Design Results for cftr

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size450Maximal Amplicon Size600
Natrium Concentration0.5 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 8 To Exon 12 (Pair 1)
Forward (1204,23)GTACAAACATGGTATGACTCTCTAmplicon SizecDNA: 592 bpgenomic: 47,516
Reverse (1795,21)TTGCTCGTTGACCTCCACTCANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.779 kcal/mol
Forward Dimers-1.149 kcal/mol
Reverse Loops1.938 kcal/mol in 3' area
Reverse Dimers-0.021 kcal/mol
Forward-Reverse Dimers-1.789 kcal/mol
Amplicon Folding-2.559 kcal/mol outside primersite
Amplicon SequenceGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGGATTTCTTACAAAAG
CAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTA
ACAGCCTTCTGGGAGGAGGGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAAC
AATAGAAAAACTTCTAATGGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGT
ACTCCTGTCCTGAAAGATATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCT
GGATCCACTGGAGCAGGCAAGACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCT
TCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATT
ATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGAATATAGATAC
AGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGACATCTCCAAGTTTGCAGAGAAAGAC
AATATAGTTCTTGGAGAAGGTGGAATCACACTGAGTGGAGGTCAACGAGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5921204 - 1795
Exon 14 To Exon 18 (Pair 1)
Forward (2528,22)AGGCAAACTTGACTGAACTGGAAmplicon SizecDNA: 573 bpgenomic: 14,171
Reverse (3100,22)TAAGAGGCAGAAGGTCATCCAANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.138 kcal/mol
Forward Dimers-1.865 kcal/mol
Reverse Loops1.095 kcal/mol in 3' area
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGG
AAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGA
GCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCT
TAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGG
TTGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTA
GAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTT
ACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGC
ATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAG
CACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAG
ATATAGCAATTTTGGATGACCTTCTGCCTCTTA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5732528 - 3100
Exon 14 To Exon 18 (Pair 2)
Forward (2528,22)AGGCAAACTTGACTGAACTGGAAmplicon SizecDNA: 579 bpgenomic: 14,177
Reverse (3106,22)ATATGGTAAGAGGCAGAAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.138 kcal/mol
Forward Dimers-1.865 kcal/mol
Reverse Loops1.97 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGG
AAATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGA
GCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCT
TAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGG
TTGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTA
GAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTT
ACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGC
ATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAG
CACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAG
ATATAGCAATTTTGGATGACCTTCTGCCTCTTACCATAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5792528 - 3106
Exon 14 To Exon 18 (Pair 3)
Forward (2530,23)GCAAACTTGACTGAACTGGATATAmplicon SizecDNA: 577 bpgenomic: 14,175
Reverse (3106,22)ATATGGTAAGAGGCAGAAGGTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.034 kcal/mol
Forward Dimers-0.251 kcal/mol
Reverse Loops1.97 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.207 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCTCAAGAAACTGGCTTGGAA
ATAAGTGAAGAAATTAACGAAGAAGACTTAAAGGAGTGCTTTTTTGATGATATGGAGAGC
ATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTAC
GTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCAT
ACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCA
CCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGAT
ATAGCAATTTTGGATGACCTTCTGCCTCTTACCATAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5772530 - 3106
Exon 15 To Exon 18 (Pair 1)
Forward (2639,22)ATATGGAGAGCATACCAGCAGTAmplicon SizecDNA: 470 bpgenomic: 11,796
Reverse (3108,23)AAATATGGTAAGAGGCAGAAGGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.739 kcal/mol
Forward Dimers-1.545 kcal/mol
Reverse Loops1.97 kcal/mol
Reverse Dimers-0.603 kcal/mol
Forward-Reverse Dimers-2.343 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceATATGGAGAGCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCC
ACAAGAGCTTAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTG
CTTCTTTGGTTGTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTA
CTCATAGTAGAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGT
TTTACATTTACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTAC
CACTGGTGCATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTG
TTCTTCAAGCACCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGAT
TCTCCAAAGATATAGCAATTTTGGATGACCTTCTGCCTCTTACCATATTT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)4702639 - 3108
Exon 15 To Exon 19 (Pair 1)
Forward (2650,22)ATACCAGCAGTGACTACATGGAAmplicon SizecDNA: 588 bpgenomic: 15,679
Reverse (3237,23)TTGGAGGAAATATGCTCTCAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.72 kcal/mol in 3' area
Forward Dimers-2.199 kcal/mol
Reverse Loops1.731 kcal/mol in 3' area
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-2.823 kcal/mol
Amplicon Folding-1.084 kcal/mol outside primersite
Amplicon SequenceATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTA
ATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTT
GTGCTGTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGA
AATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTAC
GTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCAT
ACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCA
CCTATGTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGAT
ATAGCAATTTTGGATGACCTTCTGCCTCTTACCATATTTGACTTCATCCAGTTGTTATTA
ATTGTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAACA
GTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5882650 - 3237
Exon 15 To Exon 19 (Pair 2)
Forward (2674,24)ACATACCTTCGATATATTACTGTCAmplicon SizecDNA: 564 bpgenomic: 15,655
Reverse (3237,23)TTGGAGGAAATATGCTCTCAACANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops2.085 kcal/mol
Forward Dimers-1.277 kcal/mol
Reverse Loops1.731 kcal/mol in 3' area
Reverse Dimers-0.481 kcal/mol
Forward-Reverse Dimers-2.656 kcal/mol
Amplicon Folding-1.084 kcal/mol outside primersite
Amplicon SequenceACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTTTGTGCTAATTTGGTGCTTA
GTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCTGTGGCTCCTTGGAAACACT
CCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACAGCTATGCAGTGATTATC
ACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGTAGCCGACACTTTGCTT
GCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAATCACAGTGTCGAAAATT
TTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCTATGTCAACCCTCAACACGTTG
AAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATAGCAATTTTGGATGACCTTCTG
CCTCTTACCATATTTGACTTCATCCAGTTGTTATTAATTGTGATTGGAGCTATAGCAGTT
GTCGCAGTTTTACAACCCTACATCTTTGTTGCAACAGTGCCAGTGATAGTGGCTTTTATT
ATGTTGAGAGCATATTTCCTCCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5642674 - 3237
Exon 15 To Exon 19 (Pair 3)
Forward (2655,22)AGCAGTGACTACATGGAACACAAmplicon SizecDNA: 533 bpgenomic: 15,624
Reverse (3187,23)TTGCAACAAAGATGTAGGGTTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.379 kcal/mol in 3' area
Forward Dimers-2.199 kcal/mol
Reverse Loops0.295 kcal/mol
Reverse Dimers-2.201 kcal/mol
Forward-Reverse Dimers-2.83 kcal/mol
Amplicon Folding-0.965 kcal/mol outside primersite
Amplicon SequenceAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAATTTT
TGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGGTGGCTGCTTCTTTGGTTGTGCT
GTGGCTCCTTGGAAACACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAA
CAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGG
AGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCT
AATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCTAT
GTCAACCCTCAACACGTTGAAAGCAGGTGGGATTCTTAATAGATTCTCCAAAGATATAGC
AATTTTGGATGACCTTCTGCCTCTTACCATATTTGACTTCATCCAGTTGTTATTAATTGT
GATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTTGTTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000492 (CFTR)5332655 - 3187
 

See below for some more details.

Program Output:

Loading ...