,21)CCCAGATGACTTGTCAGCCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.789 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.233 kcal/mol
Reverse Dimers-1.171 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACA
TGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGG
TAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAG
TAGCACACACTCTGCACCTCGAAGGCTGACAAGTCATCTGGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)222898 - 1119
NM_000038 (APC)222790 - 1011
Exon 9 To Exon 11 (Pair 6)
Forward (1274,22)TTACAGTCCCAAGCAACAGAAGAmplicon SizecDNA: 195 bpgenomic: 23,055
Reverse (1468,22)AGAGTGTGTGCTACTAGAACTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.316 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-2.454 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTTACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCA
CATGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCT
GGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCT
AGTAGCACACACTCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)195896 - 1090
NM_000038 (APC)195788 - 982
Exon 9 To Exon 11 (Pair 7)
Forward (1276,21)ACAGTCCCAAGCAACAGAAGCAmplicon SizecDNA: 192 bpgenomic: 23,052
Reverse (1467,22)GAGTGTGTGCTACTAGAACTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.789 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-2.454 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACA
TGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGG
TAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAG
TAGCACACACTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000038 (APC)192790 - 981
NM_001127510 (APC)192898 - 1089
Exon 9 To Exon 11 (Pair 8)
Forward (1274,22)TTACAGTCCCAAGCAACAGAAGAmplicon SizecDNA: 194 bpgenomic: 23,054
Reverse (1467,22)GAGTGTGTGCTACTAGAACTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.316 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-2.454 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTTACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCA
CATGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCT
GGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCT
AGTAGCACACACTC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)194896 - 1089
NM_000038 (APC)194788 - 981
Exon 9 To Exon 11 (Pair 9)
Forward (1274,22)TTACAGTCCCAAGCAACAGAAGAmplicon SizecDNA: 224 bpgenomic: 23,084
Reverse (1497,21)CCCAGATGACTTGTCAGCCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.316 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.233 kcal/mol
Reverse Dimers-1.171 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTTACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCA
CATGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCT
GGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCT
AGTAGCACACACTCTGCACCTCGAAGGCTGACAAGTCATCTGGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)224896 - 1119
NM_000038 (APC)224788 - 1011
Exon 9 To Exon 11 (Pair 10)
Forward (1276,21)ACAGTCCCAAGCAACAGAAGCAmplicon SizecDNA: 208 bpgenomic: 23,068
Reverse (1483,20)CAGCCTTCGAGGTGCAGAGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.789 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.926 kcal/mol
Reverse Dimers-1.352 kcal/mol
Forward-Reverse Dimers-1.357 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACA
TGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGG
TAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAG
TAGCACACACTCTGCACCTCGAAGGCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)208898 - 1105
NM_000038 (APC)208790 - 997
Exon 9 To Exon 11 (Pair 11)
Forward (1276,21)ACAGTCCCAAGCAACAGAAGCAmplicon SizecDNA: 207 bpgenomic: 23,067
Reverse (1482,20)AGCCTTCGAGGTGCAGAGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.789 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.926 kcal/mol
Reverse Dimers-1.352 kcal/mol
Forward-Reverse Dimers-1.357 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACA
TGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGG
TAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAG
TAGCACACACTCTGCACCTCGAAGGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000038 (APC)207790 - 996
NM_001127510 (APC)207898 - 1104
Exon 9 To Exon 11 (Pair 12)
Forward (1276,21)ACAGTCCCAAGCAACAGAAGCAmplicon SizecDNA: 205 bpgenomic: 23,065
Reverse (1480,20)CCTTCGAGGTGCAGAGTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.789 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.529 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.357 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACA
TGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGG
TAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAG
TAGCACACACTCTGCACCTCGAAGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000038 (APC)205790 - 994
NM_001127510 (APC)205898 - 1102
Exon 9 To Exon 11 (Pair 13)
Forward (1276,21)ACAGTCCCAAGCAACAGAAGCAmplicon SizecDNA: 206 bpgenomic: 23,066
Reverse (1481,20)GCCTTCGAGGTGCAGAGTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.789 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.004 kcal/mol
Reverse Dimers-1.274 kcal/mol
Forward-Reverse Dimers-1.357 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACA
TGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGG
TAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAG
TAGCACACACTCTGCACCTCGAAGGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000038 (APC)206790 - 995
NM_001127510 (APC)206898 - 1103
Exon 9 To Exon 11 (Pair 14)
Forward (1274,22)TTACAGTCCCAAGCAACAGAAGAmplicon SizecDNA: 222 bpgenomic: 23,082
Reverse (1495,21)CAGATGACTTGTCAGCCTTCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.316 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.233 kcal/mol
Reverse Dimers-1.171 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTTACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCA
CATGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCT
GGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCT
AGTAGCACACACTCTGCACCTCGAAGGCTGACAAGTCATCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000038 (APC)222788 - 1009
NM_001127510 (APC)222896 - 1117
Exon 9 To Exon 11 (Pair 15)
Forward (1276,21)ACAGTCCCAAGCAACAGAAGCAmplicon SizecDNA: 221 bpgenomic: 23,081
Reverse (1496,21)CCAGATGACTTGTCAGCCTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.789 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.233 kcal/mol
Reverse Dimers-1.171 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACA
TGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGG
TAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAG
TAGCACACACTCTGCACCTCGAAGGCTGACAAGTCATCTGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)221898 - 1118
NM_000038 (APC)221790 - 1010
Exon 9 To Exon 11 (Pair 16)
Forward (1274,22)TTACAGTCCCAAGCAACAGAAGAmplicon SizecDNA: 223 bpgenomic: 23,083
Reverse (1496,21)CCAGATGACTTGTCAGCCTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.316 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.233 kcal/mol
Reverse Dimers-1.171 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTTACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCA
CATGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCT
GGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCT
AGTAGCACACACTCTGCACCTCGAAGGCTGACAAGTCATCTGG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)223896 - 1118
NM_000038 (APC)223788 - 1010
Exon 9 To Exon 11 (Pair 17)
Forward (1274,22)TTACAGTCCCAAGCAACAGAAGAmplicon SizecDNA: 210 bpgenomic: 23,070
Reverse (1483,20)CAGCCTTCGAGGTGCAGAGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.316 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.926 kcal/mol
Reverse Dimers-1.352 kcal/mol
Forward-Reverse Dimers-1.357 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTTACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCA
CATGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCT
GGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCT
AGTAGCACACACTCTGCACCTCGAAGGCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)210896 - 1105
NM_000038 (APC)210788 - 997
Exon 9 To Exon 11 (Pair 18)
Forward (1276,21)ACAGTCCCAAGCAACAGAAGCAmplicon SizecDNA: 220 bpgenomic: 23,080
Reverse (1495,21)CAGATGACTTGTCAGCCTTCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.789 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops0.233 kcal/mol
Reverse Dimers-1.171 kcal/mol
Forward-Reverse Dimers-1.813 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACA
TGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGG
TAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAG
TAGCACACACTCTGCACCTCGAAGGCTGACAAGTCATCTG
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000038 (APC)220790 - 1009
NM_001127510 (APC)220898 - 1117
Exon 9 To Exon 11 (Pair 19)
Forward (1276,21)ACAGTCCCAAGCAACAGAAGCAmplicon SizecDNA: 202 bpgenomic: 23,062
Reverse (1477,20)TCGAGGTGCAGAGTGTGTGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.789 kcal/mol in 3' area
Forward Dimers-0.584 kcal/mol
Reverse Loops1.496 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.357 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACA
TGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGG
TAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAG
TAGCACACACTCTGCACCTCGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000038 (APC)202790 - 991
NM_001127510 (APC)202898 - 1099
Exon 9 To Exon 11 (Pair 20)
Forward (1274,22)TTACAGTCCCAAGCAACAGAAGAmplicon SizecDNA: 209 bpgenomic: 23,069
Reverse (1482,20)AGCCTTCGAGGTGCAGAGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.316 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops0.926 kcal/mol
Reverse Dimers-1.352 kcal/mol
Forward-Reverse Dimers-1.357 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTTACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCA
CATGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCT
GGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCT
AGTAGCACACACTCTGCACCTCGAAGGCT
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)209896 - 1104
NM_000038 (APC)209788 - 996
Exon 9 To Exon 11 (Pair 21)
Forward (1274,22)TTACAGTCCCAAGCAACAGAAGAmplicon SizecDNA: 204 bpgenomic: 23,064
Reverse (1477,20)TCGAGGTGCAGAGTGTGTGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.316 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.496 kcal/mol in 3' area
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-1.357 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTTACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCA
CATGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCT
GGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCT
AGTAGCACACACTCTGCACCTCGA
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_000038 (APC)204788 - 991
NM_001127510 (APC)204896 - 1099
Exon 9 To Exon 11 (Pair 22)
Forward (1274,22)TTACAGTCCCAAGCAACAGAAGAmplicon SizecDNA: 208 bpgenomic: 23,068
Reverse (1481,20)GCCTTCGAGGTGCAGAGTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.316 kcal/mol
Forward Dimers-0.584 kcal/mol
Reverse Loops1.004 kcal/mol
Reverse Dimers-1.274 kcal/mol
Forward-Reverse Dimers-1.357 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTTACAGTCCCAAGCAACAGAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCA
CATGATGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCT
GGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCT
AGTAGCACACACTCTGCACCTCGAAGGC
All Amplified targets
 (by primer blast)
NOTE: DISCREPANCY WITH AMPLICON BLAST DETECTED
TranscriptSizePosition on transcript
NM_001127510 (APC)208896 - 1103
NM_000038 (APC)208788 - 995
Exon 10 To Exon 12 (Pair 1)
Forward (1372,23)AGAAATCAACATGGCAACTTCTGAmplicon SizecDNA: 253 bpgenomic: 17,736
Reverse (1624,22)TCCAGACTGTCGCATGGATATANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops2.031 kcal/mol in 3' area
Forward Dimers-1.535 kcal/mol
Reverse Loops0.835 kcal/mol
Reverse Dimers-1.2 kcal/mol
Forward-Reverse Dimers-1.285 kcal/mol
Amplicon Folding-1.789 kcal/mol outside primersite
Amplicon SequenceAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATGA
AACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGGCTGACAAGTCA
TCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCAATGCTTGGTACTCATGATAA
GGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCCCAAGACAGCTGTATATCCAT
GCGACAGTCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)253886 - 1138
NM_001127510 (APC)253994 - 1246
NM_001127511 (APC)253960 - 1212
Exon 10 To Exon 11 (Pair 1)
Forward (1375,23)AATCAACATGGCAACTTCTGGTAAmplicon SizecDNA: 94 bpgenomic: 14,205
Reverse (1468,22)AGAGTGTGTGCTACTAGAACTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.814 kcal/mol in 3' area
Forward Dimers-1.535 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAAC
AGCCAGTGTTTTGAGTTCTAGTAGCACACACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)94997 - 1090
NM_001127511 (APC)94963 - 1056
NM_000038 (APC)94889 - 982
Exon 10 To Exon 11 (Pair 2)
Forward (1374,23)AAATCAACATGGCAACTTCTGGTAmplicon SizecDNA: 94 bpgenomic: 14,205
Reverse (1467,22)GAGTGTGTGCTACTAGAACTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol in 3' area
Forward Dimers-1.535 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAA
CAGCCAGTGTTTTGAGTTCTAGTAGCACACACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)94962 - 1055
NM_001127510 (APC)94996 - 1089
NM_000038 (APC)94888 - 981
Exon 10 To Exon 11 (Pair 3)
Forward (1374,23)AAATCAACATGGCAACTTCTGGTAmplicon SizecDNA: 99 bpgenomic: 14,210
Reverse (1472,21)GTGCAGAGTGTGTGCTACTAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol in 3' area
Forward Dimers-1.535 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAA
CAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)99996 - 1094
NM_001127511 (APC)99962 - 1060
NM_000038 (APC)99888 - 986
Exon 10 To Exon 11 (Pair 4)
Forward (1361,22)CAAGGAGTGGGAGAAATCAACAAmplicon SizecDNA: 124 bpgenomic: 14,235
Reverse (1484,20)TCAGCCTTCGAGGTGCAGAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.758 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.926 kcal/mol
Reverse Dimers-1.352 kcal/mol
Forward-Reverse Dimers-2.725 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGA
ATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGG
CTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)124875 - 998
NM_001127511 (APC)124949 - 1072
NM_001127510 (APC)124983 - 1106
Exon 10 To Exon 11 (Pair 5)
Forward (1361,22)CAAGGAGTGGGAGAAATCAACAAmplicon SizecDNA: 125 bpgenomic: 14,236
Reverse (1485,20)GTCAGCCTTCGAGGTGCAGANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.758 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.926 kcal/mol
Reverse Dimers-1.352 kcal/mol
Forward-Reverse Dimers-2.725 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGA
ATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGG
CTGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)125875 - 999
NM_001127510 (APC)125983 - 1107
NM_001127511 (APC)125949 - 1073
Exon 10 To Exon 11 (Pair 6)
Forward (1307,22)TCTCAGAACAAGCATGAAACCGAmplicon SizecDNA: 190 bpgenomic: 14,301
Reverse (1496,21)CCAGATGACTTGTCAGCCTTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.233 kcal/mol
Reverse Dimers-1.171 kcal/mol
Forward-Reverse Dimers-2.785 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAGAATGAAGGTCAAGGA
GTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGAC
CATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGGCTGACA
AGTCATCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)190929 - 1118
NM_001127511 (APC)190895 - 1084
NM_000038 (APC)190821 - 1010
Exon 10 To Exon 11 (Pair 7)
Forward (1374,23)AAATCAACATGGCAACTTCTGGTAmplicon SizecDNA: 101 bpgenomic: 14,212
Reverse (1474,21)AGGTGCAGAGTGTGTGCTACTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol in 3' area
Forward Dimers-1.535 kcal/mol
Reverse Loops1.238 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-2.825 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAA
CAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)101888 - 988
NM_001127510 (APC)101996 - 1096
NM_001127511 (APC)101962 - 1062
Exon 10 To Exon 11 (Pair 8)
Forward (1374,23)AAATCAACATGGCAACTTCTGGTAmplicon SizecDNA: 100 bpgenomic: 14,211
Reverse (1473,21)GGTGCAGAGTGTGTGCTACTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol in 3' area
Forward Dimers-1.535 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAA
CAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)100962 - 1061
NM_001127510 (APC)100996 - 1095
NM_000038 (APC)100888 - 987
Exon 10 To Exon 12 (Pair 2)
Forward (1361,22)CAAGGAGTGGGAGAAATCAACAAmplicon SizecDNA: 264 bpgenomic: 17,747
Reverse (1624,22)TCCAGACTGTCGCATGGATATANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.758 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.835 kcal/mol
Reverse Dimers-1.2 kcal/mol
Forward-Reverse Dimers-1.682 kcal/mol
Amplicon Folding-1.789 kcal/mol outside primersite
Amplicon SequenceCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGA
ATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGG
CTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCAATGCTTGGT
ACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCCCAAGACAGC
TGTATATCCATGCGACAGTCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)264983 - 1246
NM_001127511 (APC)264949 - 1212
NM_000038 (APC)264875 - 1138
Exon 10 To Exon 11 (Pair 9)
Forward (1361,22)CAAGGAGTGGGAGAAATCAACAAmplicon SizecDNA: 121 bpgenomic: 14,232
Reverse (1481,20)GCCTTCGAGGTGCAGAGTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.758 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops1.004 kcal/mol
Reverse Dimers-1.274 kcal/mol
Forward-Reverse Dimers-2.725 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGA
ATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGG
C
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)121875 - 995
NM_001127511 (APC)121949 - 1069
NM_001127510 (APC)121983 - 1103
Exon 10 To Exon 11 (Pair 10)
Forward (1307,22)TCTCAGAACAAGCATGAAACCGAmplicon SizecDNA: 166 bpgenomic: 14,277
Reverse (1472,21)GTGCAGAGTGTGTGCTACTAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAGAATGAAGGTCAAGGA
GTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGAC
CATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)166821 - 986
NM_001127510 (APC)166929 - 1094
NM_001127511 (APC)166895 - 1060
Exon 10 To Exon 11 (Pair 11)
Forward (1307,22)TCTCAGAACAAGCATGAAACCGAmplicon SizecDNA: 162 bpgenomic: 14,273
Reverse (1468,22)AGAGTGTGTGCTACTAGAACTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAGAATGAAGGTCAAGGA
GTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGAC
CATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)162821 - 982
NM_001127511 (APC)162895 - 1056
NM_001127510 (APC)162929 - 1090
Exon 10 To Exon 11 (Pair 12)
Forward (1361,22)CAAGGAGTGGGAGAAATCAACAAmplicon SizecDNA: 120 bpgenomic: 14,231
Reverse (1480,20)CCTTCGAGGTGCAGAGTGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.758 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops1.529 kcal/mol
Reverse Dimers-1.184 kcal/mol
Forward-Reverse Dimers-2.351 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGA
ATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)120875 - 994
NM_001127511 (APC)120949 - 1068
NM_001127510 (APC)120983 - 1102
Exon 10 To Exon 12 (Pair 3)
Forward (1371,23)GAGAAATCAACATGGCAACTTCTAmplicon SizecDNA: 254 bpgenomic: 17,737
Reverse (1624,22)TCCAGACTGTCGCATGGATATANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.035 kcal/mol
Forward Dimers-1.535 kcal/mol
Reverse Loops0.835 kcal/mol
Reverse Dimers-1.2 kcal/mol
Forward-Reverse Dimers-1.285 kcal/mol
Amplicon Folding-1.789 kcal/mol outside primersite
Amplicon SequenceGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATG
AAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGGCTGACAAGTC
ATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCAATGCTTGGTACTCATGATA
AGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCCCAAGACAGCTGTATATCCA
TGCGACAGTCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)254993 - 1246
NM_001127511 (APC)254959 - 1212
NM_000038 (APC)254885 - 1138
Exon 10 To Exon 11 (Pair 13)
Forward (1307,22)TCTCAGAACAAGCATGAAACCGAmplicon SizecDNA: 189 bpgenomic: 14,300
Reverse (1495,21)CAGATGACTTGTCAGCCTTCGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.233 kcal/mol
Reverse Dimers-1.171 kcal/mol
Forward-Reverse Dimers-2.785 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAGAATGAAGGTCAAGGA
GTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGAC
CATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGGCTGACA
AGTCATCTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)189895 - 1083
NM_001127510 (APC)189929 - 1117
NM_000038 (APC)189821 - 1009
Exon 10 To Exon 11 (Pair 14)
Forward (1307,22)TCTCAGAACAAGCATGAAACCGAmplicon SizecDNA: 161 bpgenomic: 14,272
Reverse (1467,22)GAGTGTGTGCTACTAGAACTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-2.384 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAGAATGAAGGTCAAGGA
GTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGAC
CATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)161821 - 981
NM_001127511 (APC)161895 - 1055
NM_001127510 (APC)161929 - 1089
Exon 10 To Exon 11 (Pair 15)
Forward (1375,23)AATCAACATGGCAACTTCTGGTAAmplicon SizecDNA: 98 bpgenomic: 14,209
Reverse (1472,21)GTGCAGAGTGTGTGCTACTAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.814 kcal/mol in 3' area
Forward Dimers-1.535 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAAC
AGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)98889 - 986
NM_001127510 (APC)98997 - 1094
NM_001127511 (APC)98963 - 1060
Exon 10 To Exon 11 (Pair 16)
Forward (1375,23)AATCAACATGGCAACTTCTGGTAAmplicon SizecDNA: 100 bpgenomic: 14,211
Reverse (1474,21)AGGTGCAGAGTGTGTGCTACTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.814 kcal/mol in 3' area
Forward Dimers-1.535 kcal/mol
Reverse Loops1.238 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-2.825 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAAC
AGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)100889 - 988
NM_001127510 (APC)100997 - 1096
NM_001127511 (APC)100963 - 1062
Exon 10 To Exon 11 (Pair 17)
Forward (1361,22)CAAGGAGTGGGAGAAATCAACAAmplicon SizecDNA: 123 bpgenomic: 14,234
Reverse (1483,20)CAGCCTTCGAGGTGCAGAGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.758 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.926 kcal/mol
Reverse Dimers-1.352 kcal/mol
Forward-Reverse Dimers-2.725 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGA
ATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGG
CTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)123983 - 1105
NM_001127511 (APC)123949 - 1071
NM_000038 (APC)123875 - 997
Exon 10 To Exon 11 (Pair 18)
Forward (1361,22)CAAGGAGTGGGAGAAATCAACAAmplicon SizecDNA: 122 bpgenomic: 14,233
Reverse (1482,20)AGCCTTCGAGGTGCAGAGTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.758 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.926 kcal/mol
Reverse Dimers-1.352 kcal/mol
Forward-Reverse Dimers-2.725 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGA
ATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGG
CT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)122875 - 996
NM_001127511 (APC)122949 - 1070
NM_001127510 (APC)122983 - 1104
Exon 10 To Exon 11 (Pair 19)
Forward (1375,23)AATCAACATGGCAACTTCTGGTAAmplicon SizecDNA: 93 bpgenomic: 14,204
Reverse (1467,22)GAGTGTGTGCTACTAGAACTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.814 kcal/mol in 3' area
Forward Dimers-1.535 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAAC
AGCCAGTGTTTTGAGTTCTAGTAGCACACACTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)93889 - 981
NM_001127510 (APC)93997 - 1089
NM_001127511 (APC)93963 - 1055
Exon 10 To Exon 11 (Pair 20)
Forward (1375,23)AATCAACATGGCAACTTCTGGTAAmplicon SizecDNA: 99 bpgenomic: 14,210
Reverse (1473,21)GGTGCAGAGTGTGTGCTACTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.814 kcal/mol in 3' area
Forward Dimers-1.535 kcal/mol
Reverse Loops1.093 kcal/mol in 3' area
Reverse Dimers-1.072 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAAC
AGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)99889 - 987
NM_001127511 (APC)99963 - 1061
NM_001127510 (APC)99997 - 1095
Exon 10 To Exon 12 (Pair 4)
Forward (1361,22)CAAGGAGTGGGAGAAATCAACAAmplicon SizecDNA: 269 bpgenomic: 17,752
Reverse (1629,21)AGACATCCAGACTGTCGCATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.758 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops1.558 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.682 kcal/mol
Amplicon Folding-1.789 kcal/mol outside primersite
Amplicon SequenceCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGA
ATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGG
CTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCAATGCTTGGT
ACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCCCAAGACAGC
TGTATATCCATGCGACAGTCTGGATGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)269875 - 1143
NM_001127510 (APC)269983 - 1251
NM_001127511 (APC)269949 - 1217
Exon 10 To Exon 11 (Pair 21)
Forward (1307,22)TCTCAGAACAAGCATGAAACCGAmplicon SizecDNA: 191 bpgenomic: 14,302
Reverse (1497,21)CCCAGATGACTTGTCAGCCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.007 kcal/mol
Forward Dimers-1.956 kcal/mol
Reverse Loops0.233 kcal/mol
Reverse Dimers-1.171 kcal/mol
Forward-Reverse Dimers-2.785 kcal/mol
Amplicon Folding-0.876 kcal/mol outside primersite
Amplicon SequenceTCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAGAATGAAGGTCAAGGA
GTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGAC
CATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGGCTGACA
AGTCATCTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)191895 - 1085
NM_000038 (APC)191821 - 1011
NM_001127510 (APC)191929 - 1119
Exon 10 To Exon 11 (Pair 22)
Forward (1374,23)AAATCAACATGGCAACTTCTGGTAmplicon SizecDNA: 95 bpgenomic: 14,206
Reverse (1468,22)AGAGTGTGTGCTACTAGAACTCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.485 kcal/mol in 3' area
Forward Dimers-1.535 kcal/mol
Reverse Loops1.093 kcal/mol
Reverse Dimers-1.712 kcal/mol
Forward-Reverse Dimers-1.768 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGAATGGACCATGAAA
CAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)95996 - 1090
NM_000038 (APC)95888 - 982
NM_001127511 (APC)95962 - 1056
Exon 10 To Exon 11 (Pair 23)
Forward (1361,22)CAAGGAGTGGGAGAAATCAACAAmplicon SizecDNA: 137 bpgenomic: 14,248
Reverse (1497,21)CCCAGATGACTTGTCAGCCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.758 kcal/mol in 3' area
Forward Dimers-0.136 kcal/mol
Reverse Loops0.233 kcal/mol
Reverse Dimers-1.171 kcal/mol
Forward-Reverse Dimers-2.393 kcal/mol
Amplicon Folding-0.754 kcal/mol outside primersite
Amplicon SequenceCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCAACTACACGA
ATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCACCTCGAAGG
CTGACAAGTCATCTGGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)137949 - 1085
NM_001127510 (APC)137983 - 1119
NM_000038 (APC)137875 - 1011
Exon 11 To Exon 12 (Pair 1)
Forward (1471,21)ACCTCGAAGGCTGACAAGTCAAmplicon SizecDNA: 208 bpgenomic: 3,580
Reverse (1678,23)CAATACAGAGTCTTTGTCATTGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.804 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTC
AATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTC
CCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTT
ACATGGCAATGACAAAGACTCTGTATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)208985 - 1192
NM_001127511 (APC)2081059 - 1266
NM_001127510 (APC)2081093 - 1300
Exon 11 To Exon 12 (Pair 2)
Forward (1469,20)GCACCTCGAAGGCTGACAAGAmplicon SizecDNA: 212 bpgenomic: 3,584
Reverse (1680,24)AACAATACAGAGTCTTTGTCATTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.804 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceGCACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTG
TCAATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGC
TCCCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTT
TTACATGGCAATGACAAAGACTCTGTATTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2121091 - 1302
NM_001127511 (APC)2121057 - 1268
NM_000038 (APC)212983 - 1194
Exon 11 To Exon 12 (Pair 3)
Forward (1457,20)AGCACACACTCTGCACCTCGAmplicon SizecDNA: 216 bpgenomic: 3,588
Reverse (1672,23)AGAGTCTTTGTCATTGCCATGTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.172 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops1.957 kcal/mol in 3' area
Reverse Dimers-1.38 kcal/mol
Forward-Reverse Dimers-2.641 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceAGCACACACTCTGCACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTG
TATTCATTGTTGTCAATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTA
GCTATGTCTAGCTCCCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTC
CTCATCCAGCTTTTACATGGCAATGACAAAGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2161079 - 1294
NM_001127511 (APC)2161045 - 1260
NM_000038 (APC)216971 - 1186
Exon 11 To Exon 12 (Pair 4)
Forward (1457,20)AGCACACACTCTGCACCTCGAmplicon SizecDNA: 168 bpgenomic: 3,540
Reverse (1624,22)TCCAGACTGTCGCATGGATATANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.172 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops0.835 kcal/mol
Reverse Dimers-1.2 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.035 kcal/mol outside primersite
Amplicon SequenceAGCACACACTCTGCACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTG
TATTCATTGTTGTCAATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTA
GCTATGTCTAGCTCCCAAGACAGCTGTATATCCATGCGACAGTCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)1681079 - 1246
NM_001127511 (APC)1681045 - 1212
NM_000038 (APC)168971 - 1138
Exon 11 To Exon 12 (Pair 5)
Forward (1471,21)ACCTCGAAGGCTGACAAGTCAAmplicon SizecDNA: 212 bpgenomic: 3,584
Reverse (1682,23)CCAACAATACAGAGTCTTTGTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.804 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTC
AATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTC
CCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTT
ACATGGCAATGACAAAGACTCTGTATTGTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2121093 - 1304
NM_001127511 (APC)2121059 - 1270
NM_000038 (APC)212985 - 1196
Exon 11 To Exon 12 (Pair 6)
Forward (1473,21)CTCGAAGGCTGACAAGTCATCAmplicon SizecDNA: 208 bpgenomic: 3,580
Reverse (1680,24)AACAATACAGAGTCTTTGTCATTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCAA
TGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCCC
AAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTAC
ATGGCAATGACAAAGACTCTGTATTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)2081061 - 1268
NM_001127510 (APC)2081095 - 1302
NM_000038 (APC)208987 - 1194
Exon 11 To Exon 12 (Pair 7)
Forward (1469,20)GCACCTCGAAGGCTGACAAGAmplicon SizecDNA: 213 bpgenomic: 3,585
Reverse (1681,24)CAACAATACAGAGTCTTTGTCATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.804 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceGCACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTG
TCAATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGC
TCCCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTT
TTACATGGCAATGACAAAGACTCTGTATTGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)213983 - 1195
NM_001127511 (APC)2131057 - 1269
NM_001127510 (APC)2131091 - 1303
Exon 11 To Exon 12 (Pair 8)
Forward (1473,21)CTCGAAGGCTGACAAGTCATCAmplicon SizecDNA: 210 bpgenomic: 3,582
Reverse (1682,23)CCAACAATACAGAGTCTTTGTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCAA
TGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCCC
AAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTAC
ATGGCAATGACAAAGACTCTGTATTGTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2101095 - 1304
NM_001127511 (APC)2101061 - 1270
NM_000038 (APC)210987 - 1196
Exon 11 To Exon 12 (Pair 9)
Forward (1472,21)CCTCGAAGGCTGACAAGTCATAmplicon SizecDNA: 210 bpgenomic: 3,582
Reverse (1681,24)CAACAATACAGAGTCTTTGTCATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCA
ATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCC
CAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTA
CATGGCAATGACAAAGACTCTGTATTGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)210986 - 1195
NM_001127511 (APC)2101060 - 1269
NM_001127510 (APC)2101094 - 1303
Exon 11 To Exon 12 (Pair 10)
Forward (1473,21)CTCGAAGGCTGACAAGTCATCAmplicon SizecDNA: 209 bpgenomic: 3,581
Reverse (1681,24)CAACAATACAGAGTCTTTGTCATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCAA
TGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCCC
AAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTAC
ATGGCAATGACAAAGACTCTGTATTGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)2091061 - 1269
NM_001127510 (APC)2091095 - 1303
NM_000038 (APC)209987 - 1195
Exon 11 To Exon 12 (Pair 11)
Forward (1473,21)CTCGAAGGCTGACAAGTCATCAmplicon SizecDNA: 205 bpgenomic: 3,577
Reverse (1677,23)AATACAGAGTCTTTGTCATTGCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCAA
TGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCCC
AAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTAC
ATGGCAATGACAAAGACTCTGTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)205987 - 1191
NM_001127510 (APC)2051095 - 1299
NM_001127511 (APC)2051061 - 1265
Exon 11 To Exon 12 (Pair 12)
Forward (1471,21)ACCTCGAAGGCTGACAAGTCAAmplicon SizecDNA: 211 bpgenomic: 3,583
Reverse (1681,24)CAACAATACAGAGTCTTTGTCATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.804 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTC
AATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTC
CCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTT
ACATGGCAATGACAAAGACTCTGTATTGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2111093 - 1303
NM_001127511 (APC)2111059 - 1269
NM_000038 (APC)211985 - 1195
Exon 11 To Exon 12 (Pair 13)
Forward (1469,20)GCACCTCGAAGGCTGACAAGAmplicon SizecDNA: 209 bpgenomic: 3,581
Reverse (1677,23)AATACAGAGTCTTTGTCATTGCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.804 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceGCACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTG
TCAATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGC
TCCCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTT
TTACATGGCAATGACAAAGACTCTGTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2091091 - 1299
NM_001127511 (APC)2091057 - 1265
NM_000038 (APC)209983 - 1191
Exon 11 To Exon 12 (Pair 14)
Forward (1472,21)CCTCGAAGGCTGACAAGTCATAmplicon SizecDNA: 201 bpgenomic: 3,573
Reverse (1672,23)AGAGTCTTTGTCATTGCCATGTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.957 kcal/mol in 3' area
Reverse Dimers-1.38 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCA
ATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCC
CAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTA
CATGGCAATGACAAAGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2011094 - 1294
NM_001127511 (APC)2011060 - 1260
NM_000038 (APC)201986 - 1186
Exon 11 To Exon 12 (Pair 15)
Forward (1472,21)CCTCGAAGGCTGACAAGTCATAmplicon SizecDNA: 207 bpgenomic: 3,579
Reverse (1678,23)CAATACAGAGTCTTTGTCATTGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCA
ATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCC
CAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTA
CATGGCAATGACAAAGACTCTGTATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)207986 - 1192
NM_001127511 (APC)2071060 - 1266
NM_001127510 (APC)2071094 - 1300
Exon 11 To Exon 12 (Pair 16)
Forward (1472,21)CCTCGAAGGCTGACAAGTCATAmplicon SizecDNA: 211 bpgenomic: 3,583
Reverse (1682,23)CCAACAATACAGAGTCTTTGTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCA
ATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCC
CAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTA
CATGGCAATGACAAAGACTCTGTATTGTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2111094 - 1304
NM_001127511 (APC)2111060 - 1270
NM_000038 (APC)211986 - 1196
Exon 11 To Exon 12 (Pair 17)
Forward (1469,20)GCACCTCGAAGGCTGACAAGAmplicon SizecDNA: 214 bpgenomic: 3,586
Reverse (1682,23)CCAACAATACAGAGTCTTTGTCANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.804 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol in 3' area
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceGCACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTG
TCAATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGC
TCCCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTT
TTACATGGCAATGACAAAGACTCTGTATTGTTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)214983 - 1196
NM_001127511 (APC)2141057 - 1270
NM_001127510 (APC)2141091 - 1304
Exon 11 To Exon 12 (Pair 18)
Forward (1473,21)CTCGAAGGCTGACAAGTCATCAmplicon SizecDNA: 206 bpgenomic: 3,578
Reverse (1678,23)CAATACAGAGTCTTTGTCATTGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCAA
TGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCCC
AAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTAC
ATGGCAATGACAAAGACTCTGTATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)206987 - 1192
NM_001127510 (APC)2061095 - 1300
NM_001127511 (APC)2061061 - 1266
Exon 11 To Exon 12 (Pair 19)
Forward (1472,21)CCTCGAAGGCTGACAAGTCATAmplicon SizecDNA: 206 bpgenomic: 3,578
Reverse (1677,23)AATACAGAGTCTTTGTCATTGCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCA
ATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCC
CAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTA
CATGGCAATGACAAAGACTCTGTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2061094 - 1299
NM_001127511 (APC)2061060 - 1265
NM_000038 (APC)206986 - 1191
Exon 11 To Exon 12 (Pair 20)
Forward (1471,21)ACCTCGAAGGCTGACAAGTCAAmplicon SizecDNA: 207 bpgenomic: 3,579
Reverse (1677,23)AATACAGAGTCTTTGTCATTGCCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.804 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTC
AATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTC
CCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTT
ACATGGCAATGACAAAGACTCTGTATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2071093 - 1299
NM_000038 (APC)207985 - 1191
NM_001127511 (APC)2071059 - 1265
Exon 11 To Exon 12 (Pair 21)
Forward (1471,21)ACCTCGAAGGCTGACAAGTCAAmplicon SizecDNA: 210 bpgenomic: 3,582
Reverse (1680,24)AACAATACAGAGTCTTTGTCATTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.804 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTC
AATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTC
CCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTT
ACATGGCAATGACAAAGACTCTGTATTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2101093 - 1302
NM_000038 (APC)210985 - 1194
NM_001127511 (APC)2101059 - 1268
Exon 11 To Exon 12 (Pair 22)
Forward (1472,21)CCTCGAAGGCTGACAAGTCATAmplicon SizecDNA: 209 bpgenomic: 3,581
Reverse (1680,24)AACAATACAGAGTCTTTGTCATTGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops0.998 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCA
ATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCC
CAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTA
CATGGCAATGACAAAGACTCTGTATTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2091094 - 1302
NM_000038 (APC)209986 - 1194
NM_001127511 (APC)2091060 - 1268
Exon 11 To Exon 12 (Pair 23)
Forward (1457,20)AGCACACACTCTGCACCTCGAmplicon SizecDNA: 173 bpgenomic: 3,545
Reverse (1629,21)AGACATCCAGACTGTCGCATGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.172 kcal/mol
Forward Dimers-1.124 kcal/mol
Reverse Loops1.558 kcal/mol
Reverse Dimers-1.004 kcal/mol
Forward-Reverse Dimers-1.109 kcal/mol
Amplicon Folding-1.035 kcal/mol outside primersite
Amplicon SequenceAGCACACACTCTGCACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTG
TATTCATTGTTGTCAATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTA
GCTATGTCTAGCTCCCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)1731045 - 1217
NM_001127510 (APC)1731079 - 1251
NM_000038 (APC)173971 - 1143
Exon 11 To Exon 12 (Pair 24)
Forward (1473,21)CTCGAAGGCTGACAAGTCATCAmplicon SizecDNA: 200 bpgenomic: 3,572
Reverse (1672,23)AGAGTCTTTGTCATTGCCATGTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.278 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.957 kcal/mol in 3' area
Reverse Dimers-1.38 kcal/mol
Forward-Reverse Dimers-2.583 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCAA
TGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCCC
AAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTAC
ATGGCAATGACAAAGACTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)200987 - 1186
NM_001127510 (APC)2001095 - 1294
NM_001127511 (APC)2001061 - 1260
Exon 11 To Exon 12 (Pair 25)
Forward (1469,20)GCACCTCGAAGGCTGACAAGAmplicon SizecDNA: 210 bpgenomic: 3,582
Reverse (1678,23)CAATACAGAGTCTTTGTCATTGCNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops0.804 kcal/mol
Forward Dimers-2.409 kcal/mol
Reverse Loops1.294 kcal/mol
Reverse Dimers-2.328 kcal/mol
Forward-Reverse Dimers-2.489 kcal/mol
Amplicon Folding-2.206 kcal/mol outside primersite
Amplicon SequenceGCACCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTG
TCAATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGC
TCCCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTT
TTACATGGCAATGACAAAGACTCTGTATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)210983 - 1192
NM_001127511 (APC)2101057 - 1266
NM_001127510 (APC)2101091 - 1300
Exon 13 To Exon 14 (Pair 1)
Forward (1884,21)TGCCAGCTCCTGTTGAACATCAmplicon SizecDNA: 199 bpgenomic: 5,315
Reverse (2082,22)GCCATTCCAGCATATCGTCTTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.88 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceTGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCAT
TTGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAAT
TATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAA
GACGATATGCTGGAATGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)1991472 - 1670
NM_001127510 (APC)1991506 - 1704
NM_000038 (APC)1991398 - 1596
Exon 13 To Exon 14 (Pair 2)
Forward (1886,21)CCAGCTCCTGTTGAACATCAGAmplicon SizecDNA: 193 bpgenomic: 5,309
Reverse (2078,23)TTCCAGCATATCGTCTTAGTGTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTT
GATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTA
TTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGA
CGATATGCTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)1931508 - 1700
NM_001127511 (APC)1931474 - 1666
NM_000038 (APC)1931400 - 1592
Exon 13 To Exon 14 (Pair 3)
Forward (1884,21)TGCCAGCTCCTGTTGAACATCAmplicon SizecDNA: 195 bpgenomic: 5,311
Reverse (2078,23)TTCCAGCATATCGTCTTAGTGTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceTGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCAT
TTGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAAT
TATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAA
GACGATATGCTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)1951506 - 1700
NM_001127511 (APC)1951472 - 1666
NM_000038 (APC)1951398 - 1592
Exon 13 To Exon 14 (Pair 4)
Forward (1884,21)TGCCAGCTCCTGTTGAACATCAmplicon SizecDNA: 191 bpgenomic: 5,307
Reverse (2074,24)AGCATATCGTCTTAGTGTAATACTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.205 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.666 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceTGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCAT
TTGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAAT
TATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAA
GACGATATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)1911398 - 1588
NM_001127511 (APC)1911472 - 1662
NM_001127510 (APC)1911506 - 1696
Exon 13 To Exon 14 (Pair 5)
Forward (1885,21)GCCAGCTCCTGTTGAACATCAAmplicon SizecDNA: 197 bpgenomic: 5,313
Reverse (2081,22)CCATTCCAGCATATCGTCTTAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATT
TGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATT
ATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAG
ACGATATGCTGGAATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)1971399 - 1595
NM_001127510 (APC)1971507 - 1703
NM_001127511 (APC)1971473 - 1669
Exon 13 To Exon 14 (Pair 6)
Forward (1885,21)GCCAGCTCCTGTTGAACATCAAmplicon SizecDNA: 190 bpgenomic: 5,306
Reverse (2074,24)AGCATATCGTCTTAGTGTAATACTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.205 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.666 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATT
TGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATT
ATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAG
ACGATATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)1901473 - 1662
NM_001127510 (APC)1901507 - 1696
NM_000038 (APC)1901399 - 1588
Exon 13 To Exon 14 (Pair 7)
Forward (1886,21)CCAGCTCCTGTTGAACATCAGAmplicon SizecDNA: 192 bpgenomic: 5,308
Reverse (2077,23)TCCAGCATATCGTCTTAGTGTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTT
GATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTA
TTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGA
CGATATGCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)1921400 - 1591
NM_001127510 (APC)1921508 - 1699
NM_001127511 (APC)1921474 - 1665
Exon 13 To Exon 14 (Pair 8)
Forward (1886,21)CCAGCTCCTGTTGAACATCAGAmplicon SizecDNA: 196 bpgenomic: 5,312
Reverse (2081,22)CCATTCCAGCATATCGTCTTAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTT
GATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTA
TTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGA
CGATATGCTGGAATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)1961400 - 1595
NM_001127511 (APC)1961474 - 1669
NM_001127510 (APC)1961508 - 1703
Exon 13 To Exon 14 (Pair 9)
Forward (1886,21)CCAGCTCCTGTTGAACATCAGAmplicon SizecDNA: 161 bpgenomic: 5,277
Reverse (2046,23)TGGTCATTAGTAAGCCCATACATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.042 kcal/mol
Reverse Dimers-0.022 kcal/mol
Forward-Reverse Dimers-1.904 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTT
GATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTA
TTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)1611474 - 1634
NM_001127510 (APC)1611508 - 1668
NM_000038 (APC)1611400 - 1560
Exon 13 To Exon 14 (Pair 10)
Forward (1885,21)GCCAGCTCCTGTTGAACATCAAmplicon SizecDNA: 199 bpgenomic: 5,315
Reverse (2083,22)AGCCATTCCAGCATATCGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.553 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATT
TGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATT
ATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAG
ACGATATGCTGGAATGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)1991507 - 1705
NM_001127511 (APC)1991473 - 1671
NM_000038 (APC)1991399 - 1597
Exon 13 To Exon 14 (Pair 11)
Forward (1884,21)TGCCAGCTCCTGTTGAACATCAmplicon SizecDNA: 196 bpgenomic: 5,312
Reverse (2079,23)ATTCCAGCATATCGTCTTAGTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceTGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCAT
TTGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAAT
TATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAA
GACGATATGCTGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)1961472 - 1667
NM_001127510 (APC)1961506 - 1701
NM_000038 (APC)1961398 - 1593
Exon 13 To Exon 14 (Pair 12)
Forward (1886,21)CCAGCTCCTGTTGAACATCAGAmplicon SizecDNA: 199 bpgenomic: 5,315
Reverse (2084,22)AAGCCATTCCAGCATATCGTCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.553 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTT
GATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTA
TTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGA
CGATATGCTGGAATGGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)1991400 - 1598
NM_001127511 (APC)1991474 - 1672
NM_001127510 (APC)1991508 - 1706
Exon 13 To Exon 14 (Pair 13)
Forward (1886,21)CCAGCTCCTGTTGAACATCAGAmplicon SizecDNA: 198 bpgenomic: 5,314
Reverse (2083,22)AGCCATTCCAGCATATCGTCTTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.553 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTT
GATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTA
TTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGA
CGATATGCTGGAATGGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)1981474 - 1671
NM_001127510 (APC)1981508 - 1705
NM_000038 (APC)1981400 - 1597
Exon 13 To Exon 14 (Pair 14)
Forward (1886,21)CCAGCTCCTGTTGAACATCAGAmplicon SizecDNA: 189 bpgenomic: 5,305
Reverse (2074,24)AGCATATCGTCTTAGTGTAATACTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.205 kcal/mol in 3' area
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-1.666 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTT
GATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTA
TTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGA
CGATATGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)1891474 - 1662
NM_001127510 (APC)1891508 - 1696
NM_000038 (APC)1891400 - 1588
Exon 13 To Exon 14 (Pair 15)
Forward (1884,21)TGCCAGCTCCTGTTGAACATCAmplicon SizecDNA: 194 bpgenomic: 5,310
Reverse (2077,23)TCCAGCATATCGTCTTAGTGTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceTGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCAT
TTGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAAT
TATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAA
GACGATATGCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)1941506 - 1699
NM_001127511 (APC)1941472 - 1665
NM_000038 (APC)1941398 - 1591
Exon 13 To Exon 14 (Pair 16)
Forward (1885,21)GCCAGCTCCTGTTGAACATCAAmplicon SizecDNA: 193 bpgenomic: 5,309
Reverse (2077,23)TCCAGCATATCGTCTTAGTGTAANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATT
TGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATT
ATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAG
ACGATATGCTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)1931399 - 1591
NM_001127510 (APC)1931507 - 1699
NM_001127511 (APC)1931473 - 1665
Exon 13 To Exon 14 (Pair 17)
Forward (1885,21)GCCAGCTCCTGTTGAACATCAAmplicon SizecDNA: 161 bpgenomic: 5,277
Reverse (2045,23)GGTCATTAGTAAGCCCATACATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.106 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol in 3' area
Forward-Reverse Dimers-1.904 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATT
TGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATT
ATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000038 (APC)1611399 - 1559
NM_001127511 (APC)1611473 - 1633
NM_001127510 (APC)1611507 - 1667
Exon 13 To Exon 14 (Pair 18)
Forward (1886,21)CCAGCTCCTGTTGAACATCAGAmplicon SizecDNA: 191 bpgenomic: 5,307
Reverse (2076,23)CCAGCATATCGTCTTAGTGTAATNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTT
GATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTA
TTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGA
CGATATGCTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)1911508 - 1698
NM_001127511 (APC)1911474 - 1664
NM_000038 (APC)1911400 - 1590
Exon 13 To Exon 14 (Pair 19)
Forward (1884,21)TGCCAGCTCCTGTTGAACATCAmplicon SizecDNA: 198 bpgenomic: 5,314
Reverse (2081,22)CCATTCCAGCATATCGTCTTAGNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceTGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCAT
TTGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAAT
TATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAA
GACGATATGCTGGAATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)1981472 - 1669
NM_001127510 (APC)1981506 - 1703
NM_000038 (APC)1981398 - 1595
Exon 13 To Exon 14 (Pair 20)
Forward (1884,21)TGCCAGCTCCTGTTGAACATCAmplicon SizecDNA: 162 bpgenomic: 5,278
Reverse (2045,23)GGTCATTAGTAAGCCCATACATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.106 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol in 3' area
Forward-Reverse Dimers-1.904 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceTGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCAT
TTGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAAT
TATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)1621472 - 1633
NM_001127510 (APC)1621506 - 1667
NM_000038 (APC)1621398 - 1559
Exon 13 To Exon 14 (Pair 21)
Forward (1886,21)CCAGCTCCTGTTGAACATCAGAmplicon SizecDNA: 197 bpgenomic: 5,313
Reverse (2082,22)GCCATTCCAGCATATCGTCTTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.88 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTT
GATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTA
TTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGA
CGATATGCTGGAATGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)1971508 - 1704
NM_001127511 (APC)1971474 - 1670
NM_000038 (APC)1971400 - 1596
Exon 13 To Exon 14 (Pair 22)
Forward (1885,21)GCCAGCTCCTGTTGAACATCAAmplicon SizecDNA: 200 bpgenomic: 5,316
Reverse (2084,22)AAGCCATTCCAGCATATCGTCTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.553 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATT
TGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATT
ATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAG
ACGATATGCTGGAATGGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)2001507 - 1706
NM_001127511 (APC)2001473 - 1672
NM_000038 (APC)2001399 - 1598
Exon 13 To Exon 14 (Pair 23)
Forward (1886,21)CCAGCTCCTGTTGAACATCAGAmplicon SizecDNA: 194 bpgenomic: 5,310
Reverse (2079,23)ATTCCAGCATATCGTCTTAGTGTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTT
GATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTA
TTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGA
CGATATGCTGGAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)1941508 - 1701
NM_001127511 (APC)1941474 - 1667
NM_000038 (APC)1941400 - 1593
Exon 13 To Exon 14 (Pair 24)
Forward (1886,21)CCAGCTCCTGTTGAACATCAGAmplicon SizecDNA: 160 bpgenomic: 5,276
Reverse (2045,23)GGTCATTAGTAAGCCCATACATTNr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.106 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol in 3' area
Forward-Reverse Dimers-1.904 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTT
GATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTA
TTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127510 (APC)1601508 - 1667
NM_001127511 (APC)1601474 - 1633
NM_000038 (APC)1601400 - 1559
Exon 13 To Exon 14 (Pair 25)
Forward (1885,21)GCCAGCTCCTGTTGAACATCAAmplicon SizecDNA: 194 bpgenomic: 5,310
Reverse (2078,23)TTCCAGCATATCGTCTTAGTGTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops2.175 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATT
TGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATT
ATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAG
ACGATATGCTGGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)1941473 - 1666
NM_001127510 (APC)1941507 - 1700
NM_000038 (APC)1941399 - 1592
Exon 13 To Exon 14 (Pair 26)
Forward (1885,21)GCCAGCTCCTGTTGAACATCAAmplicon SizecDNA: 198 bpgenomic: 5,314
Reverse (2082,22)GCCATTCCAGCATATCGTCTTANr. of Isoforms 3 out of 3 (by amplicon BlastN)
Folding EnergiesForward Loops1.746 kcal/mol
Forward Dimers-2.778 kcal/mol
Reverse Loops1.88 kcal/mol
Reverse Dimers-0.584 kcal/mol
Forward-Reverse Dimers-2.14 kcal/mol
Amplicon Folding-2.812 kcal/mol outside primersite
Amplicon SequenceGCCAGCTCCTGTTGAACATCAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATT
TGATGAAGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATT
ATTGCAAGTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAG
ACGATATGCTGGAATGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001127511 (APC)1981473 - 1670
NM_001127510 (APC)1981507 - 1704
NM_000038 (APC)1981399 - 1596
 

See below for some more details.

Program Output:

Loading ...