Design Results for col1a1

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-4 Minimal dG for amplicon folding-4
Nr of bases considered as 3'5Minimal Intron Size0

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 39 To Exon 40 (Pair 1)
Forward (2936,20)CTGGTGCTGATGGTCCTGCTAmplicon SizecDNA: 110 bpgenomic: 211
Reverse (3045,20)AGGGAAGCCTCTCTCTCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.987 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops0.367 kcal/mol
Reverse Dimers-0.698 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.361 kcal/mol outside primersite
Amplicon SequenceCTGGTGCTGATGGTCCTGCTGGTGCTCCTGGTACTCCCGGGCCTCAAGGTATTGCTGGAC
AGCGTGGTGTGGTCGGCCTGCCTGGTCAGAGAGGAGAGAGAGGCTTCCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)1102936 - 3045
Exon 39 To Exon 40 (Pair 2)
Forward (2821,20)GGTCCTGCTGGCAAAGAAGGAmplicon SizecDNA: 223 bpgenomic: 324
Reverse (3043,20)GGAAGCCTCTCTCTCCTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.315 kcal/mol in 3' area
Forward Dimers-2.329 kcal/mol
Reverse Loops1.125 kcal/mol
Reverse Dimers-0.126 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.64 kcal/mol outside primersite
Amplicon SequenceGGTCCTGCTGGCAAAGAAGGCGGCAAAGGTCCCCGTGGTGAGACTGGCCCTGCTGGACGT
CCTGGTGAAGTTGGTCCCCCTGGTCCCCCTGGCCCTGCTGGCGAGAAAGGATCCCCTGGT
GCTGATGGTCCTGCTGGTGCTCCTGGTACTCCCGGGCCTCAAGGTATTGCTGGACAGCGT
GGTGTGGTCGGCCTGCCTGGTCAGAGAGGAGAGAGAGGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 39 To Exon 40 (Pair 3)
Forward (2936,20)CTGGTGCTGATGGTCCTGCTAmplicon SizecDNA: 109 bpgenomic: 210
Reverse (3044,20)GGGAAGCCTCTCTCTCCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.987 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops1.125 kcal/mol
Reverse Dimers-0.417 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.361 kcal/mol outside primersite
Amplicon SequenceCTGGTGCTGATGGTCCTGCTGGTGCTCCTGGTACTCCCGGGCCTCAAGGTATTGCTGGAC
AGCGTGGTGTGGTCGGCCTGCCTGGTCAGAGAGGAGAGAGAGGCTTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)1092936 - 3044
Exon 39 To Exon 40 (Pair 4)
Forward (2936,20)CTGGTGCTGATGGTCCTGCTAmplicon SizecDNA: 108 bpgenomic: 209
Reverse (3043,20)GGAAGCCTCTCTCTCCTCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.987 kcal/mol in 3' area
Forward Dimers0.044 kcal/mol
Reverse Loops1.125 kcal/mol
Reverse Dimers-0.126 kcal/mol
Forward-Reverse Dimers-1.735 kcal/mol
Amplicon Folding-0.361 kcal/mol outside primersite
Amplicon SequenceCTGGTGCTGATGGTCCTGCTGGTGCTCCTGGTACTCCCGGGCCTCAAGGTATTGCTGGAC
AGCGTGGTGTGGTCGGCCTGCCTGGTCAGAGAGGAGAGAGAGGCTTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 39 To Exon 40 (Pair 5)
Forward (2821,20)GGTCCTGCTGGCAAAGAAGGAmplicon SizecDNA: 225 bpgenomic: 326
Reverse (3045,20)AGGGAAGCCTCTCTCTCCTCNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.315 kcal/mol in 3' area
Forward Dimers-2.329 kcal/mol
Reverse Loops0.367 kcal/mol
Reverse Dimers-0.698 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.64 kcal/mol outside primersite
Amplicon SequenceGGTCCTGCTGGCAAAGAAGGCGGCAAAGGTCCCCGTGGTGAGACTGGCCCTGCTGGACGT
CCTGGTGAAGTTGGTCCCCCTGGTCCCCCTGGCCCTGCTGGCGAGAAAGGATCCCCTGGT
GCTGATGGTCCTGCTGGTGCTCCTGGTACTCCCGGGCCTCAAGGTATTGCTGGACAGCGT
GGTGTGGTCGGCCTGCCTGGTCAGAGAGGAGAGAGAGGCTTCCCT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)10981948 - 3045
Exon 39 To Exon 40 (Pair 6)
Forward (2821,20)GGTCCTGCTGGCAAAGAAGGAmplicon SizecDNA: 224 bpgenomic: 325
Reverse (3044,20)GGGAAGCCTCTCTCTCCTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops0.315 kcal/mol in 3' area
Forward Dimers-2.329 kcal/mol
Reverse Loops1.125 kcal/mol
Reverse Dimers-0.417 kcal/mol
Forward-Reverse Dimers-2.056 kcal/mol
Amplicon Folding-1.64 kcal/mol outside primersite
Amplicon SequenceGGTCCTGCTGGCAAAGAAGGCGGCAAAGGTCCCCGTGGTGAGACTGGCCCTGCTGGACGT
CCTGGTGAAGTTGGTCCCCCTGGTCCCCCTGGCCCTGCTGGCGAGAAAGGATCCCCTGGT
GCTGATGGTCCTGCTGGTGCTCCTGGTACTCCCGGGCCTCAAGGTATTGCTGGACAGCGT
GGTGTGGTCGGCCTGCCTGGTCAGAGAGGAGAGAGAGGCTTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)10971948 - 3044
Exon 49 To Exon 50 (Pair 1)
Forward (3977,22)TGGATGCCATCAAAGTCTTCTGAmplicon SizecDNA: 262 bpgenomic: 558
Reverse (4238,22)TTGCAGTGGTAGGTGATGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.217 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.228 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTC
AGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATG
TCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCCG
ACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCCC
AGAACATCACCTACCACTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2623977 - 4238
Exon 49 To Exon 50 (Pair 2)
Forward (3976,22)CTGGATGCCATCAAAGTCTTCTAmplicon SizecDNA: 261 bpgenomic: 557
Reverse (4236,21)GCAGTGGTAGGTGATGTTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.217 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.208 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACT
CAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCAT
GTCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCC
GACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCC
CAGAACATCACCTACCACTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2613976 - 4236
Exon 49 To Exon 50 (Pair 3)
Forward (3977,22)TGGATGCCATCAAAGTCTTCTGAmplicon SizecDNA: 259 bpgenomic: 555
Reverse (4235,21)CAGTGGTAGGTGATGTTCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.366 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-1.208 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTC
AGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATG
TCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCCG
ACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCCC
AGAACATCACCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2593977 - 4235
Exon 49 To Exon 50 (Pair 4)
Forward (3976,22)CTGGATGCCATCAAAGTCTTCTAmplicon SizecDNA: 259 bpgenomic: 555
Reverse (4234,21)AGTGGTAGGTGATGTTCTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.366 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-1.208 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACT
CAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCAT
GTCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCC
GACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCC
CAGAACATCACCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2593976 - 4234
Exon 49 To Exon 50 (Pair 5)
Forward (3977,22)TGGATGCCATCAAAGTCTTCTGAmplicon SizecDNA: 260 bpgenomic: 556
Reverse (4236,21)GCAGTGGTAGGTGATGTTCTGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.217 kcal/mol
Reverse Dimers0.006 kcal/mol
Forward-Reverse Dimers-1.208 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTC
AGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATG
TCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCCG
ACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCCC
AGAACATCACCTACCACTGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2603977 - 4236
Exon 49 To Exon 50 (Pair 6)
Forward (3976,22)CTGGATGCCATCAAAGTCTTCTAmplicon SizecDNA: 258 bpgenomic: 554
Reverse (4233,21)GTGGTAGGTGATGTTCTGGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.366 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-1.208 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACT
CAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCAT
GTCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCC
GACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCC
CAGAACATCACCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2583976 - 4233
Exon 49 To Exon 50 (Pair 7)
Forward (3977,22)TGGATGCCATCAAAGTCTTCTGAmplicon SizecDNA: 256 bpgenomic: 552
Reverse (4232,21)TGGTAGGTGATGTTCTGGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.366 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-1.208 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTC
AGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATG
TCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCCG
ACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCCC
AGAACATCACCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2563977 - 4232
Exon 49 To Exon 50 (Pair 8)
Forward (3976,22)CTGGATGCCATCAAAGTCTTCTAmplicon SizecDNA: 260 bpgenomic: 556
Reverse (4235,21)CAGTGGTAGGTGATGTTCTGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.366 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-1.208 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACT
CAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCAT
GTCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCC
GACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCC
CAGAACATCACCTACCACTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2603976 - 4235
Exon 49 To Exon 50 (Pair 9)
Forward (3977,22)TGGATGCCATCAAAGTCTTCTGAmplicon SizecDNA: 284 bpgenomic: 580
Reverse (4260,20)GTCCATGTAGGCCACGCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops0.822 kcal/mol
Reverse Dimers-3.264 kcal/mol
Forward-Reverse Dimers-2.023 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTC
AGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATG
TCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCCG
ACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCCC
AGAACATCACCTACCACTGCAAGAACAGCGTGGCCTACATGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2843977 - 4260
Exon 49 To Exon 50 (Pair 10)
Forward (3976,22)CTGGATGCCATCAAAGTCTTCTAmplicon SizecDNA: 285 bpgenomic: 581
Reverse (4260,20)GTCCATGTAGGCCACGCTGTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops0.822 kcal/mol
Reverse Dimers-3.264 kcal/mol
Forward-Reverse Dimers-2.023 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACT
CAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCAT
GTCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCC
GACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCC
CAGAACATCACCTACCACTGCAAGAACAGCGTGGCCTACATGGAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2853976 - 4260
Exon 49 To Exon 50 (Pair 11)
Forward (3977,22)TGGATGCCATCAAAGTCTTCTGAmplicon SizecDNA: 258 bpgenomic: 554
Reverse (4234,21)AGTGGTAGGTGATGTTCTGGGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.366 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-1.208 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTC
AGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATG
TCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCCG
ACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCCC
AGAACATCACCTACCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2583977 - 4234
Exon 49 To Exon 50 (Pair 12)
Forward (3976,22)CTGGATGCCATCAAAGTCTTCTAmplicon SizecDNA: 263 bpgenomic: 559
Reverse (4238,22)TTGCAGTGGTAGGTGATGTTCTNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.217 kcal/mol
Reverse Dimers-1.214 kcal/mol
Forward-Reverse Dimers-1.228 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACT
CAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCAT
GTCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCC
GACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCC
CAGAACATCACCTACCACTGCAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2633976 - 4238
Exon 49 To Exon 50 (Pair 13)
Forward (3977,22)TGGATGCCATCAAAGTCTTCTGAmplicon SizecDNA: 257 bpgenomic: 553
Reverse (4233,21)GTGGTAGGTGATGTTCTGGGANr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.366 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-1.208 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTC
AGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATG
TCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCCG
ACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCCC
AGAACATCACCTACCAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2573977 - 4233
Exon 49 To Exon 50 (Pair 14)
Forward (3976,22)CTGGATGCCATCAAAGTCTTCTAmplicon SizecDNA: 257 bpgenomic: 553
Reverse (4232,21)TGGTAGGTGATGTTCTGGGAGNr. of Isoforms 1 out of 1 (by amplicon BlastN)
Folding EnergiesForward Loops1.427 kcal/mol
Forward Dimers-1.613 kcal/mol
Reverse Loops2.366 kcal/mol
Reverse Dimers0.044 kcal/mol
Forward-Reverse Dimers-1.208 kcal/mol
Amplicon Folding-2.897 kcal/mol outside primersite
Amplicon SequenceCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACT
CAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCAT
GTCTGGTTCGGCGAGAGCATGACCGATGGATTCCAGTTCGAGTATGGCGGCCAGGGCTCC
GACCCTGCCGATGTGGCCATCCAGCTGACCTTCCTGCGCCTGATGTCCACCGAGGCCTCC
CAGAACATCACCTACCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_000088 (COL1A1)2573976 - 4232
 

See below for some more details.

Program Output:

Loading ...