Design Results for bglap

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size500
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 2 To Exon 3 (Pair 1)
Forward (145,19)CCCAGCGGTGCAGAGTCCAAmplicon SizecDNA: 80 bpgenomic: 250
Reverse (224,20)CGCCTGGGTCTCTTCACTACNr. of Isoforms 5 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.375 kcal/mol
Forward Dimers-2.618 kcal/mol
Reverse Loops2.501 kcal/mol
Reverse Dimers-0.873 kcal/mol
Forward-Reverse Dimers-2.677 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGCCTTTGTGTCCAAGCAGGAGGGCAGCGAG
GTAGTGAAGAGACCCAGGCG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001199662 (PMF1-BGLAP)80601 - 680
NM_199173 (BGLAP)80145 - 224
NM_001199663 (PMF1-BGLAP)80405 - 484
NM_001199664 (PMF1-BGLAP)80394 - 473
NM_001199661 (PMF1-BGLAP)80540 - 619
Exon 2 To Exon 3 (Pair 2)
Forward (145,19)CCCAGCGGTGCAGAGTCCAAmplicon SizecDNA: 81 bpgenomic: 251
Reverse (225,20)GCGCCTGGGTCTCTTCACTANr. of Isoforms 5 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.375 kcal/mol
Forward Dimers-2.618 kcal/mol
Reverse Loops2.501 kcal/mol in 3' area
Reverse Dimers-2.462 kcal/mol
Forward-Reverse Dimers-2.677 kcal/mol
Amplicon Folding-1.587 kcal/mol outside primersite
Amplicon SequenceCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGCCTTTGTGTCCAAGCAGGAGGGCAGCGAG
GTAGTGAAGAGACCCAGGCGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_001199662 (PMF1-BGLAP)81601 - 681
NM_199173 (BGLAP)81145 - 225
NM_001199663 (PMF1-BGLAP)81405 - 485
NM_001199664 (PMF1-BGLAP)81394 - 474
NM_001199661 (PMF1-BGLAP)81540 - 620
 

See below for some more details.

Program Output:

Loading ...