Design Results for cftr

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size400Maximal Amplicon Size600
Natrium Concentration0.5 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 8 To Exon 12 (Pair 1)
Forward (1204,23)GTACAAACATGGTATGACTCTCTAmplicon SizecDNA: 592 bpgenomic: 47,516
Reverse (1795,21)TTGCTCGTTGACCTCCACTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAG
CAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTA
ACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAAC
AATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGT
ACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCT
GGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCT
TCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATT
ATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATAC
AGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGAC
AATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5921204 - 1795
Exon 8 To Exon 12 (Pair 2)
Forward (1208,23)AAACATGGTATGACTCTCTTGGAAmplicon SizecDNA: 591 bpgenomic: 47,515
Reverse (1798,21)TTCTTGCTCGTTGACCTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAG
AATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAG
CCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATA
GAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTC
CTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGAT
CCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAG
AGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGC
CTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAA
GCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATA
TAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5911208 - 1798
Exon 8 To Exon 12 (Pair 3)
Forward (1202,23)CTGTACAAACATGGTATGACTCTAmplicon SizecDNA: 592 bpgenomic: 47,516
Reverse (1793,20)GCTCGTTGACCTCCACTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol
Reverse Dimers0.085 kcal/mol in 3' area
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAA
AGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATG
TAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATA
ACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTG
GTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTG
CTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGC
CTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGA
TTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGAT
ACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAG
ACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5921202 - 1793
Exon 8 To Exon 12 (Pair 4)
Forward (1203,23)TGTACAAACATGGTATGACTCTCAmplicon SizecDNA: 595 bpgenomic: 47,519
Reverse (1797,21)TCTTGCTCGTTGACCTCCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAA
GCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGT
AACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAA
CAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGG
TACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGC
TGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCC
TTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT
TATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATA
CAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGA
CAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5951203 - 1797
Exon 8 To Exon 12 (Pair 5)
Forward (1208,23)AAACATGGTATGACTCTCTTGGAAmplicon SizecDNA: 588 bpgenomic: 47,512
Reverse (1795,21)TTGCTCGTTGACCTCCACTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAG
AATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAG
CCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATA
GAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTC
CTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGAT
CCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAG
AGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGC
CTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAA
GCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATA
TAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5881208 - 1795
Exon 8 To Exon 12 (Pair 6)
Forward (1204,23)GTACAAACATGGTATGACTCTCTAmplicon SizecDNA: 595 bpgenomic: 47,519
Reverse (1798,21)TTCTTGCTCGTTGACCTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAG
CAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTA
ACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAAC
AATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGT
ACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCT
GGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCT
TCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATT
ATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATAC
AGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGAC
AATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5951204 - 1798
Exon 8 To Exon 12 (Pair 7)
Forward (1202,23)CTGTACAAACATGGTATGACTCTAmplicon SizecDNA: 596 bpgenomic: 47,520
Reverse (1797,21)TCTTGCTCGTTGACCTCCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAA
AGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATG
TAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATA
ACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTG
GTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTG
CTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGC
CTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGA
TTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGAT
ACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAG
ACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5961202 - 1797
Exon 8 To Exon 12 (Pair 8)
Forward (1206,23)ACAAACATGGTATGACTCTCTTGAmplicon SizecDNA: 588 bpgenomic: 47,512
Reverse (1793,20)GCTCGTTGACCTCCACTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol
Reverse Dimers0.085 kcal/mol in 3' area
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCA
AGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAAC
AGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAA
TAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTAC
TCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGG
ATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTC
AGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTAT
GCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAG
AAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAA
TATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5881206 - 1793
Exon 8 To Exon 12 (Pair 9)
Forward (1203,23)TGTACAAACATGGTATGACTCTCAmplicon SizecDNA: 591 bpgenomic: 47,515
Reverse (1793,20)GCTCGTTGACCTCCACTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol
Reverse Dimers0.085 kcal/mol in 3' area
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAA
GCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGT
AACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAA
CAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGG
TACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGC
TGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCC
TTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT
TATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATA
CAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGA
CAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5911203 - 1793
Exon 8 To Exon 12 (Pair 10)
Forward (1200,22)GGCTGTACAAACATGGTATGACAmplicon SizecDNA: 596 bpgenomic: 47,520
Reverse (1795,21)TTGCTCGTTGACCTCCACTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol in 3' area
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACA
AAAGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAA
TGTAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAA
TAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCT
TGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGT
TGCTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGA
GCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTG
GATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAG
ATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAA
AGACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5961200 - 1795
Exon 8 To Exon 12 (Pair 11)
Forward (1206,23)ACAAACATGGTATGACTCTCTTGAmplicon SizecDNA: 593 bpgenomic: 47,517
Reverse (1798,21)TTCTTGCTCGTTGACCTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCA
AGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAAC
AGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAA
TAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTAC
TCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGG
ATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTC
AGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTAT
GCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAG
AAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAA
TATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5931206 - 1798
Exon 8 To Exon 12 (Pair 12)
Forward (1202,23)CTGTACAAACATGGTATGACTCTAmplicon SizecDNA: 594 bpgenomic: 47,518
Reverse (1795,21)TTGCTCGTTGACCTCCACTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAA
AGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATG
TAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATA
ACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTG
GTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTG
CTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGC
CTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGA
TTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGAT
ACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAG
ACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5941202 - 1795
Exon 8 To Exon 12 (Pair 13)
Forward (1208,23)AAACATGGTATGACTCTCTTGGAAmplicon SizecDNA: 590 bpgenomic: 47,514
Reverse (1797,21)TCTTGCTCGTTGACCTCCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAG
AATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAG
CCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATA
GAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTC
CTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGAT
CCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAG
AGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGC
CTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAA
GCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATA
TAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5901208 - 1797
Exon 8 To Exon 12 (Pair 14)
Forward (1202,23)CTGTACAAACATGGTATGACTCTAmplicon SizecDNA: 597 bpgenomic: 47,521
Reverse (1798,21)TTCTTGCTCGTTGACCTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAA
AGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATG
TAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATA
ACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTG
GTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTG
CTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGC
CTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGA
TTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGAT
ACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAG
ACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5971202 - 1798
Exon 8 To Exon 12 (Pair 15)
Forward (1208,23)AAACATGGTATGACTCTCTTGGAAmplicon SizecDNA: 586 bpgenomic: 47,510
Reverse (1793,20)GCTCGTTGACCTCCACTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol
Reverse Dimers0.085 kcal/mol in 3' area
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAG
AATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAG
CCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATA
GAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTC
CTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGAT
CCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAG
AGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGC
CTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAA
GCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATA
TAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5861208 - 1793
Exon 8 To Exon 12 (Pair 16)
Forward (1206,23)ACAAACATGGTATGACTCTCTTGAmplicon SizecDNA: 592 bpgenomic: 47,516
Reverse (1797,21)TCTTGCTCGTTGACCTCCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCA
AGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAAC
AGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAA
TAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTAC
TCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGG
ATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTC
AGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTAT
GCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAG
AAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAA
TATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5921206 - 1797
Exon 8 To Exon 12 (Pair 17)
Forward (1217,23)ATGACTCTCTTGGAGCAATAAACAmplicon SizecDNA: 577 bpgenomic: 47,501
Reverse (1793,20)GCTCGTTGACCTCCACTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.672 kcal/mol
Forward Dimers-0.677 kcal/mol
Reverse Loops1.938 kcal/mol
Reverse Dimers0.085 kcal/mol in 3' area
Forward-Reverse Dimers-2.444 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAGAATATAAGA
CATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGG
AGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTT
CTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGA
AAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAG
CAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAA
TTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCA
TTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCA
AAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTG
GAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5771217 - 1793
Exon 8 To Exon 12 (Pair 18)
Forward (1203,23)TGTACAAACATGGTATGACTCTCAmplicon SizecDNA: 593 bpgenomic: 47,517
Reverse (1795,21)TTGCTCGTTGACCTCCACTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAA
GCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGT
AACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAA
CAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGG
TACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGC
TGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCC
TTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT
TATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATA
CAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGA
CAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5931203 - 1795
Exon 8 To Exon 12 (Pair 19)
Forward (1204,23)GTACAAACATGGTATGACTCTCTAmplicon SizecDNA: 594 bpgenomic: 47,518
Reverse (1797,21)TCTTGCTCGTTGACCTCCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAG
CAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTA
ACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAAC
AATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGT
ACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCT
GGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCT
TCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATT
ATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATAC
AGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGAC
AATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5941204 - 1797
Exon 8 To Exon 12 (Pair 20)
Forward (1204,23)GTACAAACATGGTATGACTCTCTAmplicon SizecDNA: 590 bpgenomic: 47,514
Reverse (1793,20)GCTCGTTGACCTCCACTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol
Reverse Dimers0.085 kcal/mol in 3' area
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAG
CAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTA
ACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAAC
AATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGT
ACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCT
GGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCT
TCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATT
ATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATAC
AGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGAC
AATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5901204 - 1793
Exon 8 To Exon 12 (Pair 21)
Forward (1203,23)TGTACAAACATGGTATGACTCTCAmplicon SizecDNA: 596 bpgenomic: 47,520
Reverse (1798,21)TTCTTGCTCGTTGACCTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAA
GCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGT
AACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAA
CAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGG
TACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGC
TGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCC
TTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT
TATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATA
CAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGA
CAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5961203 - 1798
Exon 8 To Exon 12 (Pair 22)
Forward (1200,22)GGCTGTACAAACATGGTATGACAmplicon SizecDNA: 594 bpgenomic: 47,518
Reverse (1793,20)GCTCGTTGACCTCCACTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol in 3' area
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol
Reverse Dimers0.085 kcal/mol in 3' area
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACA
AAAGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAA
TGTAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAA
TAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCT
TGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGT
TGCTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGA
GCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTG
GATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAG
ATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAA
AGACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5941200 - 1793
Exon 8 To Exon 12 (Pair 23)
Forward (1219,23)GACTCTCTTGGAGCAATAAACAAAmplicon SizecDNA: 575 bpgenomic: 47,499
Reverse (1793,20)GCTCGTTGACCTCCACTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.672 kcal/mol
Forward Dimers-0.677 kcal/mol
Reverse Loops1.938 kcal/mol
Reverse Dimers0.085 kcal/mol in 3' area
Forward-Reverse Dimers-2.444 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAGAATATAAGACA
TTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAG
GAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTTCT
AATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAA
GATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCA
GGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATT
AAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATT
AAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAA
GCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGA
GAAGGTGGAATCACACTGAGTGGAGGTCAACGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5751219 - 1793
Exon 8 To Exon 12 (Pair 24)
Forward (1218,23)TGACTCTCTTGGAGCAATAAACAAmplicon SizecDNA: 576 bpgenomic: 47,500
Reverse (1793,20)GCTCGTTGACCTCCACTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.672 kcal/mol
Forward Dimers-0.677 kcal/mol
Reverse Loops1.938 kcal/mol
Reverse Dimers0.085 kcal/mol in 3' area
Forward-Reverse Dimers-2.444 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceTGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAGAATATAAGAC
ATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGA
GGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTTC
TAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAA
AGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGC
AGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAAT
TAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCAT
TAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAA
AGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGG
AGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5761218 - 1793
Exon 8 To Exon 12 (Pair 25)
Forward (1206,23)ACAAACATGGTATGACTCTCTTGAmplicon SizecDNA: 590 bpgenomic: 47,514
Reverse (1795,21)TTGCTCGTTGACCTCCACTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCA
AGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAAC
AGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAA
TAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTAC
TCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGG
ATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTC
AGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTAT
GCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAG
AAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAA
TATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5901206 - 1795
Exon 8 To Exon 12 (Pair 26)
Forward (1200,22)GGCTGTACAAACATGGTATGACAmplicon SizecDNA: 598 bpgenomic: 47,522
Reverse (1797,21)TCTTGCTCGTTGACCTCCACTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol in 3' area
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACA
AAAGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAA
TGTAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAA
TAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCT
TGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGT
TGCTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGA
GCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTG
GATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAG
ATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAA
AGACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5981200 - 1797
Exon 8 To Exon 12 (Pair 27)
Forward (1200,22)GGCTGTACAAACATGGTATGACAmplicon SizecDNA: 599 bpgenomic: 47,523
Reverse (1798,21)TTCTTGCTCGTTGACCTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol in 3' area
Forward Dimers-1.571 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACA
AAAGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAA
TGTAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAA
TAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCT
TGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGT
TGCTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGA
GCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTG
GATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAG
ATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAA
AGACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5991200 - 1798
Exon 8 To Exon 12 (Pair 28)
Forward (1215,23)GTATGACTCTCTTGGAGCAATAAAmplicon SizecDNA: 579 bpgenomic: 47,503
Reverse (1793,20)GCTCGTTGACCTCCACTCAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.672 kcal/mol
Forward Dimers-0.677 kcal/mol
Reverse Loops1.938 kcal/mol
Reverse Dimers0.085 kcal/mol in 3' area
Forward-Reverse Dimers-2.444 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAGCAAGAATATAA
GACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTG
GGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAAC
TTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCT
GAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGG
AGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAA
AATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCAC
CATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCAT
CAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCT
TGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5791215 - 1793
Exon 9 To Exon 12 (Pair 1)
Forward (1303,23)GAAGTAGTGATGGAGAATGTAACAmplicon SizecDNA: 502 bpgenomic: 45,757
Reverse (1804,23)AAGAAATTCTTGCTCGTTGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.45 kcal/mol
Forward Dimers-0.047 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-2.729 kcal/mol
Forward-Reverse Dimers-2.63 kcal/mol
Amplicon Folding-1.668 kcal/mol outside primersite
Amplicon SequenceGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAG
AAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTC
AGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGA
GGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTG
ATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTC
TGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTT
TCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATC
TCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGA
GGTCAACGAGCAAGAATTTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5021303 - 1804
Exon 9 To Exon 12 (Pair 2)
Forward (1303,23)GAAGTAGTGATGGAGAATGTAACAmplicon SizecDNA: 500 bpgenomic: 45,755
Reverse (1802,22)GAAATTCTTGCTCGTTGACCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.45 kcal/mol
Forward Dimers-0.047 kcal/mol
Reverse Loops1.871 kcal/mol
Reverse Dimers-1.181 kcal/mol
Forward-Reverse Dimers-2.63 kcal/mol
Amplicon Folding-1.668 kcal/mol outside primersite
Amplicon SequenceGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAG
AAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTC
AGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGA
GGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTG
ATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTC
TGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTT
TCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATC
TCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGA
GGTCAACGAGCAAGAATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5001303 - 1802
Exon 9 To Exon 12 (Pair 3)
Forward (1303,23)GAAGTAGTGATGGAGAATGTAACAmplicon SizecDNA: 499 bpgenomic: 45,754
Reverse (1801,22)AAATTCTTGCTCGTTGACCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.45 kcal/mol
Forward Dimers-0.047 kcal/mol
Reverse Loops1.871 kcal/mol
Reverse Dimers-1.181 kcal/mol
Forward-Reverse Dimers-2.63 kcal/mol
Amplicon Folding-1.668 kcal/mol outside primersite
Amplicon SequenceGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAG
AAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTC
AGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGA
GGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTG
ATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTC
TGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTT
TCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATC
TCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGA
GGTCAACGAGCAAGAATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4991303 - 1801
Exon 10 To Exon 12 (Pair 1)
Forward (1402,21)GGTGATGACAGCCTCTTCTTCAmplicon SizecDNA: 403 bpgenomic: 39,126
Reverse (1804,23)AAGAAATTCTTGCTCGTTGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.787 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-2.729 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGAT
ATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGC
AAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAG
CACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAA
GAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCA
TGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAA
GGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4031402 - 1804
Exon 10 To Exon 12 (Pair 2)
Forward (1397,22)CTAATGGTGATGACAGCCTCTTAmplicon SizecDNA: 405 bpgenomic: 39,128
Reverse (1801,22)AAATTCTTGCTCGTTGACCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.871 kcal/mol
Reverse Dimers-1.181 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGA
AAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAG
CAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAA
TTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCA
TTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCA
AAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTG
GAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4051397 - 1801
Exon 10 To Exon 12 (Pair 3)
Forward (1399,22)AATGGTGATGACAGCCTCTTCTAmplicon SizecDNA: 406 bpgenomic: 39,129
Reverse (1804,23)AAGAAATTCTTGCTCGTTGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-2.729 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAA
GATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCA
GGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATT
AAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATT
AAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAA
GCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGA
GAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4061399 - 1804
Exon 10 To Exon 12 (Pair 4)
Forward (1400,22)ATGGTGATGACAGCCTCTTCTTAmplicon SizecDNA: 405 bpgenomic: 39,128
Reverse (1804,23)AAGAAATTCTTGCTCGTTGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-2.729 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAG
ATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAG
GCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTA
AGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTA
AAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAG
CATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAG
AAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4051400 - 1804
Exon 10 To Exon 12 (Pair 5)
Forward (1399,22)AATGGTGATGACAGCCTCTTCTAmplicon SizecDNA: 402 bpgenomic: 39,125
Reverse (1800,22)AATTCTTGCTCGTTGACCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.98 kcal/mol in 3' area
Reverse Dimers-0.221 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAA
GATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCA
GGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATT
AAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATT
AAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAA
GCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGA
GAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4021399 - 1800
Exon 10 To Exon 12 (Pair 6)
Forward (1397,22)CTAATGGTGATGACAGCCTCTTAmplicon SizecDNA: 406 bpgenomic: 39,129
Reverse (1802,22)GAAATTCTTGCTCGTTGACCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.871 kcal/mol
Reverse Dimers-1.181 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGA
AAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAG
CAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAA
TTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCA
TTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCA
AAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTG
GAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4061397 - 1802
Exon 10 To Exon 12 (Pair 7)
Forward (1398,22)TAATGGTGATGACAGCCTCTTCAmplicon SizecDNA: 404 bpgenomic: 39,127
Reverse (1801,22)AAATTCTTGCTCGTTGACCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.871 kcal/mol
Reverse Dimers-1.181 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAA
AGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGC
AGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAAT
TAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCAT
TAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAA
AGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGG
AGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4041398 - 1801
Exon 10 To Exon 12 (Pair 8)
Forward (1399,22)AATGGTGATGACAGCCTCTTCTAmplicon SizecDNA: 404 bpgenomic: 39,127
Reverse (1802,22)GAAATTCTTGCTCGTTGACCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.871 kcal/mol
Reverse Dimers-1.181 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAA
GATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCA
GGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATT
AAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATT
AAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAA
GCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGA
GAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4041399 - 1802
Exon 10 To Exon 12 (Pair 9)
Forward (1398,22)TAATGGTGATGACAGCCTCTTCAmplicon SizecDNA: 407 bpgenomic: 39,130
Reverse (1804,23)AAGAAATTCTTGCTCGTTGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-2.729 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAA
AGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGC
AGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAAT
TAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCAT
TAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAA
AGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGG
AGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4071398 - 1804
Exon 10 To Exon 12 (Pair 10)
Forward (1398,22)TAATGGTGATGACAGCCTCTTCAmplicon SizecDNA: 403 bpgenomic: 39,126
Reverse (1800,22)AATTCTTGCTCGTTGACCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.98 kcal/mol in 3' area
Reverse Dimers-0.221 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAA
AGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGC
AGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAAT
TAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCAT
TAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAA
AGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGG
AGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4031398 - 1800
Exon 10 To Exon 12 (Pair 11)
Forward (1400,22)ATGGTGATGACAGCCTCTTCTTAmplicon SizecDNA: 403 bpgenomic: 39,126
Reverse (1802,22)GAAATTCTTGCTCGTTGACCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.871 kcal/mol
Reverse Dimers-1.181 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAG
ATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAG
GCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTA
AGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTA
AAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAG
CATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAG
AAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4031400 - 1802
Exon 10 To Exon 12 (Pair 12)
Forward (1397,22)CTAATGGTGATGACAGCCTCTTAmplicon SizecDNA: 408 bpgenomic: 39,131
Reverse (1804,23)AAGAAATTCTTGCTCGTTGACCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops0.905 kcal/mol
Reverse Dimers-2.729 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGA
AAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAG
CAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAA
TTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCA
TTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCA
AAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTG
GAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4081397 - 1804
Exon 10 To Exon 12 (Pair 13)
Forward (1397,22)CTAATGGTGATGACAGCCTCTTAmplicon SizecDNA: 402 bpgenomic: 39,125
Reverse (1798,21)TTCTTGCTCGTTGACCTCCACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGA
AAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAG
CAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAA
TTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCA
TTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCA
AAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTG
GAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4021397 - 1798
Exon 10 To Exon 12 (Pair 14)
Forward (1397,22)CTAATGGTGATGACAGCCTCTTAmplicon SizecDNA: 404 bpgenomic: 39,127
Reverse (1800,22)AATTCTTGCTCGTTGACCTCCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.98 kcal/mol in 3' area
Reverse Dimers-0.221 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGA
AAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAG
CAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAA
TTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCA
TTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCA
AAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTG
GAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4041397 - 1800
Exon 10 To Exon 12 (Pair 15)
Forward (1398,22)TAATGGTGATGACAGCCTCTTCAmplicon SizecDNA: 405 bpgenomic: 39,128
Reverse (1802,22)GAAATTCTTGCTCGTTGACCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.871 kcal/mol
Reverse Dimers-1.181 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAA
AGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGC
AGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAAT
TAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCAT
TAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAA
AGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGG
AGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4051398 - 1802
Exon 10 To Exon 12 (Pair 16)
Forward (1399,22)AATGGTGATGACAGCCTCTTCTAmplicon SizecDNA: 403 bpgenomic: 39,126
Reverse (1801,22)AAATTCTTGCTCGTTGACCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.871 kcal/mol
Reverse Dimers-1.181 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAA
GATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCA
GGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATT
AAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATT
AAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAA
GCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGA
GAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4031399 - 1801
Exon 10 To Exon 12 (Pair 17)
Forward (1400,22)ATGGTGATGACAGCCTCTTCTTAmplicon SizecDNA: 402 bpgenomic: 39,125
Reverse (1801,22)AAATTCTTGCTCGTTGACCTCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.726 kcal/mol
Forward Dimers-0.204 kcal/mol
Reverse Loops1.871 kcal/mol
Reverse Dimers-1.181 kcal/mol
Forward-Reverse Dimers-1.903 kcal/mol
Amplicon Folding-0.982 kcal/mol outside primersite
Amplicon SequenceATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAG
ATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAG
GCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTA
AGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTA
AAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAG
CATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAG
AAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAAGAATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4021400 - 1801
Exon 14 To Exon 18 (Pair 1)
Forward (2528,22)AGGCAAACTTGACTGAACTGGAAmplicon SizecDNA: 573 bpgenomic: 14,171
Reverse (3100,22)TAAGAGGCAGAAGGTCATCCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.138 kcal/mol
Forward Dimers-1.865 kcal/mol
Reverse Loops1.095 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGG
AAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGA
GCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCT
TAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGG
TTGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTA
GAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTT
ACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGC
ATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAG
CACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAG
ATATAGCAATTTTGGATGACCTTCTGCCTCTTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5732528 - 3100
Exon 14 To Exon 18 (Pair 2)
Forward (2528,22)AGGCAAACTTGACTGAACTGGAAmplicon SizecDNA: 579 bpgenomic: 14,177
Reverse (3106,22)ATATGGTAAGAGGCAGAAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.138 kcal/mol
Forward Dimers-1.865 kcal/mol
Reverse Loops1.97 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGG
AAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGA
GCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCT
TAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGG
TTGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTA
GAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTT
ACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGC
ATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAG
CACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAG
ATATAGCAATTTTGGATGACCTTCTGCCTCTTACCATAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5792528 - 3106
Exon 14 To Exon 18 (Pair 3)
Forward (2530,23)GCAAACTTGACTGAACTGGATATAmplicon SizecDNA: 577 bpgenomic: 14,175
Reverse (3106,22)ATATGGTAAGAGGCAGAAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol
Forward Dimers-0.251 kcal/mol
Reverse Loops1.97 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTAC
GTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCAT
ACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCA
CCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGAT
ATAGCAATTTTGGATGACCTTCTGCCTCTTACCATAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5772530 - 3106
Exon 14 To Exon 18 (Pair 4)
Forward (2542,24)GAACTGGATATATATTCAAGAAGGAmplicon SizecDNA: 561 bpgenomic: 14,159
Reverse (3102,21)GGTAAGAGGCAGAAGGTCATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.226 kcal/mol
Forward Dimers-1.693 kcal/mol
Reverse Loops1.58 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-1.558 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAAGTGAAGAA
ATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATACCAGCAGTG
ACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGTGCTA
ATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCTGTGGCTC
CTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACAGCTAT
GCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGTAGCC
GACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAATCACA
GTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCTATGTCAACC
CTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATAGCAATTTTG
GATGACCTTCTGCCTCTTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5612542 - 3102
Exon 14 To Exon 17 (Pair 1)
Forward (2409,20)CACGCTTCAGGCACGAAGGAAmplicon SizecDNA: 446 bpgenomic: 11,153
Reverse (2854,24)TGATAATCACTGCATAGCTGTTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.57 kcal/mol in 3' area
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCA
AGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCA
GGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTGATTATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5282415 - 2942
Exon 14 To Exon 18 (Pair 5)
Forward (2572,23)CAAGAAACTGGCTTGGAAATAAGAmplicon SizecDNA: 548 bpgenomic: 14,146
Reverse (3119,24)TGGATGAAGTCAAATATGGTAAGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.956 kcal/mol in 3' area
Forward Dimers-1.017 kcal/mol
Reverse Loops1.705 kcal/mol
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.873 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceCAAGAAACTGGCTTGGAAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTT
TTTGATGATATGGAGAGCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATT
ACTGTCCACAAGAGCTTAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAG
GTGGCTGCTTCTTTGGTTGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGG
AATAGTACTCATAGTAGAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTAT
TATGTGTTTTACATTTACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGA
GGTCTACCACTGGTGCATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTA
CATTCTGTTCTTCAAGCACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTT
AATAGATTCTCCAAAGATATAGCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGAC
TTCATCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5482572 - 3119
Exon 14 To Exon 17 (Pair 2)
Forward (2415,20)TCAGGCACGAAGGAGGCAGTAmplicon SizecDNA: 528 bpgenomic: 11,235
Reverse (2942,22)AGTGGTAGACCTCTGAAGAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.465 kcal/mol in 3' area
Forward Dimers-1.751 kcal/mol
Reverse Loops1.308 kcal/mol
Reverse Dimers-1.33 kcal/mol
Forward-Reverse Dimers-2.638 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGTCA
GAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCAAA
CTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAAG
TGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATACC
AGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTT
TGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCT
GTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAA
CAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGG
AGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5002409 - 2908
Exon 14 To Exon 17 (Pair 3)
Forward (2413,20)CTTCAGGCACGAAGGAGGCAAmplicon SizecDNA: 439 bpgenomic: 11,146
Reverse (2851,24)TAATCACTGCATAGCTGTTATTTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.373 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.57 kcal/mol
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGT
CAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCA
AACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATA
AGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATA
CCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATT
TTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTG
CTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAAT
AACAGCTATGCAGTGATTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5122414 - 2925
Exon 14 To Exon 17 (Pair 4)
Forward (2410,20)ACGCTTCAGGCACGAAGGAGAmplicon SizecDNA: 440 bpgenomic: 11,147
Reverse (2849,24)ATCACTGCATAGCTGTTATTTCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.57 kcal/mol
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAA
GGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAG
GCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5112410 - 2920
Exon 14 To Exon 17 (Pair 5)
Forward (2409,20)CACGCTTCAGGCACGAAGGAAmplicon SizecDNA: 435 bpgenomic: 11,142
Reverse (2843,24)GCATAGCTGTTATTTCTACTATGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.577 kcal/mol in 3' area
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCA
AGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCA
GGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5112415 - 2925
Exon 14 To Exon 18 (Pair 6)
Forward (2542,24)GAACTGGATATATATTCAAGAAGGAmplicon SizecDNA: 574 bpgenomic: 14,172
Reverse (3115,23)TGAAGTCAAATATGGTAAGAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.226 kcal/mol
Forward Dimers-1.693 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.873 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAAGTGAAGAA
ATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATACCAGCAGTG
ACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGTGCTA
ATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCTGTGGCTC
CTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACAGCTAT
GCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGTAGCC
GACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAATCACA
GTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCTATGTCAACC
CTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATAGCAATTTTG
GATGACCTTCTGCCTCTTACCATATTTGACTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5742542 - 3115
Exon 14 To Exon 18 (Pair 7)
Forward (2556,24)TTCAAGAAGGTTATCTCAAGAAACAmplicon SizecDNA: 549 bpgenomic: 14,147
Reverse (3104,22)ATGGTAAGAGGCAGAAGGTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.986 kcal/mol
Forward Dimers-0.711 kcal/mol
Reverse Loops1.58 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-1.103 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceTTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAAGTGAAGAAATTAACGAAGAAGA
CTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATACCAGCAGTGACTACATGGAACAC
ATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGTGCTAATTTGGTGCTTAGT
AATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCTGTGGCTCCTTGGAAACACTCC
TCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACAGCTATGCAGTGATTATCAC
CAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGTAGCCGACACTTTGCTTGC
TATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAATCACAGTGTCGAAAATTTT
ACACCACAAAATGTTACATTCTGTTCTTCAAGCACCTATGTCAACCCTCAACACGTTGAA
AGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATAGCAATTTTGGATGACCTTCTGCC
TCTTACCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5492556 - 3104
Exon 14 To Exon 17 (Pair 6)
Forward (2409,20)CACGCTTCAGGCACGAAGGAAmplicon SizecDNA: 500 bpgenomic: 11,207
Reverse (2908,20)AAGTGTCGGCTACTCCCACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.926 kcal/mol
Reverse Dimers-1.102 kcal/mol
Forward-Reverse Dimers-2.397 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCA
AGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCA
GGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTA
CGTGGGAGTAGCCGACACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4992410 - 2908
Exon 14 To Exon 17 (Pair 7)
Forward (2409,20)CACGCTTCAGGCACGAAGGAAmplicon SizecDNA: 439 bpgenomic: 11,146
Reverse (2847,23)CACTGCATAGCTGTTATTTCTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.57 kcal/mol
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCA
AGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCA
GGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5262414 - 2939
Exon 14 To Exon 17 (Pair 8)
Forward (2413,20)CTTCAGGCACGAAGGAGGCAAmplicon SizecDNA: 434 bpgenomic: 11,141
Reverse (2846,24)ACTGCATAGCTGTTATTTCTACTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.373 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops1.06 kcal/mol
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGT
CAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCA
AACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATA
AGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATA
CCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATT
TTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTG
CTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAAT
AACAGCTATGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5182410 - 2927
Exon 14 To Exon 18 (Pair 8)
Forward (2529,22)GGCAAACTTGACTGAACTGGATAmplicon SizecDNA: 573 bpgenomic: 14,171
Reverse (3101,21)GTAAGAGGCAGAAGGTCATCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol
Forward Dimers-0.603 kcal/mol
Reverse Loops1.533 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTA
CGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCA
TACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGC
ACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGA
TATAGCAATTTTGGATGACCTTCTGCCTCTTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5732529 - 3101
Exon 14 To Exon 18 (Pair 9)
Forward (2593,24)AGTGAAGAAATTAACGAAGAAGACAmplicon SizecDNA: 518 bpgenomic: 14,116
Reverse (3110,23)TCAAATATGGTAAGAGGCAGAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.595 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops1.833 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATA
CCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATT
TTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTG
CTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAAT
AACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTG
GGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACT
CTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCT
ATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATA
GCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5182593 - 3110
Exon 14 To Exon 17 (Pair 9)
Forward (2414,20)TTCAGGCACGAAGGAGGCAGAmplicon SizecDNA: 512 bpgenomic: 11,219
Reverse (2925,22)GAATCCCATAGCAAGCAAAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.465 kcal/mol in 3' area
Forward Dimers-1.751 kcal/mol
Reverse Loops1.955 kcal/mol
Reverse Dimers-0.677 kcal/mol
Forward-Reverse Dimers-1.112 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGTC
AGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCAA
ACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAA
GTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATAC
CAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTT
TTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGC
TGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATA
ACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGG
GAGTAGCCGACACTTTGCTTGCTATGGGATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4952409 - 2903
Exon 14 To Exon 18 (Pair 10)
Forward (2530,23)GCAAACTTGACTGAACTGGATATAmplicon SizecDNA: 573 bpgenomic: 14,171
Reverse (3102,21)GGTAAGAGGCAGAAGGTCATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol
Forward Dimers-0.251 kcal/mol
Reverse Loops1.58 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTAC
GTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCAT
ACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCA
CCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGAT
ATAGCAATTTTGGATGACCTTCTGCCTCTTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5732530 - 3102
Exon 14 To Exon 18 (Pair 11)
Forward (2529,22)GGCAAACTTGACTGAACTGGATAmplicon SizecDNA: 574 bpgenomic: 14,172
Reverse (3102,21)GGTAAGAGGCAGAAGGTCATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol
Forward Dimers-0.603 kcal/mol
Reverse Loops1.58 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTA
CGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCA
TACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGC
ACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGA
TATAGCAATTTTGGATGACCTTCTGCCTCTTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5742529 - 3102
Exon 14 To Exon 17 (Pair 10)
Forward (2410,20)ACGCTTCAGGCACGAAGGAGAmplicon SizecDNA: 511 bpgenomic: 11,218
Reverse (2920,21)CCATAGCAAGCAAAGTGTCGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops2.044 kcal/mol in 3' area
Reverse Dimers-0.677 kcal/mol
Forward-Reverse Dimers-2.459 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAA
GGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAG
GCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTAC
GTGGGAGTAGCCGACACTTTGCTTGCTATGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5252415 - 2939
Exon 14 To Exon 18 (Pair 12)
Forward (2538,24)GACTGAACTGGATATATATTCAAGAmplicon SizecDNA: 567 bpgenomic: 14,165
Reverse (3104,22)ATGGTAAGAGGCAGAAGGTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.226 kcal/mol
Forward Dimers-1.693 kcal/mol
Reverse Loops1.58 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAAGTGA
AGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATACCAGC
AGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGT
GCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCTGTG
GCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACAG
CTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGT
AGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAAT
CACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCTATGTC
AACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATAGCAAT
TTTGGATGACCTTCTGCCTCTTACCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5672538 - 3104
Exon 14 To Exon 17 (Pair 11)
Forward (2529,22)GGCAAACTTGACTGAACTGGATAmplicon SizecDNA: 415 bpgenomic: 11,122
Reverse (2943,22)CAGTGGTAGACCTCTGAAGAATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol
Forward Dimers-0.603 kcal/mol
Reverse Loops0.148 kcal/mol
Reverse Dimers-2.865 kcal/mol
Forward-Reverse Dimers-2.445 kcal/mol
Amplicon Folding-0.197 kcal/mol outside primersite
Amplicon SequenceGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTA
CGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5292415 - 2943
Exon 14 To Exon 17 (Pair 12)
Forward (2410,20)ACGCTTCAGGCACGAAGGAGAmplicon SizecDNA: 437 bpgenomic: 11,144
Reverse (2846,24)ACTGCATAGCTGTTATTTCTACTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops1.06 kcal/mol
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAA
GGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAG
GCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5172409 - 2925
Exon 14 To Exon 17 (Pair 13)
Forward (2528,22)AGGCAAACTTGACTGAACTGGAAmplicon SizecDNA: 409 bpgenomic: 11,116
Reverse (2936,22)AGACCTCTGAAGAATCCCATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.138 kcal/mol
Forward Dimers-1.865 kcal/mol
Reverse Loops1.58 kcal/mol
Reverse Dimers-0.476 kcal/mol
Forward-Reverse Dimers-1.652 kcal/mol
Amplicon Folding-0.197 kcal/mol outside primersite
Amplicon SequenceAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGG
AAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGA
GCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCT
TAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGG
TTGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTA
GAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTT
ACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5232414 - 2936
Exon 14 To Exon 17 (Pair 14)
Forward (2538,24)GACTGAACTGGATATATATTCAAGAmplicon SizecDNA: 405 bpgenomic: 11,112
Reverse (2942,22)AGTGGTAGACCTCTGAAGAATCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.226 kcal/mol
Forward Dimers-1.693 kcal/mol
Reverse Loops1.308 kcal/mol
Reverse Dimers-1.33 kcal/mol
Forward-Reverse Dimers-1.225 kcal/mol
Amplicon Folding-0.197 kcal/mol outside primersite
Amplicon SequenceGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAAGTGA
AGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATACCAGC
AGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGT
GCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCTGTG
GCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACAG
CTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGT
AGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5332410 - 2942
Exon 14 To Exon 17 (Pair 15)
Forward (2413,20)CTTCAGGCACGAAGGAGGCAAmplicon SizecDNA: 443 bpgenomic: 11,150
Reverse (2855,23)GTGATAATCACTGCATAGCTGTTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.373 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.57 kcal/mol in 3' area
Reverse Dimers-2.978 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGT
CAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCA
AACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATA
AGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATA
CCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATT
TTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTG
CTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAAT
AACAGCTATGCAGTGATTATCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5302414 - 2943
Exon 14 To Exon 17 (Pair 16)
Forward (2410,20)ACGCTTCAGGCACGAAGGAGAmplicon SizecDNA: 436 bpgenomic: 11,143
Reverse (2845,24)CTGCATAGCTGTTATTTCTACTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops1.628 kcal/mol
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAA
GGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAG
GCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4942409 - 2902
Exon 14 To Exon 18 (Pair 13)
Forward (2538,24)GACTGAACTGGATATATATTCAAGAmplicon SizecDNA: 571 bpgenomic: 14,169
Reverse (3108,23)AAATATGGTAAGAGGCAGAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.226 kcal/mol
Forward Dimers-1.693 kcal/mol
Reverse Loops1.97 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAAGTGA
AGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATACCAGC
AGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGT
GCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCTGTG
GCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACAG
CTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGT
AGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAAT
CACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCTATGTC
AACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATAGCAAT
TTTGGATGACCTTCTGCCTCTTACCATATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5712538 - 3108
Exon 14 To Exon 18 (Pair 14)
Forward (2581,24)GGCTTGGAAATAAGTGAAGAAATTAmplicon SizecDNA: 530 bpgenomic: 14,128
Reverse (3110,23)TCAAATATGGTAAGAGGCAGAAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.653 kcal/mol
Forward Dimers-1.024 kcal/mol
Reverse Loops1.833 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-1.15 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGGCTTGGAAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGAT
ATGGAGAGCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCAC
AAGAGCTTAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCT
TCTTTGGTTGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACT
CATAGTAGAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTT
TACATTTACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCA
CTGGTGCATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTT
CTTCAAGCACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTC
TCCAAAGATATAGCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5302581 - 3110
Exon 14 To Exon 17 (Pair 17)
Forward (2415,20)TCAGGCACGAAGGAGGCAGTAmplicon SizecDNA: 511 bpgenomic: 11,218
Reverse (2925,22)GAATCCCATAGCAAGCAAAGTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.465 kcal/mol in 3' area
Forward Dimers-1.751 kcal/mol
Reverse Loops1.955 kcal/mol
Reverse Dimers-0.677 kcal/mol
Forward-Reverse Dimers-1.112 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGTCA
GAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCAAA
CTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAAG
TGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATACC
AGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTT
TGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCT
GTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAA
CAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGG
AGTAGCCGACACTTTGCTTGCTATGGGATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5092415 - 2923
Exon 14 To Exon 17 (Pair 18)
Forward (2414,20)TTCAGGCACGAAGGAGGCAGAmplicon SizecDNA: 431 bpgenomic: 11,138
Reverse (2844,24)TGCATAGCTGTTATTTCTACTATGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.465 kcal/mol in 3' area
Forward Dimers-1.751 kcal/mol
Reverse Loops1.403 kcal/mol in 3' area
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGTC
AGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCAA
ACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAA
GTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATAC
CAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTT
TTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGC
TGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATA
ACAGCTATGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5252414 - 2938
Exon 14 To Exon 17 (Pair 19)
Forward (2410,20)ACGCTTCAGGCACGAAGGAGAmplicon SizecDNA: 445 bpgenomic: 11,152
Reverse (2854,24)TGATAATCACTGCATAGCTGTTATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.57 kcal/mol in 3' area
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAA
GGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAG
GCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGTGATTATCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5152413 - 2927
Exon 14 To Exon 17 (Pair 20)
Forward (2410,20)ACGCTTCAGGCACGAAGGAGAmplicon SizecDNA: 441 bpgenomic: 11,148
Reverse (2850,24)AATCACTGCATAGCTGTTATTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.57 kcal/mol
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAA
GGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAG
GCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGTGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4932409 - 2901
Exon 14 To Exon 17 (Pair 21)
Forward (2410,20)ACGCTTCAGGCACGAAGGAGAmplicon SizecDNA: 499 bpgenomic: 11,206
Reverse (2908,20)AAGTGTCGGCTACTCCCACGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.926 kcal/mol
Reverse Dimers-1.102 kcal/mol
Forward-Reverse Dimers-1.907 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAA
GGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAG
GCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTAC
GTGGGAGTAGCCGACACTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5142414 - 2927
Exon 14 To Exon 18 (Pair 15)
Forward (2593,24)AGTGAAGAAATTAACGAAGAAGACAmplicon SizecDNA: 523 bpgenomic: 14,121
Reverse (3115,23)TGAAGTCAAATATGGTAAGAGGCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.595 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops1.787 kcal/mol
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-1.03 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATA
CCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATT
TTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTG
CTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAAT
AACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTG
GGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACT
CTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCT
ATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATA
GCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGACTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5232593 - 3115
Exon 14 To Exon 18 (Pair 16)
Forward (2581,24)GGCTTGGAAATAAGTGAAGAAATTAmplicon SizecDNA: 525 bpgenomic: 14,123
Reverse (3105,22)TATGGTAAGAGGCAGAAGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.653 kcal/mol
Forward Dimers-1.024 kcal/mol
Reverse Loops1.58 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-1.15 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGGCTTGGAAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGAT
ATGGAGAGCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCAC
AAGAGCTTAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCT
TCTTTGGTTGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACT
CATAGTAGAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTT
TACATTTACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCA
CTGGTGCATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTT
CTTCAAGCACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTC
TCCAAAGATATAGCAATTTTGGATGACCTTCTGCCTCTTACCATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5252581 - 3105
Exon 14 To Exon 18 (Pair 17)
Forward (2528,22)AGGCAAACTTGACTGAACTGGAAmplicon SizecDNA: 577 bpgenomic: 14,175
Reverse (3104,22)ATGGTAAGAGGCAGAAGGTCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.138 kcal/mol
Forward Dimers-1.865 kcal/mol
Reverse Loops1.58 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGG
AAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGA
GCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCT
TAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGG
TTGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTA
GAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTT
ACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGC
ATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAG
CACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAG
ATATAGCAATTTTGGATGACCTTCTGCCTCTTACCAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5772528 - 3104
Exon 14 To Exon 17 (Pair 22)
Forward (2529,22)GGCAAACTTGACTGAACTGGATAmplicon SizecDNA: 410 bpgenomic: 11,117
Reverse (2938,22)GTAGACCTCTGAAGAATCCCATNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol
Forward Dimers-0.603 kcal/mol
Reverse Loops1.58 kcal/mol
Reverse Dimers-0.476 kcal/mol
Forward-Reverse Dimers-1.652 kcal/mol
Amplicon Folding-0.197 kcal/mol outside primersite
Amplicon SequenceGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTA
CGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5252414 - 2938
Exon 14 To Exon 17 (Pair 23)
Forward (2409,20)CACGCTTCAGGCACGAAGGAAmplicon SizecDNA: 438 bpgenomic: 11,145
Reverse (2846,24)ACTGCATAGCTGTTATTTCTACTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops1.06 kcal/mol
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCA
AGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCA
GGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5042410 - 2913
Exon 14 To Exon 17 (Pair 24)
Forward (2410,20)ACGCTTCAGGCACGAAGGAGAmplicon SizecDNA: 433 bpgenomic: 11,140
Reverse (2842,24)CATAGCTGTTATTTCTACTATGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.966 kcal/mol in 3' area
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAA
GGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAG
GCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5112413 - 2923
Exon 14 To Exon 17 (Pair 25)
Forward (2414,20)TTCAGGCACGAAGGAGGCAGAmplicon SizecDNA: 526 bpgenomic: 11,233
Reverse (2939,21)GGTAGACCTCTGAAGAATCCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.465 kcal/mol in 3' area
Forward Dimers-1.751 kcal/mol
Reverse Loops1.58 kcal/mol
Reverse Dimers-1.045 kcal/mol
Forward-Reverse Dimers-2.638 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGTC
AGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCAA
ACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAA
GTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATAC
CAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTT
TTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGC
TGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATA
ACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGG
GAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5292415 - 2943
Exon 14 To Exon 17 (Pair 26)
Forward (2409,20)CACGCTTCAGGCACGAAGGAAmplicon SizecDNA: 434 bpgenomic: 11,141
Reverse (2842,24)CATAGCTGTTATTTCTACTATGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.966 kcal/mol in 3' area
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCA
AGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCA
GGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5132415 - 2927
Exon 14 To Exon 18 (Pair 18)
Forward (2530,23)GCAAACTTGACTGAACTGGATATAmplicon SizecDNA: 572 bpgenomic: 14,170
Reverse (3101,21)GTAAGAGGCAGAAGGTCATCCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol
Forward Dimers-0.251 kcal/mol
Reverse Loops1.533 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTAC
GTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCAT
ACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCA
CCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGAT
ATAGCAATTTTGGATGACCTTCTGCCTCTTAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5722530 - 3101
Exon 14 To Exon 17 (Pair 27)
Forward (2410,20)ACGCTTCAGGCACGAAGGAGAmplicon SizecDNA: 430 bpgenomic: 11,137
Reverse (2839,24)AGCTGTTATTTCTACTATGAGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops1.144 kcal/mol in 3' area
Reverse Dimers-1.727 kcal/mol
Forward-Reverse Dimers-1.218 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAA
GGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAG
GCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5162410 - 2925
Exon 14 To Exon 18 (Pair 19)
Forward (2529,22)GGCAAACTTGACTGAACTGGATAmplicon SizecDNA: 572 bpgenomic: 14,170
Reverse (3100,22)TAAGAGGCAGAAGGTCATCCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol
Forward Dimers-0.603 kcal/mol
Reverse Loops1.095 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTA
CGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCA
TACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGC
ACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGA
TATAGCAATTTTGGATGACCTTCTGCCTCTTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5722529 - 3100
Exon 14 To Exon 17 (Pair 28)
Forward (2410,20)ACGCTTCAGGCACGAAGGAGAmplicon SizecDNA: 518 bpgenomic: 11,225
Reverse (2927,23)AAGAATCCCATAGCAAGCAAAGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops1.955 kcal/mol
Reverse Dimers-0.677 kcal/mol
Forward-Reverse Dimers-2.459 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAA
GGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAG
GCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTAC
GTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5052409 - 2913
Exon 14 To Exon 17 (Pair 29)
Forward (2413,20)CTTCAGGCACGAAGGAGGCAAmplicon SizecDNA: 438 bpgenomic: 11,145
Reverse (2850,24)AATCACTGCATAGCTGTTATTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.373 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.57 kcal/mol
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.385 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGT
CAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCA
AACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAAATA
AGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGCATA
CCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATT
TTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTG
CTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAAT
AACAGCTATGCAGTGATT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5292414 - 2942
Exon 14 To Exon 17 (Pair 30)
Forward (2409,20)CACGCTTCAGGCACGAAGGAAmplicon SizecDNA: 431 bpgenomic: 11,138
Reverse (2839,24)AGCTGTTATTTCTACTATGAGTACNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops1.144 kcal/mol in 3' area
Reverse Dimers-1.727 kcal/mol
Forward-Reverse Dimers-1.218 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCA
AGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCA
GGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5132413 - 2925
Exon 14 To Exon 17 (Pair 31)
Forward (2529,22)GGCAAACTTGACTGAACTGGATAmplicon SizecDNA: 408 bpgenomic: 11,115
Reverse (2936,22)AGACCTCTGAAGAATCCCATAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol
Forward Dimers-0.603 kcal/mol
Reverse Loops1.58 kcal/mol
Reverse Dimers-0.476 kcal/mol
Forward-Reverse Dimers-1.652 kcal/mol
Amplicon Folding-0.197 kcal/mol outside primersite
Amplicon SequenceGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTA
CGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5272410 - 2936
Exon 14 To Exon 18 (Pair 20)
Forward (2529,22)GGCAAACTTGACTGAACTGGATAmplicon SizecDNA: 577 bpgenomic: 14,175
Reverse (3105,22)TATGGTAAGAGGCAGAAGGTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol
Forward Dimers-0.603 kcal/mol
Reverse Loops1.58 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTA
CGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCA
TACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGC
ACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGA
TATAGCAATTTTGGATGACCTTCTGCCTCTTACCATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5772529 - 3105
Exon 14 To Exon 17 (Pair 32)
Forward (2409,20)CACGCTTCAGGCACGAAGGAAmplicon SizecDNA: 441 bpgenomic: 11,148
Reverse (2849,24)ATCACTGCATAGCTGTTATTTCTANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.835 kcal/mol
Forward Dimers-1.751 kcal/mol
Reverse Loops0.57 kcal/mol
Reverse Dimers-2.217 kcal/mol
Forward-Reverse Dimers-1.463 kcal/mol
Amplicon Folding-2.613 kcal/mol outside primersite
Amplicon SequenceCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCA
AGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCA
GGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGA
AATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAG
CATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTT
AATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGT
TGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAG
AAATAACAGCTATGCAGTGAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5102410 - 2919
 

See below for some more details.

Program Output:

Loading ...