Design Results for egfr

(Homo Sapiens, NCBI 37 / UCSC hg19)

Settings Overview
Minimal Amplicon Size70Maximal Amplicon Size300
Natrium Concentration0.3 MMagnesium Concentration0.015 M
Annealing Temperature60 °CMinimal dG for primer folding0
Minimal dG for primer dimer-3 Minimal dG for amplicon folding-3
Nr of bases considered as 3'5Minimal Intron Size3000

Sorting Options

Sort results by : Sort results by : Direction: (add item)

Amplicon Details

Remark: Only top 100 primer pairs are shown)

Exon 4 To Exon 5 (Pair 1)
Forward (732,23)AATTCCTATGCCTTAGCAGTCTTAmplicon SizecDNA: 142 bpgenomic: 3,259
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.139 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAG
CTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCT
GCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)142589 - 730
NM_005228 (EGFR)142589 - 730
NM_201284 (EGFR)142589 - 730
NM_201282 (EGFR)142589 - 730
Exon 4 To Exon 5 (Pair 2)
Forward (783,20)CTGAAGGAGCTGCCCATGAGAmplicon SizecDNA: 94 bpgenomic: 3,211
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.152 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceCTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGC
AACAACCCTGCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)94640 - 733
NM_201282 (EGFR)94640 - 733
NM_201283 (EGFR)94640 - 733
NM_005228 (EGFR)94640 - 733
Exon 4 To Exon 5 (Pair 3)
Forward (786,22)AAGGAGCTGCCCATGAGAAATTAmplicon SizecDNA: 91 bpgenomic: 3,208
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.039 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAAC
AACCCTGCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)91643 - 733
NM_201283 (EGFR)91643 - 733
NM_201284 (EGFR)91643 - 733
NM_201282 (EGFR)91643 - 733
Exon 4 To Exon 5 (Pair 4)
Forward (784,21)TGAAGGAGCTGCCCATGAGAAAmplicon SizecDNA: 90 bpgenomic: 3,207
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.152 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCA
ACAACCCTGCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)90641 - 730
NM_005228 (EGFR)90641 - 730
NM_201282 (EGFR)90641 - 730
NM_201284 (EGFR)90641 - 730
Exon 4 To Exon 5 (Pair 5)
Forward (700,23)TGCAGATCATCAGAGGAAATATGAmplicon SizecDNA: 150 bpgenomic: 3,267
Reverse (849,20)GGTTGTTGCTGAACCGCACGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.156 kcal/mol in 3' area
Reverse Dimers-1.185 kcal/mol
Forward-Reverse Dimers-1.957 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTA
ACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCC
TGCATGGCGCCGTGCGGTTCAGCAACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)150557 - 706
NM_201284 (EGFR)150557 - 706
NM_005228 (EGFR)150557 - 706
NM_201283 (EGFR)150557 - 706
Exon 4 To Exon 5 (Pair 6)
Forward (732,23)AATTCCTATGCCTTAGCAGTCTTAmplicon SizecDNA: 132 bpgenomic: 3,249
Reverse (863,20)GTTGCACAGGGCAGGGTTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops0.101 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.638 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAG
CTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCT
GCCCTGTGCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)132589 - 720
NM_201283 (EGFR)132589 - 720
NM_201282 (EGFR)132589 - 720
NM_201284 (EGFR)132589 - 720
Exon 4 To Exon 5 (Pair 7)
Forward (700,23)TGCAGATCATCAGAGGAAATATGAmplicon SizecDNA: 167 bpgenomic: 3,284
Reverse (866,19)CACGTTGCACAGGGCAGGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.101 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.628 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTA
ACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCC
TGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)167557 - 723
NM_201283 (EGFR)167557 - 723
NM_201282 (EGFR)167557 - 723
NM_201284 (EGFR)167557 - 723
Exon 4 To Exon 5 (Pair 8)
Forward (703,24)AGATCATCAGAGGAAATATGTACTAmplicon SizecDNA: 174 bpgenomic: 3,291
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAACT
ATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGC
ATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)174560 - 733
NM_005228 (EGFR)174560 - 733
NM_201282 (EGFR)174560 - 733
NM_201284 (EGFR)174560 - 733
Exon 4 To Exon 5 (Pair 9)
Forward (701,23)GCAGATCATCAGAGGAAATATGTAmplicon SizecDNA: 176 bpgenomic: 3,293
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAA
CTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCT
GCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)176558 - 733
NM_201282 (EGFR)176558 - 733
NM_005228 (EGFR)176558 - 733
NM_201283 (EGFR)176558 - 733
Exon 4 To Exon 5 (Pair 10)
Forward (784,21)TGAAGGAGCTGCCCATGAGAAAmplicon SizecDNA: 93 bpgenomic: 3,210
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.152 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCA
ACAACCCTGCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)93641 - 733
NM_201283 (EGFR)93641 - 733
NM_201284 (EGFR)93641 - 733
NM_201282 (EGFR)93641 - 733
Exon 4 To Exon 5 (Pair 11)
Forward (787,22)AGGAGCTGCCCATGAGAAATTTAmplicon SizecDNA: 90 bpgenomic: 3,207
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.039 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACA
ACCCTGCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)90644 - 733
NM_201284 (EGFR)90644 - 733
NM_005228 (EGFR)90644 - 733
NM_201283 (EGFR)90644 - 733
Exon 4 To Exon 5 (Pair 12)
Forward (788,22)GGAGCTGCCCATGAGAAATTTAAmplicon SizecDNA: 86 bpgenomic: 3,203
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.039 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.908 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAA
CCCTGCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)86645 - 730
NM_005228 (EGFR)86645 - 730
NM_201282 (EGFR)86645 - 730
NM_201284 (EGFR)86645 - 730
Exon 4 To Exon 5 (Pair 13)
Forward (701,23)GCAGATCATCAGAGGAAATATGTAmplicon SizecDNA: 163 bpgenomic: 3,280
Reverse (863,20)GTTGCACAGGGCAGGGTTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.101 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAA
CTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCT
GCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)163558 - 720
NM_005228 (EGFR)163558 - 720
NM_201282 (EGFR)163558 - 720
NM_201284 (EGFR)163558 - 720
Exon 4 To Exon 5 (Pair 14)
Forward (701,23)GCAGATCATCAGAGGAAATATGTAmplicon SizecDNA: 149 bpgenomic: 3,266
Reverse (849,20)GGTTGTTGCTGAACCGCACGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.156 kcal/mol in 3' area
Reverse Dimers-1.185 kcal/mol
Forward-Reverse Dimers-1.957 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAA
CTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCT
GCATGGCGCCGTGCGGTTCAGCAACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)149558 - 706
NM_005228 (EGFR)149558 - 706
NM_201284 (EGFR)149558 - 706
NM_201282 (EGFR)149558 - 706
Exon 4 To Exon 5 (Pair 15)
Forward (674,22)AGTGGAGCGAATTCCTTTGGAAAmplicon SizecDNA: 188 bpgenomic: 3,305
Reverse (861,20)TGCACAGGGCAGGGTTGTTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.82 kcal/mol in 3' area
Forward Dimers-1.322 kcal/mol
Reverse Loops0.172 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-1.573 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAA
TTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCT
GCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGC
CCTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)188531 - 718
NM_201282 (EGFR)188531 - 718
NM_201283 (EGFR)188531 - 718
NM_005228 (EGFR)188531 - 718
Exon 4 To Exon 5 (Pair 16)
Forward (700,23)TGCAGATCATCAGAGGAAATATGAmplicon SizecDNA: 171 bpgenomic: 3,288
Reverse (870,20)TCTCCACGTTGCACAGGGCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.101 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.628 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTA
ACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCC
TGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)171557 - 727
NM_201284 (EGFR)171557 - 727
NM_201282 (EGFR)171557 - 727
NM_005228 (EGFR)171557 - 727
Exon 4 To Exon 5 (Pair 17)
Forward (675,22)GTGGAGCGAATTCCTTTGGAAAAmplicon SizecDNA: 193 bpgenomic: 3,310
Reverse (867,19)CCACGTTGCACAGGGCAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.75 kcal/mol in 3' area
Forward Dimers-1.322 kcal/mol
Reverse Loops0.101 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.756 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAAT
TCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTG
CCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCC
CTGTGCAACGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)193532 - 724
NM_201284 (EGFR)193532 - 724
NM_201282 (EGFR)193532 - 724
NM_201283 (EGFR)193532 - 724
Exon 4 To Exon 5 (Pair 18)
Forward (701,23)GCAGATCATCAGAGGAAATATGTAmplicon SizecDNA: 173 bpgenomic: 3,290
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAA
CTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCT
GCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)173558 - 730
NM_201283 (EGFR)173558 - 730
NM_201284 (EGFR)173558 - 730
NM_201282 (EGFR)173558 - 730
Exon 4 To Exon 5 (Pair 19)
Forward (700,23)TGCAGATCATCAGAGGAAATATGAmplicon SizecDNA: 174 bpgenomic: 3,291
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTA
ACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCC
TGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)174557 - 730
NM_201282 (EGFR)174557 - 730
NM_201284 (EGFR)174557 - 730
NM_201283 (EGFR)174557 - 730
Exon 4 To Exon 5 (Pair 20)
Forward (731,23)AAATTCCTATGCCTTAGCAGTCTAmplicon SizecDNA: 131 bpgenomic: 3,248
Reverse (861,20)TGCACAGGGCAGGGTTGTTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops0.172 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.638 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGA
GCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCC
TGCCCTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)131588 - 718
NM_201282 (EGFR)131588 - 718
NM_201283 (EGFR)131588 - 718
NM_005228 (EGFR)131588 - 718
Exon 4 To Exon 5 (Pair 21)
Forward (703,24)AGATCATCAGAGGAAATATGTACTAmplicon SizecDNA: 171 bpgenomic: 3,288
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAACT
ATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGC
ATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)171560 - 730
NM_201282 (EGFR)171560 - 730
NM_201284 (EGFR)171560 - 730
NM_201283 (EGFR)171560 - 730
Exon 4 To Exon 5 (Pair 22)
Forward (703,24)AGATCATCAGAGGAAATATGTACTAmplicon SizecDNA: 147 bpgenomic: 3,264
Reverse (849,20)GGTTGTTGCTGAACCGCACGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops1.156 kcal/mol in 3' area
Reverse Dimers-1.185 kcal/mol
Forward-Reverse Dimers-1.957 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAACT
ATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGC
ATGGCGCCGTGCGGTTCAGCAACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)147560 - 706
NM_201284 (EGFR)147560 - 706
NM_201283 (EGFR)147560 - 706
NM_005228 (EGFR)147560 - 706
Exon 4 To Exon 5 (Pair 23)
Forward (781,20)GACTGAAGGAGCTGCCCATGAmplicon SizecDNA: 93 bpgenomic: 3,210
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.152 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCA
GCAACAACCCTGCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)93638 - 730
NM_201284 (EGFR)93638 - 730
NM_201282 (EGFR)93638 - 730
NM_201283 (EGFR)93638 - 730
Exon 4 To Exon 5 (Pair 24)
Forward (703,24)AGATCATCAGAGGAAATATGTACTAmplicon SizecDNA: 168 bpgenomic: 3,285
Reverse (870,20)TCTCCACGTTGCACAGGGCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.101 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAACT
ATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGC
ATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)168560 - 727
NM_201284 (EGFR)168560 - 727
NM_201282 (EGFR)168560 - 727
NM_201283 (EGFR)168560 - 727
Exon 4 To Exon 5 (Pair 25)
Forward (700,23)TGCAGATCATCAGAGGAAATATGAmplicon SizecDNA: 168 bpgenomic: 3,285
Reverse (867,19)CCACGTTGCACAGGGCAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.101 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.628 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTA
ACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCC
TGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)168557 - 724
NM_201282 (EGFR)168557 - 724
NM_201284 (EGFR)168557 - 724
NM_201283 (EGFR)168557 - 724
Exon 4 To Exon 5 (Pair 26)
Forward (732,23)AATTCCTATGCCTTAGCAGTCTTAmplicon SizecDNA: 118 bpgenomic: 3,235
Reverse (849,20)GGTTGTTGCTGAACCGCACGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops1.156 kcal/mol in 3' area
Reverse Dimers-1.185 kcal/mol
Forward-Reverse Dimers-2.098 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAG
CTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)118589 - 706
NM_201282 (EGFR)118589 - 706
NM_201284 (EGFR)118589 - 706
NM_201283 (EGFR)118589 - 706
Exon 4 To Exon 5 (Pair 27)
Forward (701,23)GCAGATCATCAGAGGAAATATGTAmplicon SizecDNA: 166 bpgenomic: 3,283
Reverse (866,19)CACGTTGCACAGGGCAGGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.101 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAA
CTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCT
GCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)166558 - 723
NM_201284 (EGFR)166558 - 723
NM_201282 (EGFR)166558 - 723
NM_201283 (EGFR)166558 - 723
Exon 4 To Exon 5 (Pair 28)
Forward (732,23)AATTCCTATGCCTTAGCAGTCTTAmplicon SizecDNA: 130 bpgenomic: 3,247
Reverse (861,20)TGCACAGGGCAGGGTTGTTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops0.172 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-2.638 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAG
CTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCT
GCCCTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)130589 - 718
NM_201284 (EGFR)130589 - 718
NM_201283 (EGFR)130589 - 718
NM_005228 (EGFR)130589 - 718
Exon 4 To Exon 5 (Pair 29)
Forward (783,20)CTGAAGGAGCTGCCCATGAGAmplicon SizecDNA: 91 bpgenomic: 3,208
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.152 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceCTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGC
AACAACCCTGCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)91640 - 730
NM_201284 (EGFR)91640 - 730
NM_201282 (EGFR)91640 - 730
NM_005228 (EGFR)91640 - 730
Exon 4 To Exon 5 (Pair 30)
Forward (701,23)GCAGATCATCAGAGGAAATATGTAmplicon SizecDNA: 161 bpgenomic: 3,278
Reverse (861,20)TGCACAGGGCAGGGTTGTTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.172 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-0.96 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAA
CTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCT
GCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)161558 - 718
NM_201282 (EGFR)161558 - 718
NM_201284 (EGFR)161558 - 718
NM_005228 (EGFR)161558 - 718
Exon 4 To Exon 5 (Pair 31)
Forward (701,23)GCAGATCATCAGAGGAAATATGTAmplicon SizecDNA: 167 bpgenomic: 3,284
Reverse (867,19)CCACGTTGCACAGGGCAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.101 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.031 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAA
CTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCT
GCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)167558 - 724
NM_201283 (EGFR)167558 - 724
NM_201282 (EGFR)167558 - 724
NM_201284 (EGFR)167558 - 724
Exon 4 To Exon 5 (Pair 32)
Forward (732,23)AATTCCTATGCCTTAGCAGTCTTAmplicon SizecDNA: 145 bpgenomic: 3,262
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol
Forward Dimers-0.826 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.44 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAG
CTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCT
GCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)145589 - 733
NM_201283 (EGFR)145589 - 733
NM_201282 (EGFR)145589 - 733
NM_201284 (EGFR)145589 - 733
Exon 4 To Exon 5 (Pair 33)
Forward (701,23)GCAGATCATCAGAGGAAATATGTAmplicon SizecDNA: 170 bpgenomic: 3,287
Reverse (870,20)TCTCCACGTTGCACAGGGCANr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-0.806 kcal/mol
Reverse Loops0.101 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.114 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAA
CTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCT
GCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)170558 - 727
NM_201284 (EGFR)170558 - 727
NM_201282 (EGFR)170558 - 727
NM_005228 (EGFR)170558 - 727
Exon 4 To Exon 5 (Pair 34)
Forward (675,22)GTGGAGCGAATTCCTTTGGAAAAmplicon SizecDNA: 187 bpgenomic: 3,304
Reverse (861,20)TGCACAGGGCAGGGTTGTTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.75 kcal/mol in 3' area
Forward Dimers-1.322 kcal/mol
Reverse Loops0.172 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-1.573 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAAT
TCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTG
CCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCC
CTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)187532 - 718
NM_201282 (EGFR)187532 - 718
NM_201284 (EGFR)187532 - 718
NM_201283 (EGFR)187532 - 718
Exon 4 To Exon 5 (Pair 35)
Forward (668,21)CAACACAGTGGAGCGAATTCCAmplicon SizecDNA: 196 bpgenomic: 3,313
Reverse (863,20)GTTGCACAGGGCAGGGTTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.62 kcal/mol in 3' area
Forward Dimers-1.322 kcal/mol
Reverse Loops0.101 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-0.959 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceCAACACAGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTA
CGAAAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAA
GGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAA
CCCTGCCCTGTGCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)196525 - 720
NM_201283 (EGFR)196525 - 720
NM_201282 (EGFR)196525 - 720
NM_201284 (EGFR)196525 - 720
Exon 4 To Exon 5 (Pair 36)
Forward (700,23)TGCAGATCATCAGAGGAAATATGAmplicon SizecDNA: 164 bpgenomic: 3,281
Reverse (863,20)GTTGCACAGGGCAGGGTTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.101 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-1.628 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTA
ACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCC
TGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)164557 - 720
NM_201282 (EGFR)164557 - 720
NM_201283 (EGFR)164557 - 720
NM_005228 (EGFR)164557 - 720
Exon 4 To Exon 5 (Pair 37)
Forward (675,22)GTGGAGCGAATTCCTTTGGAAAAmplicon SizecDNA: 192 bpgenomic: 3,309
Reverse (866,19)CACGTTGCACAGGGCAGGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.75 kcal/mol in 3' area
Forward Dimers-1.322 kcal/mol
Reverse Loops0.101 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.756 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAAT
TCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTG
CCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCC
CTGTGCAACGTG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)192532 - 723
NM_201282 (EGFR)192532 - 723
NM_201283 (EGFR)192532 - 723
NM_005228 (EGFR)192532 - 723
Exon 4 To Exon 5 (Pair 38)
Forward (731,23)AAATTCCTATGCCTTAGCAGTCTAmplicon SizecDNA: 133 bpgenomic: 3,250
Reverse (863,20)GTTGCACAGGGCAGGGTTGTNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.149 kcal/mol in 3' area
Forward Dimers-1.026 kcal/mol
Reverse Loops0.101 kcal/mol
Reverse Dimers-1.266 kcal/mol
Forward-Reverse Dimers-2.638 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGA
GCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCC
TGCCCTGTGCAAC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)133588 - 720
NM_201284 (EGFR)133588 - 720
NM_201283 (EGFR)133588 - 720
NM_005228 (EGFR)133588 - 720
Exon 4 To Exon 5 (Pair 39)
Forward (786,22)AAGGAGCTGCCCATGAGAAATTAmplicon SizecDNA: 88 bpgenomic: 3,205
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.039 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAAC
AACCCTGCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)88643 - 730
NM_201283 (EGFR)88643 - 730
NM_201282 (EGFR)88643 - 730
NM_201284 (EGFR)88643 - 730
Exon 4 To Exon 5 (Pair 40)
Forward (788,22)GGAGCTGCCCATGAGAAATTTAAmplicon SizecDNA: 89 bpgenomic: 3,206
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.039 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.908 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAA
CCCTGCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)89645 - 733
NM_201284 (EGFR)89645 - 733
NM_201282 (EGFR)89645 - 733
NM_005228 (EGFR)89645 - 733
Exon 4 To Exon 5 (Pair 41)
Forward (785,21)GAAGGAGCTGCCCATGAGAAAAmplicon SizecDNA: 89 bpgenomic: 3,206
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.152 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAA
CAACCCTGCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)89642 - 730
NM_201283 (EGFR)89642 - 730
NM_201284 (EGFR)89642 - 730
NM_201282 (EGFR)89642 - 730
Exon 4 To Exon 5 (Pair 42)
Forward (700,23)TGCAGATCATCAGAGGAAATATGAmplicon SizecDNA: 177 bpgenomic: 3,294
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-1.79 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTA
ACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCC
TGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)177557 - 733
NM_201282 (EGFR)177557 - 733
NM_201283 (EGFR)177557 - 733
NM_005228 (EGFR)177557 - 733
Exon 4 To Exon 5 (Pair 43)
Forward (780,20)GGACTGAAGGAGCTGCCCATAmplicon SizecDNA: 97 bpgenomic: 3,214
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.152 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTC
AGCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)97637 - 733
NM_201283 (EGFR)97637 - 733
NM_201284 (EGFR)97637 - 733
NM_201282 (EGFR)97637 - 733
Exon 4 To Exon 5 (Pair 44)
Forward (787,22)AGGAGCTGCCCATGAGAAATTTAmplicon SizecDNA: 87 bpgenomic: 3,204
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.039 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACA
ACCCTGCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)87644 - 730
NM_201282 (EGFR)87644 - 730
NM_201284 (EGFR)87644 - 730
NM_005228 (EGFR)87644 - 730
Exon 4 To Exon 5 (Pair 45)
Forward (781,20)GACTGAAGGAGCTGCCCATGAmplicon SizecDNA: 96 bpgenomic: 3,213
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.152 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCA
GCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)96638 - 733
NM_201282 (EGFR)96638 - 733
NM_201283 (EGFR)96638 - 733
NM_005228 (EGFR)96638 - 733
Exon 4 To Exon 5 (Pair 46)
Forward (700,23)TGCAGATCATCAGAGGAAATATGAmplicon SizecDNA: 162 bpgenomic: 3,279
Reverse (861,20)TGCACAGGGCAGGGTTGTTGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.738 kcal/mol
Forward Dimers-1.072 kcal/mol
Reverse Loops0.172 kcal/mol
Reverse Dimers-1.124 kcal/mol
Forward-Reverse Dimers-1.557 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTA
ACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCC
TGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201283 (EGFR)162557 - 718
NM_201282 (EGFR)162557 - 718
NM_201284 (EGFR)162557 - 718
NM_005228 (EGFR)162557 - 718
Exon 4 To Exon 5 (Pair 47)
Forward (785,21)GAAGGAGCTGCCCATGAGAAAAmplicon SizecDNA: 92 bpgenomic: 3,209
Reverse (876,20)GGATGCTCTCCACGTTGCACNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.152 kcal/mol
Forward Dimers-2.732 kcal/mol
Reverse Loops0.923 kcal/mol
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAA
CAACCCTGCCCTGTGCAACGTGGAGAGCATCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_005228 (EGFR)92642 - 733
NM_201282 (EGFR)92642 - 733
NM_201284 (EGFR)92642 - 733
NM_201283 (EGFR)92642 - 733
Exon 4 To Exon 5 (Pair 48)
Forward (780,20)GGACTGAAGGAGCTGCCCATAmplicon SizecDNA: 94 bpgenomic: 3,211
Reverse (873,20)TGCTCTCCACGTTGCACAGGNr. of Isoforms 4 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.152 kcal/mol in 3' area
Forward Dimers-2.732 kcal/mol
Reverse Loops1.39 kcal/mol in 3' area
Reverse Dimers-2.89 kcal/mol
Forward-Reverse Dimers-2.013 kcal/mol
Amplicon Folding-0.6 kcal/mol outside primersite
Amplicon SequenceGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTC
AGCAACAACCCTGCCCTGTGCAACGTGGAGAGCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)94637 - 730
NM_201282 (EGFR)94637 - 730
NM_201283 (EGFR)94637 - 730
NM_005228 (EGFR)94637 - 730
Exon 16 To Exon 18 (Pair 1)
Forward (2320,20)CACCCTGGTCTGGAAGTACGAmplicon SizecDNA: 204 bpgenomic: 4,960
Reverse (2523,22)TTTGAGACTCTCATTTCCTGGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTG
CACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTGCATT
TCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACTATTCATTT
GAGCCAGGAAATGAGAGTCTCAAA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)912058 - 2148
Exon 16 To Exon 17 (Pair 1)
Forward (2346,19)CCGGCCATGTGTGCCACCTAmplicon SizecDNA: 76 bpgenomic: 3,161
Reverse (2421,23)GACTAAAGTCAGACAGTGAAGATNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.6 kcal/mol in 3' area
Forward Dimers-2.704 kcal/mol
Reverse Loops1.069 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.153 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCA
CTGTCTGACTTTAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)762084 - 2159
Exon 16 To Exon 18 (Pair 2)
Forward (2321,20)ACCCTGGTCTGGAAGTACGCAmplicon SizecDNA: 205 bpgenomic: 4,961
Reverse (2525,22)GCTTTGAGACTCTCATTTCCTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.678 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGC
ACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTGCATTT
CCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACTATTCATTTG
AGCCAGGAAATGAGAGTCTCAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)922059 - 2150
Exon 16 To Exon 17 (Pair 2)
Forward (2358,20)GCCACCTGTGCCATCCAAACAmplicon SizecDNA: 134 bpgenomic: 3,219
Reverse (2491,23)AGTGTCAGGACTTTATTTGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.73 kcal/mol
Reverse Dimers-0.768 kcal/mol
Forward-Reverse Dimers-2.574 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTT
AGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAAT
AAAGTCCTGACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1342096 - 2229
Exon 16 To Exon 18 (Pair 4)
Forward (2320,20)CACCCTGGTCTGGAAGTACGAmplicon SizecDNA: 208 bpgenomic: 4,964
Reverse (2527,22)TGGCTTTGAGACTCTCATTTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTG
CACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTGCATT
TCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACTATTCATTT
GAGCCAGGAAATGAGAGTCTCAAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)952058 - 2152
Exon 16 To Exon 18 (Pair 5)
Forward (2315,21)AACAACACCCTGGTCTGGAAGAmplicon SizecDNA: 213 bpgenomic: 4,969
Reverse (2527,22)TGGCTTTGAGACTCTCATTTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCA
AACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACT
GCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACTATT
CATTTGAGCCAGGAAATGAGAGTCTCAAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)1002053 - 2152
Exon 16 To Exon 18 (Pair 6)
Forward (2358,20)GCCACCTGTGCCATCCAAACAmplicon SizecDNA: 170 bpgenomic: 4,926
Reverse (2527,22)TGGCTTTGAGACTCTCATTTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-2.3 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTT
AGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAAT
AAAGTCCTGACACTATTCATTTGAGCCAGGAAATGAGAGTCTCAAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 16 To Exon 18 (Pair 7)
Forward (2328,20)TCTGGAAGTACGCAGACGCCAmplicon SizecDNA: 197 bpgenomic: 4,953
Reverse (2524,22)CTTTGAGACTCTCATTTCCTGGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.638 kcal/mol in 3' area
Forward Dimers-0.74 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGCACCTACG
GGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTGCATTTCCTTTCT
ACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACTATTCATTTGAGCCAGG
AAATGAGAGTCTCAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)842066 - 2149
Exon 16 To Exon 17 (Pair 3)
Forward (2295,20)CGGCAGGAGTCATGGGAGAAAmplicon SizecDNA: 199 bpgenomic: 3,284
Reverse (2493,24)ATAGTGTCAGGACTTTATTTGAAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.9 kcal/mol in 3' area
Forward Dimers-0.998 kcal/mol
Reverse Loops1.5 kcal/mol
Reverse Dimers-0.998 kcal/mol
Forward-Reverse Dimers-2.589 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCGGCAGGAGTCATGGGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATG
TGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGAC
TTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCA
AATAAAGTCCTGACACTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1992033 - 2231
Exon 16 To Exon 17 (Pair 4)
Forward (2358,20)GCCACCTGTGCCATCCAAACAmplicon SizecDNA: 138 bpgenomic: 3,223
Reverse (2495,24)GAATAGTGTCAGGACTTTATTTGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.5 kcal/mol
Reverse Dimers-0.998 kcal/mol
Forward-Reverse Dimers-2.574 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTT
AGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAAT
AAAGTCCTGACACTATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1382096 - 2233
Exon 16 To Exon 17 (Pair 5)
Forward (2356,20)GTGCCACCTGTGCCATCCAAAmplicon SizecDNA: 136 bpgenomic: 3,221
Reverse (2491,23)AGTGTCAGGACTTTATTTGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.73 kcal/mol
Reverse Dimers-0.768 kcal/mol
Forward-Reverse Dimers-2.574 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACT
TTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAA
ATAAAGTCCTGACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1362094 - 2229
Exon 16 To Exon 17 (Pair 6)
Forward (2318,21)AACACCCTGGTCTGGAAGTACAmplicon SizecDNA: 148 bpgenomic: 3,233
Reverse (2465,24)GGGAGAAATTGAAATTGTAGAAAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.039 kcal/mol
Reverse Dimers-0.802 kcal/mol
Forward-Reverse Dimers-2.094 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAAC
TGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTGCA
TTTCCTTTCTACAATTTCAATTTCTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1482056 - 2203
Exon 16 To Exon 18 (Pair 8)
Forward (2347,19)CGGCCATGTGTGCCACCTGAmplicon SizecDNA: 180 bpgenomic: 4,936
Reverse (2526,22)GGCTTTGAGACTCTCATTTCCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.6 kcal/mol
Forward Dimers-2.704 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-1.766 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCGGCCATGTGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCAC
TGTCTGACTTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCT
TTGCTTCAAATAAAGTCCTGACACTATTCATTTGAGCCAGGAAATGAGAGTCTCAAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)672085 - 2151
Exon 16 To Exon 17 (Pair 7)
Forward (2295,20)CGGCAGGAGTCATGGGAGAAAmplicon SizecDNA: 179 bpgenomic: 3,264
Reverse (2473,24)GAAGCAAAGGGAGAAATTGAAATTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.9 kcal/mol in 3' area
Forward Dimers-0.998 kcal/mol
Reverse Loops1.039 kcal/mol
Reverse Dimers-0.802 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCGGCAGGAGTCATGGGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATG
TGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGAC
TTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1792033 - 2211
Exon 16 To Exon 17 (Pair 8)
Forward (2317,21)CAACACCCTGGTCTGGAAGTAAmplicon SizecDNA: 105 bpgenomic: 3,190
Reverse (2421,23)GACTAAAGTCAGACAGTGAAGATNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.069 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-2.368 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAA
CTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1052055 - 2159
Exon 16 To Exon 17 (Pair 9)
Forward (2356,20)GTGCCACCTGTGCCATCCAAAmplicon SizecDNA: 110 bpgenomic: 3,195
Reverse (2465,24)GGGAGAAATTGAAATTGTAGAAAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.039 kcal/mol
Reverse Dimers-0.802 kcal/mol
Forward-Reverse Dimers-1.147 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACT
TTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1102094 - 2203
Exon 16 To Exon 17 (Pair 10)
Forward (2295,20)CGGCAGGAGTCATGGGAGAAAmplicon SizecDNA: 184 bpgenomic: 3,269
Reverse (2478,24)TATTTGAAGCAAAGGGAGAAATTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.9 kcal/mol in 3' area
Forward Dimers-0.998 kcal/mol
Reverse Loops1.039 kcal/mol in 3' area
Reverse Dimers-0.819 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCGGCAGGAGTCATGGGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATG
TGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGAC
TTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCA
AATA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1842033 - 2216
Exon 16 To Exon 18 (Pair 9)
Forward (2316,21)ACAACACCCTGGTCTGGAAGTAmplicon SizecDNA: 211 bpgenomic: 4,967
Reverse (2526,22)GGCTTTGAGACTCTCATTTCCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAA
ACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTG
CATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACTATTC
ATTTGAGCCAGGAAATGAGAGTCTCAAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)982054 - 2151
Exon 16 To Exon 17 (Pair 11)
Forward (2358,20)GCCACCTGTGCCATCCAAACAmplicon SizecDNA: 124 bpgenomic: 3,209
Reverse (2481,24)CTTTATTTGAAGCAAAGGGAGAAANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers-0.819 kcal/mol
Forward-Reverse Dimers-2.82 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTT
AGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAAT
AAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1242096 - 2219
Exon 16 To Exon 17 (Pair 12)
Forward (2321,20)ACCCTGGTCTGGAAGTACGCAmplicon SizecDNA: 104 bpgenomic: 3,189
Reverse (2424,22)GGAGACTAAAGTCAGACAGTGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.678 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-1.671 kcal/mol
Forward-Reverse Dimers-2.368 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGC
ACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1042059 - 2162
Exon 16 To Exon 17 (Pair 13)
Forward (2328,20)TCTGGAAGTACGCAGACGCCAmplicon SizecDNA: 164 bpgenomic: 3,249
Reverse (2491,23)AGTGTCAGGACTTTATTTGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.638 kcal/mol in 3' area
Forward Dimers-0.74 kcal/mol
Reverse Loops1.73 kcal/mol
Reverse Dimers-0.768 kcal/mol
Forward-Reverse Dimers-2.28 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGCACCTACG
GGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTGCATTTCCTTTCT
ACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1642066 - 2229
Exon 16 To Exon 17 (Pair 14)
Forward (2358,20)GCCACCTGTGCCATCCAAACAmplicon SizecDNA: 136 bpgenomic: 3,221
Reverse (2493,24)ATAGTGTCAGGACTTTATTTGAAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.5 kcal/mol
Reverse Dimers-0.998 kcal/mol
Forward-Reverse Dimers-2.574 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTT
AGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAAT
AAAGTCCTGACACTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1362096 - 2231
Exon 16 To Exon 18 (Pair 10)
Forward (2358,20)GCCACCTGTGCCATCCAAACAmplicon SizecDNA: 169 bpgenomic: 4,925
Reverse (2526,22)GGCTTTGAGACTCTCATTTCCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-1.729 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTT
AGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAAT
AAAGTCCTGACACTATTCATTTGAGCCAGGAAATGAGAGTCTCAAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 16 To Exon 18 (Pair 11)
Forward (2351,20)CATGTGTGCCACCTGTGCCAAmplicon SizecDNA: 177 bpgenomic: 4,933
Reverse (2527,22)TGGCTTTGAGACTCTCATTTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.606 kcal/mol
Forward Dimers-0.501 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-2.326 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCATGTGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTC
TGACTTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGC
TTCAAATAAAGTCCTGACACTATTCATTTGAGCCAGGAAATGAGAGTCTCAAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)642089 - 2152
Exon 16 To Exon 18 (Pair 12)
Forward (2315,21)AACAACACCCTGGTCTGGAAGAmplicon SizecDNA: 211 bpgenomic: 4,967
Reverse (2525,22)GCTTTGAGACTCTCATTTCCTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCA
AACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACT
GCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACTATT
CATTTGAGCCAGGAAATGAGAGTCTCAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)982053 - 2150
Exon 16 To Exon 17 (Pair 15)
Forward (2316,21)ACAACACCCTGGTCTGGAAGTAmplicon SizecDNA: 180 bpgenomic: 3,265
Reverse (2495,24)GAATAGTGTCAGGACTTTATTTGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.5 kcal/mol
Reverse Dimers-0.998 kcal/mol
Forward-Reverse Dimers-2.391 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAA
ACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTG
CATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACTATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1802054 - 2233
Exon 16 To Exon 17 (Pair 16)
Forward (2295,20)CGGCAGGAGTCATGGGAGAAAmplicon SizecDNA: 201 bpgenomic: 3,286
Reverse (2495,24)GAATAGTGTCAGGACTTTATTTGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.9 kcal/mol in 3' area
Forward Dimers-0.998 kcal/mol
Reverse Loops1.5 kcal/mol
Reverse Dimers-0.998 kcal/mol
Forward-Reverse Dimers-2.589 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCGGCAGGAGTCATGGGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATG
TGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGAC
TTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCA
AATAAAGTCCTGACACTATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)2012033 - 2233
Exon 16 To Exon 17 (Pair 17)
Forward (2328,20)TCTGGAAGTACGCAGACGCCAmplicon SizecDNA: 101 bpgenomic: 3,186
Reverse (2428,22)AGTGGGAGACTAAAGTCAGACANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.638 kcal/mol in 3' area
Forward Dimers-0.74 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-1.671 kcal/mol
Forward-Reverse Dimers-1.75 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGCACCTACG
GGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1012066 - 2166
Exon 16 To Exon 17 (Pair 18)
Forward (2328,20)TCTGGAAGTACGCAGACGCCAmplicon SizecDNA: 88 bpgenomic: 3,173
Reverse (2415,24)AGTCAGACAGTGAAGATTTATTAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.638 kcal/mol in 3' area
Forward Dimers-0.74 kcal/mol
Reverse Loops1.212 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-1.145 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGCACCTACG
GGTCCTAATAAATCTTCACTGTCTGACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)882066 - 2153
Exon 16 To Exon 17 (Pair 19)
Forward (2358,20)GCCACCTGTGCCATCCAAACAmplicon SizecDNA: 116 bpgenomic: 3,201
Reverse (2473,24)GAAGCAAAGGGAGAAATTGAAATTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.039 kcal/mol
Reverse Dimers-0.802 kcal/mol
Forward-Reverse Dimers-2.82 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTT
AGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1162096 - 2211
Exon 16 To Exon 18 (Pair 13)
Forward (2321,20)ACCCTGGTCTGGAAGTACGCAmplicon SizecDNA: 206 bpgenomic: 4,962
Reverse (2526,22)GGCTTTGAGACTCTCATTTCCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.678 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-1.817 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGC
ACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTGCATTT
CCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACTATTCATTTG
AGCCAGGAAATGAGAGTCTCAAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)932059 - 2151
Exon 16 To Exon 17 (Pair 20)
Forward (2328,20)TCTGGAAGTACGCAGACGCCAmplicon SizecDNA: 99 bpgenomic: 3,184
Reverse (2426,22)TGGGAGACTAAAGTCAGACAGTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.638 kcal/mol in 3' area
Forward Dimers-0.74 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-1.671 kcal/mol
Forward-Reverse Dimers-1.75 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGCACCTACG
GGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)992066 - 2164
Exon 16 To Exon 17 (Pair 21)
Forward (2295,20)CGGCAGGAGTCATGGGAGAAAmplicon SizecDNA: 183 bpgenomic: 3,268
Reverse (2477,24)ATTTGAAGCAAAGGGAGAAATTGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.9 kcal/mol in 3' area
Forward Dimers-0.998 kcal/mol
Reverse Loops1.039 kcal/mol in 3' area
Reverse Dimers-0.819 kcal/mol
Forward-Reverse Dimers-1.007 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCGGCAGGAGTCATGGGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATG
TGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGAC
TTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCA
AAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1832033 - 2215
Exon 16 To Exon 17 (Pair 22)
Forward (2356,20)GTGCCACCTGTGCCATCCAAAmplicon SizecDNA: 119 bpgenomic: 3,204
Reverse (2474,24)TGAAGCAAAGGGAGAAATTGAAATNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.039 kcal/mol
Reverse Dimers-0.802 kcal/mol
Forward-Reverse Dimers-2.82 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACT
TTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1192094 - 2212
Exon 16 To Exon 18 (Pair 14)
Forward (2356,20)GTGCCACCTGTGCCATCCAAAmplicon SizecDNA: 172 bpgenomic: 4,928
Reverse (2527,22)TGGCTTTGAGACTCTCATTTCCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-2.326 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACT
TTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAA
ATAAAGTCCTGACACTATTCATTTGAGCCAGGAAATGAGAGTCTCAAAGCCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
() -
Exon 16 To Exon 17 (Pair 23)
Forward (2320,20)CACCCTGGTCTGGAAGTACGAmplicon SizecDNA: 105 bpgenomic: 3,190
Reverse (2424,22)GGAGACTAAAGTCAGACAGTGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-1.671 kcal/mol
Forward-Reverse Dimers-2.368 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTG
CACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1052058 - 2162
Exon 16 To Exon 17 (Pair 24)
Forward (2358,20)GCCACCTGTGCCATCCAAACAmplicon SizecDNA: 108 bpgenomic: 3,193
Reverse (2465,24)GGGAGAAATTGAAATTGTAGAAAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.026 kcal/mol
Reverse Loops1.039 kcal/mol
Reverse Dimers-0.802 kcal/mol
Forward-Reverse Dimers-1.147 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTT
AGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1082096 - 2203
Exon 16 To Exon 17 (Pair 25)
Forward (2320,20)CACCCTGGTCTGGAAGTACGAmplicon SizecDNA: 100 bpgenomic: 3,185
Reverse (2419,24)CTAAAGTCAGACAGTGAAGATTTANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.212 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-2.368 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTG
CACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1002058 - 2157
Exon 16 To Exon 17 (Pair 26)
Forward (2318,21)AACACCCTGGTCTGGAAGTACAmplicon SizecDNA: 178 bpgenomic: 3,263
Reverse (2495,24)GAATAGTGTCAGGACTTTATTTGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.5 kcal/mol
Reverse Dimers-0.998 kcal/mol
Forward-Reverse Dimers-2.391 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAAC
TGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTGCA
TTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACTATTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1782056 - 2233
Exon 16 To Exon 18 (Pair 15)
Forward (2353,20)TGTGTGCCACCTGTGCCATCAmplicon SizecDNA: 173 bpgenomic: 4,929
Reverse (2525,22)GCTTTGAGACTCTCATTTCCTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.606 kcal/mol
Forward Dimers-0.501 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-0.754 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceTGTGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTG
ACTTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTT
CAAATAAAGTCCTGACACTATTCATTTGAGCCAGGAAATGAGAGTCTCAAAGC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)602091 - 2150
Exon 16 To Exon 17 (Pair 27)
Forward (2321,20)ACCCTGGTCTGGAAGTACGCAmplicon SizecDNA: 171 bpgenomic: 3,256
Reverse (2491,23)AGTGTCAGGACTTTATTTGAAGCNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.678 kcal/mol
Reverse Loops1.73 kcal/mol
Reverse Dimers-0.768 kcal/mol
Forward-Reverse Dimers-2.391 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGC
ACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTGCATTT
CCTTTCTACAATTTCAATTTCTCCCTTTGCTTCAAATAAAGTCCTGACACT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1712059 - 2229
Exon 16 To Exon 17 (Pair 28)
Forward (2353,20)TGTGTGCCACCTGTGCCATCAmplicon SizecDNA: 141 bpgenomic: 3,226
Reverse (2493,24)ATAGTGTCAGGACTTTATTTGAAGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.606 kcal/mol
Forward Dimers-0.501 kcal/mol
Reverse Loops1.5 kcal/mol
Reverse Dimers-0.998 kcal/mol
Forward-Reverse Dimers-2.574 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceTGTGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTG
ACTTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTT
CAAATAAAGTCCTGACACTAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1412091 - 2231
Exon 16 To Exon 17 (Pair 29)
Forward (2321,20)ACCCTGGTCTGGAAGTACGCAmplicon SizecDNA: 101 bpgenomic: 3,186
Reverse (2421,23)GACTAAAGTCAGACAGTGAAGATNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.678 kcal/mol
Reverse Loops1.069 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-2.368 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGC
ACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGTC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1012059 - 2159
Exon 16 To Exon 18 (Pair 16)
Forward (2351,20)CATGTGTGCCACCTGTGCCAAmplicon SizecDNA: 176 bpgenomic: 4,932
Reverse (2526,22)GGCTTTGAGACTCTCATTTCCTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.606 kcal/mol
Forward Dimers-0.501 kcal/mol
Reverse Loops1.107 kcal/mol
Reverse Dimers-1.129 kcal/mol
Forward-Reverse Dimers-1.729 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCATGTGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTC
TGACTTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGC
TTCAAATAAAGTCCTGACACTATTCATTTGAGCCAGGAAATGAGAGTCTCAAAGCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201284 (EGFR)632089 - 2151
Exon 16 To Exon 17 (Pair 30)
Forward (2295,20)CGGCAGGAGTCATGGGAGAAAmplicon SizecDNA: 202 bpgenomic: 3,287
Reverse (2496,24)TGAATAGTGTCAGGACTTTATTTGNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.9 kcal/mol in 3' area
Forward Dimers-0.998 kcal/mol
Reverse Loops1.5 kcal/mol
Reverse Dimers-0.998 kcal/mol
Forward-Reverse Dimers-2.589 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCGGCAGGAGTCATGGGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATG
TGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGAC
TTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCA
AATAAAGTCCTGACACTATTCA
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)2022033 - 2234
Exon 16 To Exon 17 (Pair 31)
Forward (2295,20)CGGCAGGAGTCATGGGAGAAAmplicon SizecDNA: 188 bpgenomic: 3,273
Reverse (2482,24)ACTTTATTTGAAGCAAAGGGAGAANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.9 kcal/mol in 3' area
Forward Dimers-0.998 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers-0.823 kcal/mol
Forward-Reverse Dimers-1.339 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCGGCAGGAGTCATGGGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATG
TGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGAC
TTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCA
AATAAAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1882033 - 2220
Exon 16 To Exon 17 (Pair 32)
Forward (2328,20)TCTGGAAGTACGCAGACGCCAmplicon SizecDNA: 150 bpgenomic: 3,235
Reverse (2477,24)ATTTGAAGCAAAGGGAGAAATTGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops0.638 kcal/mol in 3' area
Forward Dimers-0.74 kcal/mol
Reverse Loops1.039 kcal/mol in 3' area
Reverse Dimers-0.819 kcal/mol
Forward-Reverse Dimers-0.848 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGCACCTACG
GGTCCTAATAAATCTTCACTGTCTGACTTTAGTCTCCCACTAAAACTGCATTTCCTTTCT
ACAATTTCAATTTCTCCCTTTGCTTCAAAT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1502066 - 2215
Exon 16 To Exon 17 (Pair 33)
Forward (2321,20)ACCCTGGTCTGGAAGTACGCAmplicon SizecDNA: 99 bpgenomic: 3,184
Reverse (2419,24)CTAAAGTCAGACAGTGAAGATTTANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.351 kcal/mol
Forward Dimers-0.678 kcal/mol
Reverse Loops1.212 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-2.368 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTGC
ACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)992059 - 2157
Exon 16 To Exon 17 (Pair 34)
Forward (2355,20)TGTGCCACCTGTGCCATCCAAmplicon SizecDNA: 127 bpgenomic: 3,212
Reverse (2481,24)CTTTATTTGAAGCAAAGGGAGAAANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.825 kcal/mol
Forward Dimers-0.501 kcal/mol
Reverse Loops1.576 kcal/mol
Reverse Dimers-0.819 kcal/mol
Forward-Reverse Dimers-2.82 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceTGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGAC
TTTAGTCTCCCACTAAAACTGCATTTCCTTTCTACAATTTCAATTTCTCCCTTTGCTTCA
AATAAAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1272093 - 2219
Exon 16 To Exon 17 (Pair 35)
Forward (2317,21)CAACACCCTGGTCTGGAAGTAAmplicon SizecDNA: 103 bpgenomic: 3,188
Reverse (2419,24)CTAAAGTCAGACAGTGAAGATTTANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.212 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-2.368 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAA
CTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAG
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1032055 - 2157
Exon 16 To Exon 17 (Pair 36)
Forward (2320,20)CACCCTGGTCTGGAAGTACGAmplicon SizecDNA: 101 bpgenomic: 3,186
Reverse (2420,24)ACTAAAGTCAGACAGTGAAGATTTNr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.232 kcal/mol
Forward Dimers-1.528 kcal/mol
Reverse Loops1.212 kcal/mol
Reverse Dimers-1.63 kcal/mol
Forward-Reverse Dimers-2.368 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCACCCTGGTCTGGAAGTACGCAGACGCCGGCCATGTGTGCCACCTGTGCCATCCAAACTG
CACCTACGGGTCCTAATAAATCTTCACTGTCTGACTTTAGT
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1012058 - 2158
Exon 16 To Exon 17 (Pair 37)
Forward (2295,20)CGGCAGGAGTCATGGGAGAAAmplicon SizecDNA: 130 bpgenomic: 3,215
Reverse (2424,22)GGAGACTAAAGTCAGACAGTGANr. of Isoforms 1 out of 4 (by amplicon BlastN)
Folding EnergiesForward Loops1.9 kcal/mol in 3' area
Forward Dimers-0.998 kcal/mol
Reverse Loops0.756 kcal/mol
Reverse Dimers-1.671 kcal/mol
Forward-Reverse Dimers-2.152 kcal/mol
Amplicon Folding-0.082 kcal/mol outside primersite
Amplicon SequenceCGGCAGGAGTCATGGGAGAAAACAACACCCTGGTCTGGAAGTACGCAGACGCCGGCCATG
TGTGCCACCTGTGCCATCCAAACTGCACCTACGGGTCCTAATAAATCTTCACTGTCTGAC
TTTAGTCTCC
All Amplified targets
 (by primer blast)
TranscriptSizePosition on transcript
NM_201282 (EGFR)1302033 - 2162
 

See below for some more details.

Program Output:

Loading ...