Design Results for braf

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size130
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size500

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 5 (Pair 1)
Forward (617,22)ATGATGAGAGGTCTAATCCCAGAmplicon SizecDNA: 96 bpgenomic: 925
Reverse (712,22)AAGCCAGGAAATATCAGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.051 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)96617 - 712
Exon 4 To Exon 5 (Pair 2)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 113 bpgenomic: 942
Reverse (726,22)AATTCTTCTCCAGTAAGCCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops2.107 kcal/mol in 3' area
Reverse Dimers-0.128 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)113614 - 726
Exon 4 To Exon 5 (Pair 3)
Forward (645,23)GTGCTGTTTACAGAATTCAGGATAmplicon SizecDNA: 83 bpgenomic: 912
Reverse (727,22)CAATTCTTCTCCAGTAAGCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTT
CCTGGCTTACTGGAGAAGAATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)83645 - 727
Exon 4 To Exon 5 (Pair 4)
Forward (641,23)TGCTGTGCTGTTTACAGAATTCAAmplicon SizecDNA: 72 bpgenomic: 901
Reverse (712,22)AAGCCAGGAAATATCAGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.138 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGAT
ATTTCCTGGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)72641 - 712
Exon 4 To Exon 5 (Pair 5)
Forward (615,22)TGATGATGAGAGGTCTAATCCCAmplicon SizecDNA: 120 bpgenomic: 949
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGA
AGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)120615 - 734
Exon 4 To Exon 5 (Pair 6)
Forward (616,22)GATGATGAGAGGTCTAATCCCAAmplicon SizecDNA: 112 bpgenomic: 941
Reverse (727,22)CAATTCTTCTCCAGTAAGCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAA
GAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)112616 - 727
Exon 4 To Exon 5 (Pair 7)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 119 bpgenomic: 948
Reverse (732,23)ACATGCAATTCTTCTCCAGTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)119614 - 732
Exon 4 To Exon 5 (Pair 8)
Forward (644,23)TGTGCTGTTTACAGAATTCAGGAAmplicon SizecDNA: 92 bpgenomic: 921
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATT
TCCTGGCTTACTGGAGAAGAATTGCATGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)92644 - 735
Exon 4 To Exon 5 (Pair 9)
Forward (644,23)TGTGCTGTTTACAGAATTCAGGAAmplicon SizecDNA: 108 bpgenomic: 937
Reverse (751,23)AACATTCTCCAACACTTCCACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.401 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATT
TCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGAATGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)108644 - 751
Exon 4 To Exon 5 (Pair 10)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 108 bpgenomic: 937
Reverse (721,23)TTCTCCAGTAAGCCAGGAAATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)108614 - 721
Exon 4 To Exon 5 (Pair 11)
Forward (616,22)GATGATGAGAGGTCTAATCCCAAmplicon SizecDNA: 97 bpgenomic: 926
Reverse (712,22)AAGCCAGGAAATATCAGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.051 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAA
GAAACCAATTGGTTGGGACACTGATATTTCCTGGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)97616 - 712
Exon 4 To Exon 5 (Pair 12)
Forward (644,23)TGTGCTGTTTACAGAATTCAGGAAmplicon SizecDNA: 72 bpgenomic: 901
Reverse (715,23)AGTAAGCCAGGAAATATCAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATT
TCCTGGCTTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)72644 - 715
Exon 4 To Exon 5 (Pair 13)
Forward (615,22)TGATGATGAGAGGTCTAATCCCAmplicon SizecDNA: 119 bpgenomic: 948
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGA
AGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)119615 - 733
Exon 4 To Exon 5 (Pair 14)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 107 bpgenomic: 936
Reverse (752,22)GAACATTCTCCAACACTTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.857 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.401 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGAATGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)107646 - 752
Exon 4 To Exon 5 (Pair 15)
Forward (616,22)GATGATGAGAGGTCTAATCCCAAmplicon SizecDNA: 118 bpgenomic: 947
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAA
GAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)118616 - 733
Exon 4 To Exon 5 (Pair 16)
Forward (618,22)TGATGAGAGGTCTAATCCCAGAAmplicon SizecDNA: 124 bpgenomic: 953
Reverse (741,23)AACACTTCCACATGCAATTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGA
AACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAG
TGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)124618 - 741
Exon 4 To Exon 5 (Pair 17)
Forward (644,23)TGTGCTGTTTACAGAATTCAGGAAmplicon SizecDNA: 76 bpgenomic: 905
Reverse (719,22)CTCCAGTAAGCCAGGAAATATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATT
TCCTGGCTTACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)76644 - 719
Exon 4 To Exon 5 (Pair 18)
Forward (617,22)ATGATGAGAGGTCTAATCCCAGAmplicon SizecDNA: 119 bpgenomic: 948
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)119617 - 735
Exon 4 To Exon 5 (Pair 19)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 90 bpgenomic: 919
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAGAAGAATTGCATGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)90646 - 735
Exon 4 To Exon 5 (Pair 20)
Forward (615,22)TGATGATGAGAGGTCTAATCCCAmplicon SizecDNA: 112 bpgenomic: 941
Reverse (726,22)AATTCTTCTCCAGTAAGCCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops2.107 kcal/mol in 3' area
Reverse Dimers-0.128 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGA
AGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)112615 - 726
Exon 4 To Exon 5 (Pair 21)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 92 bpgenomic: 921
Reverse (737,22)CTTCCACATGCAATTCTTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAGAAGAATTGCATGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)92646 - 737
Exon 4 To Exon 5 (Pair 22)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 72 bpgenomic: 901
Reverse (717,22)CCAGTAAGCCAGGAAATATCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.601 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)72646 - 717
Exon 4 To Exon 5 (Pair 23)
Forward (610,22)AGCACTGATGATGAGAGGTCTAAmplicon SizecDNA: 131 bpgenomic: 960
Reverse (740,23)ACACTTCCACATGCAATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.614 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGG
AGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCA
TGTGGAAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)131610 - 740
Exon 4 To Exon 5 (Pair 24)
Forward (645,23)GTGCTGTTTACAGAATTCAGGATAmplicon SizecDNA: 75 bpgenomic: 904
Reverse (719,22)CTCCAGTAAGCCAGGAAATATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTT
CCTGGCTTACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)75645 - 719
Exon 4 To Exon 5 (Pair 25)
Forward (615,22)TGATGATGAGAGGTCTAATCCCAmplicon SizecDNA: 98 bpgenomic: 927
Reverse (712,22)AAGCCAGGAAATATCAGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.051 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGA
AGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)98615 - 712
Exon 4 To Exon 5 (Pair 26)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 106 bpgenomic: 935
Reverse (751,23)AACATTCTCCAACACTTCCACATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.401 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGAATGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)106646 - 751
Exon 4 To Exon 5 (Pair 27)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 120 bpgenomic: 949
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)120614 - 733
Exon 4 To Exon 5 (Pair 28)
Forward (615,22)TGATGATGAGAGGTCTAATCCCAmplicon SizecDNA: 126 bpgenomic: 955
Reverse (740,23)ACACTTCCACATGCAATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGA
AGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
AAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)126615 - 740
Exon 4 To Exon 5 (Pair 29)
Forward (618,22)TGATGAGAGGTCTAATCCCAGAAmplicon SizecDNA: 111 bpgenomic: 940
Reverse (728,22)GCAATTCTTCTCCAGTAAGCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGA
AACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)111618 - 728
Exon 4 To Exon 5 (Pair 30)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 82 bpgenomic: 911
Reverse (727,22)CAATTCTTCTCCAGTAAGCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAGAAGAATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)82646 - 727
Exon 4 To Exon 5 (Pair 31)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 83 bpgenomic: 912
Reverse (728,22)GCAATTCTTCTCCAGTAAGCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAGAAGAATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)83646 - 728
Exon 4 To Exon 5 (Pair 32)
Forward (618,22)TGATGAGAGGTCTAATCCCAGAAmplicon SizecDNA: 110 bpgenomic: 939
Reverse (727,22)CAATTCTTCTCCAGTAAGCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGA
AACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)110618 - 727
Exon 4 To Exon 5 (Pair 33)
Forward (611,22)GCACTGATGATGAGAGGTCTAAAmplicon SizecDNA: 131 bpgenomic: 960
Reverse (741,23)AACACTTCCACATGCAATTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGA
GAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCAT
GTGGAAGTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)131611 - 741
Exon 4 To Exon 5 (Pair 34)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 97 bpgenomic: 926
Reverse (710,21)GCCAGGAAATATCAGTGTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.721 kcal/mol in 3' area
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.423 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)97614 - 710
Exon 4 To Exon 5 (Pair 35)
Forward (644,23)TGTGCTGTTTACAGAATTCAGGAAmplicon SizecDNA: 112 bpgenomic: 941
Reverse (755,22)GTGGAACATTCTCCAACACTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops0.767 kcal/mol
Reverse Dimers-0.969 kcal/mol
Forward-Reverse Dimers-2.401 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATT
TCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGAATGTTCCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)112644 - 755
Exon 4 To Exon 5 (Pair 36)
Forward (617,22)ATGATGAGAGGTCTAATCCCAGAmplicon SizecDNA: 113 bpgenomic: 942
Reverse (729,22)TGCAATTCTTCTCCAGTAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)113617 - 729
Exon 4 To Exon 5 (Pair 37)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 76 bpgenomic: 905
Reverse (721,23)TTCTCCAGTAAGCCAGGAAATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)76646 - 721
Exon 4 To Exon 5 (Pair 38)
Forward (644,23)TGTGCTGTTTACAGAATTCAGGAAmplicon SizecDNA: 74 bpgenomic: 903
Reverse (717,22)CCAGTAAGCCAGGAAATATCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.601 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATT
TCCTGGCTTACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)74644 - 717
Exon 4 To Exon 5 (Pair 39)
Forward (611,22)GCACTGATGATGAGAGGTCTAAAmplicon SizecDNA: 117 bpgenomic: 946
Reverse (727,22)CAATTCTTCTCCAGTAAGCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-2.475 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGA
GAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)117611 - 727
Exon 4 To Exon 5 (Pair 40)
Forward (617,22)ATGATGAGAGGTCTAATCCCAGAmplicon SizecDNA: 116 bpgenomic: 945
Reverse (732,23)ACATGCAATTCTTCTCCAGTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)116617 - 732
Exon 4 To Exon 5 (Pair 41)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 74 bpgenomic: 903
Reverse (719,22)CTCCAGTAAGCCAGGAAATATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)74646 - 719
Exon 4 To Exon 5 (Pair 42)
Forward (616,22)GATGATGAGAGGTCTAATCCCAAmplicon SizecDNA: 122 bpgenomic: 951
Reverse (737,22)CTTCCACATGCAATTCTTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAA
GAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGA
AG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)122616 - 737
Exon 4 To Exon 5 (Pair 43)
Forward (645,23)GTGCTGTTTACAGAATTCAGGATAmplicon SizecDNA: 73 bpgenomic: 902
Reverse (717,22)CCAGTAAGCCAGGAAATATCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.601 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTT
CCTGGCTTACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)73645 - 717
Exon 4 To Exon 5 (Pair 44)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 109 bpgenomic: 938
Reverse (754,22)TGGAACATTCTCCAACACTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops0.767 kcal/mol
Reverse Dimers-0.969 kcal/mol
Forward-Reverse Dimers-2.401 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGAATGTTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)109646 - 754
Exon 4 To Exon 5 (Pair 45)
Forward (618,22)TGATGAGAGGTCTAATCCCAGAAmplicon SizecDNA: 112 bpgenomic: 941
Reverse (729,22)TGCAATTCTTCTCCAGTAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGA
AACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)112618 - 729
Exon 4 To Exon 5 (Pair 46)
Forward (645,23)GTGCTGTTTACAGAATTCAGGATAmplicon SizecDNA: 89 bpgenomic: 918
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTT
CCTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)89645 - 733
Exon 4 To Exon 5 (Pair 47)
Forward (611,22)GCACTGATGATGAGAGGTCTAAAmplicon SizecDNA: 125 bpgenomic: 954
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGA
GAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCAT
GTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)125611 - 735
Exon 4 To Exon 5 (Pair 48)
Forward (618,22)TGATGAGAGGTCTAATCCCAGAAmplicon SizecDNA: 125 bpgenomic: 954
Reverse (742,23)CAACACTTCCACATGCAATTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol in 3' area
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGA
AACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAG
TGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)125618 - 742
Exon 4 To Exon 5 (Pair 49)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 121 bpgenomic: 950
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
G
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)121614 - 734
Exon 4 To Exon 5 (Pair 50)
Forward (616,22)GATGATGAGAGGTCTAATCCCAAmplicon SizecDNA: 114 bpgenomic: 943
Reverse (729,22)TGCAATTCTTCTCCAGTAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAA
GAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)114616 - 729
Exon 4 To Exon 5 (Pair 51)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 88 bpgenomic: 917
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)88646 - 733
Exon 4 To Exon 5 (Pair 52)
Forward (616,22)GATGATGAGAGGTCTAATCCCAAmplicon SizecDNA: 126 bpgenomic: 955
Reverse (741,23)AACACTTCCACATGCAATTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAA
GAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGA
AGTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)126616 - 741
Exon 4 To Exon 5 (Pair 53)
Forward (610,22)AGCACTGATGATGAGAGGTCTAAmplicon SizecDNA: 128 bpgenomic: 957
Reverse (737,22)CTTCCACATGCAATTCTTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.614 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGG
AGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCA
TGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)128610 - 737
Exon 4 To Exon 5 (Pair 54)
Forward (618,22)TGATGAGAGGTCTAATCCCAGAAmplicon SizecDNA: 115 bpgenomic: 944
Reverse (732,23)ACATGCAATTCTTCTCCAGTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGA
AACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)115618 - 732
Exon 4 To Exon 5 (Pair 55)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 124 bpgenomic: 953
Reverse (737,22)CTTCCACATGCAATTCTTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
GAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)124614 - 737
Exon 4 To Exon 5 (Pair 56)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 115 bpgenomic: 944
Reverse (728,22)GCAATTCTTCTCCAGTAAGCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)115614 - 728
Exon 4 To Exon 5 (Pair 57)
Forward (618,22)TGATGAGAGGTCTAATCCCAGAAmplicon SizecDNA: 109 bpgenomic: 938
Reverse (726,22)AATTCTTCTCCAGTAAGCCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops2.107 kcal/mol in 3' area
Reverse Dimers-0.128 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGA
AACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)109618 - 726
Exon 4 To Exon 5 (Pair 58)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 127 bpgenomic: 956
Reverse (740,23)ACACTTCCACATGCAATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
GAAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)127614 - 740
Exon 4 To Exon 5 (Pair 59)
Forward (616,22)GATGATGAGAGGTCTAATCCCAAmplicon SizecDNA: 113 bpgenomic: 942
Reverse (728,22)GCAATTCTTCTCCAGTAAGCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAA
GAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)113616 - 728
Exon 4 To Exon 5 (Pair 60)
Forward (641,23)TGCTGTGCTGTTTACAGAATTCAAmplicon SizecDNA: 79 bpgenomic: 908
Reverse (719,22)CTCCAGTAAGCCAGGAAATATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.138 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGAT
ATTTCCTGGCTTACTGGAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)79641 - 719
Exon 4 To Exon 5 (Pair 61)
Forward (616,22)GATGATGAGAGGTCTAATCCCAAmplicon SizecDNA: 119 bpgenomic: 948
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAA
GAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)119616 - 734
Exon 4 To Exon 5 (Pair 62)
Forward (611,22)GCACTGATGATGAGAGGTCTAAAmplicon SizecDNA: 130 bpgenomic: 959
Reverse (740,23)ACACTTCCACATGCAATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGA
GAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCAT
GTGGAAGTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)130611 - 740
Exon 4 To Exon 5 (Pair 63)
Forward (644,23)TGTGCTGTTTACAGAATTCAGGAAmplicon SizecDNA: 90 bpgenomic: 919
Reverse (733,23)CACATGCAATTCTTCTCCAGTAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATT
TCCTGGCTTACTGGAGAAGAATTGCATGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)90644 - 733
Exon 4 To Exon 5 (Pair 64)
Forward (615,22)TGATGATGAGAGGTCTAATCCCAmplicon SizecDNA: 115 bpgenomic: 944
Reverse (729,22)TGCAATTCTTCTCCAGTAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGA
AGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)115615 - 729
Exon 4 To Exon 5 (Pair 65)
Forward (618,22)TGATGAGAGGTCTAATCCCAGAAmplicon SizecDNA: 123 bpgenomic: 952
Reverse (740,23)ACACTTCCACATGCAATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGA
AACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAG
TGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)123618 - 740
Exon 4 To Exon 5 (Pair 66)
Forward (645,23)GTGCTGTTTACAGAATTCAGGATAmplicon SizecDNA: 88 bpgenomic: 917
Reverse (732,23)ACATGCAATTCTTCTCCAGTAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTT
CCTGGCTTACTGGAGAAGAATTGCATGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)88645 - 732
Exon 4 To Exon 5 (Pair 67)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 114 bpgenomic: 943
Reverse (727,22)CAATTCTTCTCCAGTAAGCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)114614 - 727
Exon 4 To Exon 5 (Pair 68)
Forward (610,22)AGCACTGATGATGAGAGGTCTAAmplicon SizecDNA: 119 bpgenomic: 948
Reverse (728,22)GCAATTCTTCTCCAGTAAGCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-2.475 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGG
AGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)119610 - 728
Exon 4 To Exon 5 (Pair 69)
Forward (610,22)AGCACTGATGATGAGAGGTCTAAmplicon SizecDNA: 117 bpgenomic: 946
Reverse (726,22)AATTCTTCTCCAGTAAGCCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops2.107 kcal/mol in 3' area
Reverse Dimers-0.128 kcal/mol
Forward-Reverse Dimers-2.475 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGG
AGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)117610 - 726
Exon 4 To Exon 5 (Pair 70)
Forward (644,23)TGTGCTGTTTACAGAATTCAGGAAmplicon SizecDNA: 91 bpgenomic: 920
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATT
TCCTGGCTTACTGGAGAAGAATTGCATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)91644 - 734
Exon 4 To Exon 5 (Pair 71)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 122 bpgenomic: 951
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
GA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)122614 - 735
Exon 4 To Exon 5 (Pair 72)
Forward (615,22)TGATGATGAGAGGTCTAATCCCAmplicon SizecDNA: 107 bpgenomic: 936
Reverse (721,23)TTCTCCAGTAAGCCAGGAAATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGA
AGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)107615 - 721
Exon 4 To Exon 5 (Pair 73)
Forward (641,23)TGCTGTGCTGTTTACAGAATTCAAmplicon SizecDNA: 81 bpgenomic: 910
Reverse (721,23)TTCTCCAGTAAGCCAGGAAATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.138 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGAT
ATTTCCTGGCTTACTGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)81641 - 721
Exon 4 To Exon 5 (Pair 74)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 84 bpgenomic: 913
Reverse (729,22)TGCAATTCTTCTCCAGTAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAGAAGAATTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)84646 - 729
Exon 4 To Exon 5 (Pair 75)
Forward (617,22)ATGATGAGAGGTCTAATCCCAGAmplicon SizecDNA: 111 bpgenomic: 940
Reverse (727,22)CAATTCTTCTCCAGTAAGCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)111617 - 727
Exon 4 To Exon 5 (Pair 76)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 129 bpgenomic: 958
Reverse (742,23)CAACACTTCCACATGCAATTCTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol in 3' area
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
GAAGTGTTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)129614 - 742
Exon 4 To Exon 5 (Pair 77)
Forward (610,22)AGCACTGATGATGAGAGGTCTAAmplicon SizecDNA: 112 bpgenomic: 941
Reverse (721,23)TTCTCCAGTAAGCCAGGAAATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.475 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGG
AGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)112610 - 721
Exon 4 To Exon 5 (Pair 78)
Forward (645,23)GTGCTGTTTACAGAATTCAGGATAmplicon SizecDNA: 108 bpgenomic: 937
Reverse (752,22)GAACATTCTCCAACACTTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.857 kcal/mol in 3' area
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-2.401 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTT
CCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGAATGTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)108645 - 752
Exon 4 To Exon 5 (Pair 79)
Forward (580,21)TGGAGTTACAGTCCGAGACAGAmplicon SizecDNA: 131 bpgenomic: 960
Reverse (710,21)GCCAGGAAATATCAGTGTCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.286 kcal/mol in 3' area
Forward Dimers-0.996 kcal/mol
Reverse Loops1.721 kcal/mol in 3' area
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.427 kcal/mol
Amplicon Folding-1.056 kcal/mol outside primersite
Amplicon SequenceTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGA
GTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGA
TATTTCCTGGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)131580 - 710
Exon 4 To Exon 5 (Pair 80)
Forward (615,22)TGATGATGAGAGGTCTAATCCCAmplicon SizecDNA: 114 bpgenomic: 943
Reverse (728,22)GCAATTCTTCTCCAGTAAGCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGA
AGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)114615 - 728
Exon 4 To Exon 5 (Pair 81)
Forward (617,22)ATGATGAGAGGTCTAATCCCAGAmplicon SizecDNA: 110 bpgenomic: 939
Reverse (726,22)AATTCTTCTCCAGTAAGCCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops2.107 kcal/mol in 3' area
Reverse Dimers-0.128 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)110617 - 726
Exon 4 To Exon 5 (Pair 82)
Forward (646,23)TGCTGTTTACAGAATTCAGGATGAmplicon SizecDNA: 89 bpgenomic: 918
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTC
CTGGCTTACTGGAGAAGAATTGCATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)89646 - 734
Exon 4 To Exon 5 (Pair 83)
Forward (617,22)ATGATGAGAGGTCTAATCCCAGAmplicon SizecDNA: 118 bpgenomic: 947
Reverse (734,22)CCACATGCAATTCTTCTCCAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)118617 - 734
Exon 4 To Exon 5 (Pair 84)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 128 bpgenomic: 957
Reverse (741,23)AACACTTCCACATGCAATTCTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTG
GAAGTGTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)128614 - 741
Exon 4 To Exon 5 (Pair 85)
Forward (618,22)TGATGAGAGGTCTAATCCCAGAAmplicon SizecDNA: 120 bpgenomic: 949
Reverse (737,22)CTTCCACATGCAATTCTTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGA
AACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)120618 - 737
Exon 4 To Exon 5 (Pair 86)
Forward (617,22)ATGATGAGAGGTCTAATCCCAGAmplicon SizecDNA: 124 bpgenomic: 953
Reverse (740,23)ACACTTCCACATGCAATTCTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAA
GTGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)124617 - 740
Exon 4 To Exon 5 (Pair 87)
Forward (644,23)TGTGCTGTTTACAGAATTCAGGAAmplicon SizecDNA: 83 bpgenomic: 912
Reverse (726,22)AATTCTTCTCCAGTAAGCCAGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops2.107 kcal/mol in 3' area
Reverse Dimers-0.128 kcal/mol
Forward-Reverse Dimers-2.464 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATT
TCCTGGCTTACTGGAGAAGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)83644 - 726
Exon 4 To Exon 5 (Pair 88)
Forward (641,23)TGCTGTGCTGTTTACAGAATTCAAmplicon SizecDNA: 75 bpgenomic: 904
Reverse (715,23)AGTAAGCCAGGAAATATCAGTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.138 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGAT
ATTTCCTGGCTTACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)75641 - 715
Exon 4 To Exon 5 (Pair 89)
Forward (618,22)TGATGAGAGGTCTAATCCCAGAAmplicon SizecDNA: 118 bpgenomic: 947
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGA
AACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)118618 - 735
Exon 4 To Exon 5 (Pair 90)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 99 bpgenomic: 928
Reverse (712,22)AAGCCAGGAAATATCAGTGTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.423 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)99614 - 712
Exon 4 To Exon 5 (Pair 91)
Forward (610,22)AGCACTGATGATGAGAGGTCTAAmplicon SizecDNA: 126 bpgenomic: 955
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.614 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGG
AGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCA
TGTGGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)126610 - 735
Exon 4 To Exon 5 (Pair 92)
Forward (645,23)GTGCTGTTTACAGAATTCAGGATAmplicon SizecDNA: 110 bpgenomic: 939
Reverse (754,22)TGGAACATTCTCCAACACTTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops0.767 kcal/mol
Reverse Dimers-0.969 kcal/mol
Forward-Reverse Dimers-2.401 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTT
CCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGAATGTTCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)110645 - 754
Exon 4 To Exon 5 (Pair 93)
Forward (644,23)TGTGCTGTTTACAGAATTCAGGAAmplicon SizecDNA: 78 bpgenomic: 907
Reverse (721,23)TTCTCCAGTAAGCCAGGAAATATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.296 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATT
TCCTGGCTTACTGGAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)78644 - 721
Exon 4 To Exon 5 (Pair 94)
Forward (615,22)TGATGATGAGAGGTCTAATCCCAmplicon SizecDNA: 121 bpgenomic: 950
Reverse (735,22)TCCACATGCAATTCTTCTCCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGA
AGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
A
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)121615 - 735
Exon 4 To Exon 5 (Pair 95)
Forward (644,23)TGTGCTGTTTACAGAATTCAGGAAmplicon SizecDNA: 86 bpgenomic: 915
Reverse (729,22)TGCAATTCTTCTCCAGTAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATT
TCCTGGCTTACTGGAGAAGAATTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)86644 - 729
Exon 4 To Exon 5 (Pair 96)
Forward (615,22)TGATGATGAGAGGTCTAATCCCAmplicon SizecDNA: 123 bpgenomic: 952
Reverse (737,22)CTTCCACATGCAATTCTTCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.195 kcal/mol
Reverse Dimers-1.814 kcal/mol
Forward-Reverse Dimers-1.584 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGA
AGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGG
AAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)123615 - 737
Exon 4 To Exon 5 (Pair 97)
Forward (645,23)GTGCTGTTTACAGAATTCAGGATAmplicon SizecDNA: 84 bpgenomic: 913
Reverse (728,22)GCAATTCTTCTCCAGTAAGCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.308 kcal/mol
Forward Dimers-2.392 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-2.846 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTT
CCTGGCTTACTGGAGAAGAATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)84645 - 728
Exon 4 To Exon 5 (Pair 98)
Forward (617,22)ATGATGAGAGGTCTAATCCCAGAmplicon SizecDNA: 112 bpgenomic: 941
Reverse (728,22)GCAATTCTTCTCCAGTAAGCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-0.892 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAG
AAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)112617 - 728
Exon 4 To Exon 5 (Pair 99)
Forward (614,22)CTGATGATGAGAGGTCTAATCCAmplicon SizecDNA: 116 bpgenomic: 945
Reverse (729,22)TGCAATTCTTCTCCAGTAAGCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.263 kcal/mol
Forward Dimers-0.444 kcal/mol
Reverse Loops1.857 kcal/mol
Reverse Dimers-1.212 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceCTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAG
AAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)116614 - 729
Exon 4 To Exon 5 (Pair 100)
Forward (611,22)GCACTGATGATGAGAGGTCTAAAmplicon SizecDNA: 107 bpgenomic: 936
Reverse (717,22)CCAGTAAGCCAGGAAATATCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.21 kcal/mol
Forward Dimers-0.627 kcal/mol
Reverse Loops1.601 kcal/mol
Reverse Dimers-1.364 kcal/mol
Forward-Reverse Dimers-2.475 kcal/mol
Amplicon Folding-0.582 kcal/mol outside primersite
Amplicon SequenceGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGA
GAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_004333 (BRAF)107611 - 717
 

See below for some more details.

Program Output:

Loading ...